ID: 1127882380

View in Genome Browser
Species Human (GRCh38)
Location 15:63169717-63169739
Sequence TTGTGTCATAGGGAAGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127882380_1127882388 21 Left 1127882380 15:63169717-63169739 CCATCCACTTCCCTATGACACAA No data
Right 1127882388 15:63169761-63169783 TAGGAGAAAACATTATTTTAGGG No data
1127882380_1127882385 -9 Left 1127882380 15:63169717-63169739 CCATCCACTTCCCTATGACACAA No data
Right 1127882385 15:63169731-63169753 ATGACACAAGAAGGTATATCAGG No data
1127882380_1127882387 20 Left 1127882380 15:63169717-63169739 CCATCCACTTCCCTATGACACAA No data
Right 1127882387 15:63169760-63169782 CTAGGAGAAAACATTATTTTAGG No data
1127882380_1127882386 2 Left 1127882380 15:63169717-63169739 CCATCCACTTCCCTATGACACAA No data
Right 1127882386 15:63169742-63169764 AGGTATATCAGGAAGTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127882380 Original CRISPR TTGTGTCATAGGGAAGTGGA TGG (reversed) Intergenic
No off target data available for this crispr