ID: 1127890217

View in Genome Browser
Species Human (GRCh38)
Location 15:63243684-63243706
Sequence CAGAATTTGGGGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 589}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127890209_1127890217 1 Left 1127890209 15:63243660-63243682 CCTTGACTAATTAAGTCACAATC 0: 1
1: 0
2: 6
3: 46
4: 328
Right 1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 43
4: 589
1127890206_1127890217 12 Left 1127890206 15:63243649-63243671 CCAGGTCCCATCCTTGACTAATT 0: 1
1: 0
2: 0
3: 34
4: 433
Right 1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 43
4: 589
1127890204_1127890217 19 Left 1127890204 15:63243642-63243664 CCAGTGCCCAGGTCCCATCCTTG 0: 1
1: 1
2: 1
3: 36
4: 304
Right 1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 43
4: 589
1127890205_1127890217 13 Left 1127890205 15:63243648-63243670 CCCAGGTCCCATCCTTGACTAAT 0: 1
1: 0
2: 3
3: 14
4: 169
Right 1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 43
4: 589
1127890208_1127890217 5 Left 1127890208 15:63243656-63243678 CCATCCTTGACTAATTAAGTCAC 0: 1
1: 0
2: 2
3: 22
4: 157
Right 1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 43
4: 589
1127890207_1127890217 6 Left 1127890207 15:63243655-63243677 CCCATCCTTGACTAATTAAGTCA 0: 1
1: 0
2: 0
3: 20
4: 183
Right 1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG 0: 1
1: 0
2: 5
3: 43
4: 589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127890217 Original CRISPR CAGAATTTGGGGAAGGGGGC AGG Intronic
900035297 1:402694-402716 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900056918 1:638447-638469 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900646847 1:3712932-3712954 CAGAGGGTGGGGCAGGGGGCAGG - Intronic
900806687 1:4772247-4772269 AAGAGTTTGGGGTAGGGGGACGG - Intronic
901211068 1:7526385-7526407 CAGACTGTGGGGTGGGGGGCAGG - Intronic
901329061 1:8390516-8390538 CAGAACTTGGGGAAGGAAGAAGG + Intronic
901529641 1:9844817-9844839 CAGGTTTTGGGGAAGGCGGAGGG + Intergenic
902559311 1:17267134-17267156 GAGAATTTGGGGAAAAGGCCTGG - Intronic
903862292 1:26372057-26372079 CAGAATTTGTGTAAGGCCGCAGG - Intronic
903979576 1:27176280-27176302 CAGCATTGGGGGTTGGGGGCTGG - Intergenic
904939111 1:34152453-34152475 GAGGATTTGGAGAAGGGGGATGG - Intronic
905589105 1:39146689-39146711 CAGAAGTTGGGAAGGGGGGATGG + Intronic
905909464 1:41643851-41643873 CACAATTTGGGGAGGGGGTGAGG - Intronic
906960737 1:50418376-50418398 CAGCCTTTTGGAAAGGGGGCCGG + Exonic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908179251 1:61587936-61587958 CAGAAAGCGGGGAATGGGGCTGG - Intergenic
908236165 1:62149187-62149209 CAGAATTTTGGGATGTGGCCTGG - Intronic
908796311 1:67833640-67833662 GAGAATTAGAGGAAGGGGGATGG - Intergenic
909122039 1:71615641-71615663 GAGAAGGTGGGGCAGGGGGCTGG + Intronic
911023603 1:93413286-93413308 TTGAATTTGGGGGAGGGGGTTGG + Intergenic
911150686 1:94594723-94594745 CAGAGTTTGGGAAAGGAGGAAGG - Intergenic
911218905 1:95226189-95226211 CAGATTATGTTGAAGGGGGCAGG - Intronic
911598305 1:99821513-99821535 AAGAATTTGGGTAAGGGGAAAGG + Intergenic
912383808 1:109261485-109261507 CAGGAGTTGGGGATGGGGGCAGG - Intronic
912387448 1:109278892-109278914 TAGAAATTGGAGCAGGGGGCTGG + Intergenic
912502189 1:110129981-110130003 GAGCATATGGGGAAGGTGGCGGG + Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912688036 1:111782311-111782333 CTAAATGTGGGGAAGGGGCCAGG + Intronic
912706454 1:111918596-111918618 GAGGATTTGGGGAAGGGGAGAGG + Intronic
913011139 1:114684995-114685017 CAGGAGTTGGGAATGGGGGCAGG - Intronic
913144112 1:115972470-115972492 ATGAATTTGGGTGAGGGGGCAGG - Intergenic
914302071 1:146386084-146386106 CAGAATTGGGGGCGGGGGGGGGG - Intergenic
914866049 1:151430023-151430045 CAGAAGTGGGGGTGGGGGGCAGG + Intronic
914998660 1:152566592-152566614 CAGCAATGGGGGAAGGGGGCAGG - Intronic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
915342867 1:155185760-155185782 CAGAATGTGTGTGAGGGGGCTGG - Intronic
915448758 1:155990129-155990151 CTGACTTTGGGGAAGTGGTCAGG + Intronic
915566198 1:156714471-156714493 ATGAATTTGGGGGAGGTGGCTGG - Intergenic
915910216 1:159910345-159910367 GGGAATGTGGGGAAGGGGGTTGG - Intergenic
916507216 1:165439247-165439269 CAGATTTTAGGGGAGGGGGGCGG + Intronic
918105030 1:181409584-181409606 CAGAATTTGGGGATTGGAGGGGG + Intergenic
918246637 1:182666125-182666147 AAAAATGTGGGGAAGGGTGCAGG + Intronic
918859395 1:189802558-189802580 CAAAATTTCTGGAAGGAGGCCGG - Intergenic
918935604 1:190916696-190916718 CACATGTTGTGGAAGGGGGCTGG + Intergenic
918997828 1:191784831-191784853 CCAAATTTGGCAAAGGGGGCTGG - Intergenic
920823245 1:209401035-209401057 CATAATTTCAGGATGGGGGCTGG - Intergenic
921016527 1:211197307-211197329 AAGAATTTGGTCAGGGGGGCCGG + Intergenic
922257827 1:223908254-223908276 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
923098387 1:230793447-230793469 CAGCCTTTGGGTAAGGGAGCAGG - Intronic
923137604 1:231132154-231132176 CGTATTTTGGAGAAGGGGGCAGG - Intergenic
923795342 1:237148928-237148950 CAAAATTTGGGGTAGGGGGCTGG - Intronic
924099791 1:240591434-240591456 CAGCATTTGATGAAGGGGGCTGG + Intronic
924339025 1:243011033-243011055 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
924385627 1:243496233-243496255 CAGGATGTGTGGATGGGGGCAGG + Intronic
924651630 1:245933941-245933963 CAGTAATTGGGGGAGGGGGCTGG - Intronic
1064348714 10:14557041-14557063 GAGAAGTGTGGGAAGGGGGCTGG - Intronic
1064614109 10:17134941-17134963 CAGAGGTTGGGGGAGGGGGAGGG + Intergenic
1064654734 10:17545851-17545873 CAGAAGTTGGGAAAGGGAACAGG + Intergenic
1065133451 10:22644998-22645020 CAGCATAGGGGGAAGGGGGTAGG - Intronic
1065379275 10:25073069-25073091 CAGGGTTTGGGGGAGGGGGTTGG + Intergenic
1065379916 10:25079520-25079542 AAAAATTTGGGGAAGGGAGATGG - Intergenic
1066183998 10:32991207-32991229 CAGAATTTGTGGAAGAGAGCTGG - Intronic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1067016349 10:42758608-42758630 CAGGAGTTGGTGAAGGGGACAGG - Intergenic
1067460298 10:46453235-46453257 AAGAATATGGGGAAGGAGACAGG - Intergenic
1067626892 10:47931368-47931390 AAGAATATGGGGAAGGAGACAGG + Intergenic
1068183317 10:53551060-53551082 CAGAAGTGGGGGAGGGGGGGAGG - Intergenic
1069676526 10:70252831-70252853 CAGCATTTGAGGCTGGGGGCGGG - Exonic
1069698278 10:70404032-70404054 CTGAAGTTGTTGAAGGGGGCGGG - Intergenic
1069745106 10:70710050-70710072 CAGATGCTGGGGATGGGGGCCGG + Intronic
1070311259 10:75275724-75275746 CAGACTGAGGGCAAGGGGGCTGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071335993 10:84601001-84601023 CAGAATTTGGAGGAGCTGGCAGG - Intergenic
1071689913 10:87806093-87806115 CAGAATTTGGGGAAGTTTGTGGG - Intronic
1072100534 10:92225267-92225289 CAGAAAATGGGGTAGGAGGCTGG - Intronic
1072118894 10:92388831-92388853 CAGATTTTTGGGAAAGGGGGTGG + Intergenic
1072335625 10:94395611-94395633 CAGAAATGGGGGAAGGGTCCTGG - Intergenic
1072412631 10:95217517-95217539 AAGAATTTGTGGTGGGGGGCAGG + Intronic
1072614658 10:97041429-97041451 CAGAGTTGGGGCATGGGGGCCGG + Intronic
1073762764 10:106648719-106648741 CAGAAGTGGGGGAAGGGCGTTGG + Intronic
1074488845 10:113919683-113919705 TTGAATTTGGGGAAGGGGGTAGG + Intergenic
1075008591 10:118848941-118848963 CAGAAATTGGGCAAAGGGCCTGG + Intergenic
1075383868 10:122040433-122040455 CAGGATTTGGGGCTGTGGGCTGG - Intronic
1075711670 10:124534018-124534040 CAGAGTTTGGGGATTGGGGCGGG + Intronic
1076801432 10:132832385-132832407 CAGCATTGGGGGGGGGGGGCAGG - Intronic
1077063114 11:626367-626389 CTGCATTTGGGGTGGGGGGCAGG - Intergenic
1077221897 11:1421673-1421695 CAGGAGCTGGGGCAGGGGGCAGG - Intronic
1077632449 11:3819976-3819998 CAGAGTTTGGGGAAGGCCTCAGG - Intronic
1077913294 11:6593184-6593206 CAGAATGTGGGGGTGGGGGTGGG - Intronic
1077914761 11:6603944-6603966 CAGAGTTGGGGGAAGTGGGGAGG - Exonic
1077971136 11:7192426-7192448 CAGGGTGTGGGGATGGGGGCAGG - Intergenic
1078024647 11:7683272-7683294 CAGAATTTGGGGTCGGGGCGGGG - Intergenic
1078100535 11:8327930-8327952 CAGAATGTGGGGAAAGGGAAGGG + Intergenic
1078935946 11:15950311-15950333 CTGAATCTGAGGAAGGGGCCTGG - Intergenic
1079243496 11:18737156-18737178 CAGAACTTGGCGAGGGTGGCAGG + Intronic
1080044670 11:27796774-27796796 CAGTACTTGGGGAAGGGTGGAGG - Intergenic
1080223429 11:29933842-29933864 ATGAATTTGGGGAAAGGGTCAGG - Intergenic
1080298973 11:30762876-30762898 CAGAATTTGGTGATGGGGTGGGG - Intergenic
1080750702 11:35147598-35147620 AAAAGTTGGGGGAAGGGGGCTGG - Intronic
1081542817 11:44048543-44048565 GAGAATTTGGGGTGGGGGGTGGG + Intronic
1081660785 11:44887189-44887211 CAGAGGTTGGGGCATGGGGCAGG - Intronic
1081799760 11:45849918-45849940 CAGAACTGGGAGAAAGGGGCTGG - Intronic
1082835496 11:57647759-57647781 TACATTTTGGGGAGGGGGGCAGG + Exonic
1082920797 11:58491317-58491339 CAGAATTTGAGGAGGGAGGGAGG + Intergenic
1083708963 11:64535920-64535942 CAGATTTTGGGGCAGGAGCCGGG + Intergenic
1083727834 11:64637563-64637585 CTGAATTTGGGGGGTGGGGCGGG + Intronic
1083732525 11:64660543-64660565 CAGGAGTTGGGGAAGAGGGAAGG + Intronic
1084550175 11:69836378-69836400 CACAATTTGGGGGAGGAGACGGG - Intergenic
1085056311 11:73406114-73406136 TAGAATTTGGGGGAGGGTGGGGG - Exonic
1085231196 11:74972454-74972476 CACACTTTGGAGGAGGGGGCGGG - Intronic
1085270117 11:75265270-75265292 CAGAGATGGGGGCAGGGGGCGGG - Exonic
1086338711 11:85825583-85825605 CAAGATTTGGGGAAGAGGGTTGG + Intergenic
1088379073 11:109173336-109173358 CAGAATTAGGGGAAGAAGGTTGG + Intergenic
1088920287 11:114255557-114255579 CACAACTCGGGGAAGTGGGCTGG - Intergenic
1090354996 11:126134300-126134322 CAGCAGTTGGGGTTGGGGGCAGG + Intergenic
1090669784 11:128938092-128938114 CTGAATTTGGGGAAAGGGGGTGG + Intronic
1093542106 12:20299342-20299364 CAGAATTTGGGTGAAGGGGGAGG - Intergenic
1094291583 12:28856373-28856395 GAGGAATTGGGGAAGGGGGGTGG + Intergenic
1094482423 12:30895415-30895437 AAGCATTTGGGGAAGGGCACAGG - Intergenic
1094754643 12:33453872-33453894 CAGGATCTGGGGAAGGGGGCAGG + Intergenic
1096072308 12:48782239-48782261 CAGAATGTGGGGCTGGAGGCAGG - Intronic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1096867029 12:54570743-54570765 CAGAACTGGGGGACGGGGGAGGG - Intronic
1096916570 12:55039790-55039812 CAGGATTTGGTGAGGGGGGAAGG - Intergenic
1097012502 12:55963251-55963273 CAGAGATTGGGGATGGGGACAGG + Intronic
1097242129 12:57582718-57582740 GAGCCTTTGGGGAAGGGGGAGGG + Intronic
1097265868 12:57744638-57744660 CAGAACAGGGGGAAGGGGGTGGG + Intronic
1099674840 12:85745434-85745456 CTGACCTTGTGGAAGGGGGCTGG + Intergenic
1099924726 12:89003488-89003510 TAGAATTTGGGGGAGGAGGGTGG + Intergenic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1100616072 12:96232615-96232637 CAGGAGATGGGGGAGGGGGCGGG + Intronic
1100650919 12:96587206-96587228 TGGAGTTTGGGGAAGGGGTCTGG + Intronic
1100721025 12:97358357-97358379 CAGAATTTGAGGAAGGTGAAGGG - Intergenic
1102096636 12:110246489-110246511 CAGAATTGGGGCAAGGGAGAAGG - Intergenic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102216155 12:111162748-111162770 TAGAATTTGGGGTAAGGGCCAGG + Intronic
1102230870 12:111261378-111261400 CAGAATCTTGGGGCGGGGGCGGG - Intronic
1102247557 12:111364938-111364960 AAGAATTTGGGGAAAGATGCAGG + Intronic
1102514616 12:113437977-113437999 CTGAAGTCAGGGAAGGGGGCAGG - Exonic
1102644844 12:114397146-114397168 ATGAATTTGGTCAAGGGGGCGGG - Intronic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1105489019 13:20869450-20869472 CTTAATTTGGGAAAGGGGGCTGG + Intronic
1106133297 13:26956940-26956962 GAGAATTTCGGGAAGGGGAGGGG - Intergenic
1106142025 13:27019596-27019618 CAGAATTTGGGGAATGGGACAGG - Intergenic
1106264210 13:28095567-28095589 AAGAATTTGGAGAGGGGGCCGGG - Intronic
1106391114 13:29336744-29336766 GAGCATCTGGGGAAAGGGGCAGG - Intronic
1107943319 13:45394245-45394267 CAGAAGGTGGGGGCGGGGGCGGG - Exonic
1108590452 13:51908297-51908319 CAGAATGTGGGGGTGGGGGTGGG + Intergenic
1110247416 13:73342290-73342312 CAGTATTTGGGGGAAGGTGCTGG + Intergenic
1110718758 13:78737930-78737952 CAAAATTTAGGGATGGGAGCGGG - Intergenic
1111441571 13:88287585-88287607 CTGAATTTGGGGAAGTGTCCGGG + Intergenic
1111509881 13:89247057-89247079 AAGAATTTGGGGAATTCGGCTGG - Intergenic
1113596954 13:111540198-111540220 CGGAACTTGGGGAGGGGGGACGG - Intergenic
1113771285 13:112910992-112911014 CAGAATTTGGGGGGTGGGGGCGG + Intronic
1114069099 14:19094168-19094190 CAGGAGTTGGTGAAGGGGACAGG + Intergenic
1114093161 14:19305835-19305857 CAGGAGTTGGTGAAGGGGACAGG - Intergenic
1114258171 14:21019816-21019838 CAGGATTTGGGGAAGGAAGAAGG - Intronic
1114322359 14:21557712-21557734 AAGAATTTGGGGGTGGGGGGAGG - Intergenic
1114648464 14:24268682-24268704 CAGAAGTTGGGGTCTGGGGCAGG - Intronic
1114654563 14:24308327-24308349 CAGAGTGTGGGGAAGTGGGATGG + Exonic
1114686012 14:24532396-24532418 AAGAGATTGGAGAAGGGGGCTGG - Intergenic
1115006477 14:28491685-28491707 ATGAATTTTGGGAAGGGGGCAGG - Intergenic
1115052883 14:29086126-29086148 AAGAATGTGGGGAAGGGGAGTGG - Intergenic
1115188465 14:30719949-30719971 CAGAATTGGGGGCAGGGGGGTGG + Intronic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1118266820 14:64302519-64302541 AACATTTTGGGGGAGGGGGCTGG - Intronic
1118608128 14:67518036-67518058 CAGAATTGTGGGAAGGGGTTGGG + Intronic
1119073741 14:71614713-71614735 CTGAATTTGGGGAATGGTGATGG - Intronic
1119759343 14:77140167-77140189 AAGGATTTGGGGTCGGGGGCAGG + Intronic
1119905201 14:78295661-78295683 CAGAATTTTGGGAAGGAGTGGGG - Intronic
1120587695 14:86334727-86334749 CACATGTTGGGGAAGGGGCCTGG - Intergenic
1120722943 14:87907191-87907213 AAGAATTGGGGGAGGGGGCCAGG - Intronic
1121445093 14:93973751-93973773 CAGAATATGGGTCAGGGGCCTGG - Intronic
1121882875 14:97515897-97515919 CAGGATTTGTGGATGGGGTCTGG + Intergenic
1122114938 14:99522904-99522926 CAGAATTTGGGGCTGGGGCTGGG + Intronic
1122126048 14:99579352-99579374 GAGAAGTGGGGGAGGGGGGCAGG + Intronic
1122465585 14:101931389-101931411 CAGAACTTGGGGGTGGGGGTGGG + Intergenic
1123191507 14:106576351-106576373 CAGAAGTTTGGGCAGGGGGTGGG + Intergenic
1123691022 15:22838495-22838517 TAGAGTGTGGGGACGGGGGCGGG - Intergenic
1123868816 15:24551026-24551048 CAAAATTTTGGGCAGAGGGCAGG + Intergenic
1125322267 15:38501093-38501115 CTGAATTTGGGGAAGAGTGTGGG - Intronic
1125343254 15:38695090-38695112 CAGAATTGGGGGGCGGGTGCGGG + Intergenic
1125533213 15:40427522-40427544 AAGACTTTGCGGGAGGGGGCAGG - Intronic
1126176805 15:45743399-45743421 CAGAAATTGGGAAAGGAGGCAGG - Intergenic
1126449821 15:48794036-48794058 AAGAATTTTGGGGAGGGAGCAGG + Intronic
1126853181 15:52811247-52811269 TAGGATTTGGGGAAGTGGGAGGG + Intergenic
1127264039 15:57346850-57346872 CAGAATCTGGGGTGGGGGGCAGG + Intergenic
1127816948 15:62619517-62619539 CACAATTTTGGCAGGGGGGCAGG - Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1127918186 15:63472485-63472507 TAGAAGGTGGGGAAGTGGGCTGG + Intergenic
1128995310 15:72290412-72290434 CAGGATCTGGGGAAGGGATCTGG + Intronic
1129171756 15:73812277-73812299 CAGGATCAGGGGATGGGGGCTGG - Intergenic
1129227125 15:74176503-74176525 CAGGATTGGGGGAATGGAGCTGG + Exonic
1129296321 15:74602245-74602267 GAGAACCTGGGGCAGGGGGCAGG - Intronic
1129324054 15:74790282-74790304 CAGAGTTTTGGCAAGGGGGAAGG + Intronic
1129712386 15:77826960-77826982 CAGAGTTTGGAAAGGGGGGCAGG - Intergenic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130955284 15:88623073-88623095 ACTAATTTGGGAAAGGGGGCTGG - Intronic
1131150486 15:90044423-90044445 CTGAGTGTGAGGAAGGGGGCCGG + Intronic
1131462166 15:92625149-92625171 CAGAGTTTGGGGAGGGAGGGAGG - Intronic
1131856858 15:96606267-96606289 GGGAGTTTGGGGAAGGGGTCAGG + Intergenic
1132257484 15:100389042-100389064 CAGATTTTGGGGGTGGGGGTGGG - Intergenic
1132266436 15:100476015-100476037 TAGAATTTGGGGCAGGGAGATGG + Intronic
1132841297 16:1979596-1979618 GAGAATGTGGAGAAGGGTGCGGG - Exonic
1133087253 16:3374606-3374628 CAGAATTGGGGGAAAGAAGCAGG + Intronic
1133421391 16:5650147-5650169 CAGGAGTTGGGGGTGGGGGCTGG - Intergenic
1133451074 16:5904496-5904518 CAGAATGTGGGGATGGTGGTGGG + Intergenic
1133713096 16:8420362-8420384 TTGAATTTGGAGATGGGGGCAGG + Intergenic
1133932079 16:10240810-10240832 CACACTGGGGGGAAGGGGGCAGG + Intergenic
1134765189 16:16751320-16751342 CACAAATTGGGAATGGGGGCTGG - Intergenic
1134980864 16:18607891-18607913 CACAAATTGGGAATGGGGGCTGG + Intergenic
1135170366 16:20178481-20178503 TAGAAGTTGGGGCTGGGGGCAGG - Intergenic
1135491785 16:22915660-22915682 CTCAAGTTGGGAAAGGGGGCTGG - Exonic
1137268429 16:46886610-46886632 GGGCATTTGGGGAAGGGGGCTGG + Intronic
1138084259 16:54119431-54119453 CAGAGTTGGGGGCAGGGGGAAGG - Exonic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140823935 16:78688672-78688694 CACAACTTGGGGAAGGGGCAAGG + Intronic
1140827122 16:78716931-78716953 CTGATCTTGGGAAAGGGGGCAGG - Intronic
1140997065 16:80271466-80271488 CAGAAGTTGGGAAAGAGGCCTGG + Intergenic
1142747969 17:1969652-1969674 CAGAATTTGAGTGAGGTGGCTGG + Intronic
1143186047 17:5011035-5011057 CAGAATGTGGGAAAGGGCGAGGG - Intronic
1143378219 17:6479662-6479684 CAGAATCTGGGGCAGGTGACAGG + Intronic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143634928 17:8159199-8159221 CAGAATTGGGGGCATGGGGTGGG + Exonic
1143912760 17:10265557-10265579 CAGAATTGGGGGGAGGAGGGGGG - Intergenic
1143972471 17:10805489-10805511 AATATTTTGGGGAAGGTGGCAGG + Intergenic
1144659628 17:17059783-17059805 CAGAATGTGGGGATGGGGAGTGG + Intronic
1146189971 17:30756475-30756497 CAGCACTTTGGGAAGGAGGCAGG - Intergenic
1146306379 17:31732879-31732901 CAGCAGGTGGGGTAGGGGGCAGG - Intergenic
1146334872 17:31960824-31960846 CAGCACTTTGGGAAGGAGGCAGG - Intronic
1146435990 17:32848323-32848345 AAGAATTAGGGGAAAGGGGCAGG + Intronic
1146785848 17:35720724-35720746 AAAAATATGGGGCAGGGGGCGGG - Intronic
1147114217 17:38286770-38286792 CAGAAGTTTGGGAAAGGGGGAGG - Intergenic
1147168184 17:38604416-38604438 CAACATTTGAGGAGGGGGGCTGG + Intronic
1147293329 17:39461471-39461493 CGGCACTTGGGGAAGGGGGGAGG - Intergenic
1147592830 17:41695914-41695936 CAGCGTGTGGGGATGGGGGCAGG - Intergenic
1147743659 17:42682553-42682575 CAGAGGCTGGGGAAGGGGGGAGG + Intronic
1147924166 17:43936347-43936369 AAGAGCTTGGGGATGGGGGCTGG + Intergenic
1148050562 17:44768081-44768103 CAGCATTGGGGCAAGGGGTCTGG + Intronic
1148128093 17:45247134-45247156 CAGCATTTGGGGGAAGGGGCGGG - Exonic
1148244478 17:46021448-46021470 CAGACTGTGGGGATGGGGCCAGG - Intronic
1148415389 17:47502420-47502442 CAGAAGTTTGGGAAAGGGGGAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149008868 17:51834390-51834412 GAGAATCTGAGGAAGGAGGCAGG - Intronic
1149367726 17:55962681-55962703 CAGAATTTGGGGACTTTGGCTGG + Intergenic
1149397348 17:56258523-56258545 CAGAATTTGGAATAAGGGGCTGG + Intronic
1149867808 17:60160465-60160487 GAGAATTCAGGGCAGGGGGCCGG + Intronic
1150133422 17:62681147-62681169 CAGCAGATGTGGAAGGGGGCTGG + Intronic
1151562311 17:74877186-74877208 AAGAATTTGTAGGAGGGGGCTGG - Intergenic
1152664505 17:81559471-81559493 CAGAGTGTGGGCATGGGGGCAGG + Intronic
1152922561 17:83073244-83073266 CAGGGTTTGGGGAAGGGTGTCGG - Intergenic
1153630528 18:7064985-7065007 CAGCACTTTGGGAGGGGGGCAGG + Intronic
1154393851 18:13969117-13969139 CTGAATTTGGGGCAGAGGTCGGG + Intergenic
1154411760 18:14145607-14145629 CAGGATTTTGGGGAGGGGGCAGG - Intergenic
1154946552 18:21167406-21167428 GAGACTATGGGGAAGAGGGCAGG - Intergenic
1156472797 18:37388049-37388071 CAGGAGTTGGGGGAGGGGGGAGG + Intronic
1156966060 18:43093979-43094001 CAGAATTTGGAGAGAGGAGCAGG + Intronic
1157279944 18:46340237-46340259 GAGAATTGGGGGAAAGGGGAGGG + Intronic
1157511512 18:48278722-48278744 CAGAATTTGAGGAGGATGGCTGG - Intronic
1158689254 18:59645652-59645674 TAGAATATGGGGGAGGGTGCTGG - Intronic
1160524448 18:79526718-79526740 GGGAATTTGGGGAAGGGAGTGGG + Intronic
1161104112 19:2434740-2434762 CAGAAGTTGGGCCAGGGGGACGG + Intronic
1161440958 19:4291410-4291432 CAGAAGTAGGGGAGGGGAGCTGG + Intergenic
1162576295 19:11500949-11500971 CAGAAGTTGGAGAAGTGGACAGG - Intronic
1162582848 19:11540912-11540934 CATAGTTGGGGGATGGGGGCTGG - Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1162781081 19:13007271-13007293 GGGAATTTGGGGGTGGGGGCCGG + Intronic
1162964391 19:14149122-14149144 TAGAGTTGAGGGAAGGGGGCTGG + Exonic
1162993360 19:14317749-14317771 TAAGATTTGGGGAAGGGGGATGG + Intergenic
1163428006 19:17249780-17249802 CAGATTTTCCTGAAGGGGGCCGG - Exonic
1163561542 19:18022220-18022242 CAGAAAGTGGGGCAGGGAGCCGG - Intergenic
1164076795 19:21826589-21826611 CAGCACTTTGGGAAGGAGGCAGG + Intronic
1165542135 19:36500486-36500508 CAGAACCTGGGGAAGGGAGTGGG - Intergenic
1165935055 19:39384049-39384071 CAGAATGTGGGGAATGGTGAAGG - Exonic
1166323538 19:42034846-42034868 CAGCAGTTGGGGCGGGGGGCGGG + Intronic
1167387425 19:49171957-49171979 CAGGAGTTGGGGATGGAGGCGGG + Intronic
1167609574 19:50500738-50500760 CAGAATATGGGGGTTGGGGCAGG + Intergenic
1167774195 19:51544199-51544221 CGGATTCTGGGGAAGGGGACGGG + Intergenic
1167805075 19:51776911-51776933 CAGAAATTGGGAAGGGTGGCAGG + Intronic
1167915901 19:52739868-52739890 CACAATTTGGGGGCGGGGCCTGG - Intergenic
1168651870 19:58097209-58097231 CAGAAATGGGGGAAGCGGGGAGG + Intronic
925139451 2:1539861-1539883 CAGTATTTGGGGAATGGGGGCGG + Intronic
925509862 2:4613336-4613358 ATGAATTTAGGGATGGGGGCAGG + Intergenic
925517134 2:4695409-4695431 CAAAAGTGGGAGAAGGGGGCAGG + Intergenic
925930774 2:8706118-8706140 AATAATTTAGGGAAGGAGGCGGG + Intergenic
926874734 2:17462813-17462835 CTGAATTTGTGGAAGAGTGCAGG - Intergenic
927383891 2:22510890-22510912 TTGAATTTGGGGAAGAGGGTGGG - Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
928694557 2:33836214-33836236 CAGGAGTAGGGGAAGAGGGCAGG + Intergenic
928875115 2:36029103-36029125 CAGAAGTTGGGGATGGGGTGGGG - Intergenic
928935889 2:36677557-36677579 CAAAATTAGGGGAAGAGGGAGGG + Intergenic
929578482 2:43067653-43067675 CAGGTGTTGGGGGAGGGGGCGGG - Intergenic
929582002 2:43087147-43087169 CAGACTTGGGGTGAGGGGGCAGG + Intergenic
929722951 2:44389355-44389377 AAGAATTTGGGGAAAGTGGGAGG + Intronic
930144044 2:47982928-47982950 CAGAAATGGGGGAAGGGGCTTGG + Intergenic
930376007 2:50567410-50567432 CAGAACTTGGGTGAGGGGTCAGG + Intronic
931511761 2:63004875-63004897 CAGAATGTGGGTAAGGGGGTGGG - Intronic
931694945 2:64864766-64864788 TAGAATTGGGTGGAGGGGGCTGG - Intergenic
931828747 2:66028642-66028664 CAGAACTTTGGGAAGAGGCCTGG - Intergenic
932333627 2:70916533-70916555 CAGGATTTGGGGATGGAGGAAGG - Intronic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
932463996 2:71901785-71901807 CTGAATTGGGGGAAGGGCCCTGG - Intergenic
934085857 2:88508973-88508995 CAGAATTTGATGAGGGAGGCTGG - Intergenic
934475983 2:94593817-94593839 TGGAGTTTGGGGAAGGTGGCGGG - Intronic
935466604 2:103405799-103405821 CAGAATTTGAGGAAGGATGGAGG + Intergenic
936099444 2:109562367-109562389 GAGAGTTGGGGGAGGGGGGCAGG - Intronic
936790016 2:116140271-116140293 AAAAAATTGGGGAAGGGGGGAGG + Intergenic
937094114 2:119224491-119224513 CAAATTTCGGGGAAGTGGGCAGG - Intronic
937410364 2:121669711-121669733 CAGAATTTGGGCAGGGTCGCAGG + Intergenic
938046918 2:128129962-128129984 GAGAATGTGGGGAATAGGGCTGG + Intronic
938743914 2:134259366-134259388 CAGAATTTGGGTCAGGCTGCTGG - Intronic
939815405 2:146890152-146890174 CATAATTTGGGAAATGGGGTTGG - Intergenic
940398401 2:153220362-153220384 CAGGAATTGGGCAAGTGGGCTGG + Intergenic
940650225 2:156435003-156435025 TAAAATTGGGGGGAGGGGGCAGG - Intergenic
940726155 2:157339080-157339102 AAGACTTGGGGGAAGGGGGTGGG - Intergenic
940750680 2:157624203-157624225 AAGATTTTGGGGAAGGGGCTTGG - Intronic
941051696 2:160741794-160741816 GAGTATTGGGGAAAGGGGGCTGG - Intergenic
941507453 2:166365152-166365174 TACTATTTGGGGCAGGGGGCAGG - Intronic
941693516 2:168526845-168526867 CAGAATTTGTTGAAGGCTGCTGG - Intronic
942339373 2:174927079-174927101 CAGATATTGGGGAAGGAGGAAGG - Intronic
942552805 2:177137362-177137384 CAGAAGATGGGGAAAGGGGCTGG - Intergenic
942762200 2:179412327-179412349 GAGAAATTGGAGAAGGGGGAGGG - Intergenic
943581350 2:189687128-189687150 CAGAAGCTGGGAAAGGTGGCAGG - Intronic
943601744 2:189929871-189929893 AAGAATTTGGGGATGGGGAGGGG + Intronic
943623460 2:190175036-190175058 CAGAATTTGGTGGTGGGGGTAGG + Intronic
945130153 2:206562546-206562568 CAGAATGTGGGGCTGGGGGCAGG + Intronic
945221644 2:207489909-207489931 CAGAACTTGGGGACAGGGACGGG - Intergenic
945891515 2:215435933-215435955 CAGAGGGTGGGGAAGGGGACGGG + Exonic
946080479 2:217114194-217114216 CAGGAGTTTGGGAAGGGTGCGGG + Intergenic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946461684 2:219874467-219874489 CAGAATTTAGGGGAGGGGTGGGG - Intergenic
946958817 2:224961032-224961054 TAGAATTTGGTGATGGGGGCCGG - Intronic
947979126 2:234394061-234394083 CAGATTTTTGGGAGGAGGGCAGG - Intergenic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948564351 2:238874165-238874187 GAGAATTTGGGGACCAGGGCTGG + Intronic
949003001 2:241628129-241628151 CAGAATGGAGAGAAGGGGGCTGG - Intronic
949052078 2:241902810-241902832 CAGATTTCGGGGAAGGGCCCTGG - Intergenic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1168913659 20:1469326-1469348 TAGAATTTGGGGATGGGGCTTGG - Intronic
1169276461 20:4236517-4236539 AAGAATTTGGGGGAAGTGGCAGG + Intronic
1169992768 20:11522103-11522125 CAGATTTTGGGGAAGGATGTTGG + Intergenic
1170166863 20:13368760-13368782 CAGGGGTTGGGGAAGGGGACAGG - Intergenic
1171209429 20:23305337-23305359 CACAGTTTGTGGAAGGAGGCAGG - Intergenic
1171282622 20:23913892-23913914 CAGGAATTGGTGTAGGGGGCGGG + Intergenic
1173299293 20:41786871-41786893 CAGAAATTGGGGAAGGTAGAAGG - Intergenic
1173857646 20:46260977-46260999 AGGAATTTGGGGGAGGAGGCAGG - Intronic
1173911518 20:46674353-46674375 CTCACTATGGGGAAGGGGGCAGG + Intronic
1175078211 20:56393639-56393661 GAGAATTGGGGGCGGGGGGCGGG + Intronic
1175127487 20:56763317-56763339 GAGAATGTGGGGAAGGGGCGGGG + Intergenic
1175272593 20:57745188-57745210 AAGAATGTGGTGAAGGGGGTGGG + Intergenic
1175378841 20:58548807-58548829 CAGTGTTTGGGGGAGGGGGTTGG - Intergenic
1175423941 20:58852781-58852803 GGGACTTTGGGTAAGGGGGCTGG - Exonic
1175523050 20:59615030-59615052 AAGAATGTGGGGTAGGGGCCAGG - Intronic
1175709669 20:61209259-61209281 CAGAAGTGGAGGAAGGGGTCGGG - Intergenic
1176031386 20:63014700-63014722 CAGAATCTGGGGGTGGGGGTGGG - Intergenic
1176861275 21:14012731-14012753 CAGGACTTTGGGGAGGGGGCAGG + Intergenic
1177769626 21:25500036-25500058 CAGAATTTGGGGATGGGGTCTGG + Intergenic
1178635386 21:34297984-34298006 CAGGATGTGGGGTAGGGAGCTGG + Intergenic
1178919590 21:36729776-36729798 CAGGCTTTGGGCAATGGGGCCGG - Intronic
1179171003 21:38972703-38972725 AAGAATTTGAGAAAGGGGCCCGG + Intergenic
1180487573 22:15816731-15816753 CAGGAGTTGGTGAAGGGGACAGG + Intergenic
1180623955 22:17181613-17181635 CAGGGGTTGGGGAACGGGGCAGG + Intronic
1181392197 22:22591666-22591688 CTGAATTTGAGGACAGGGGCAGG - Intergenic
1181753940 22:25009559-25009581 AAAAAAGTGGGGAAGGGGGCTGG - Intronic
1182212188 22:28685898-28685920 CAGCATTTTGGGAGGGAGGCGGG + Intergenic
1182472610 22:30557619-30557641 GAGAGGTTGGGGAATGGGGCAGG + Intronic
1182561163 22:31160337-31160359 CAAAGTTTAGGGACGGGGGCGGG + Intronic
1182900101 22:33890780-33890802 CATAATTTTGGGGTGGGGGCGGG + Intronic
1183303653 22:37070647-37070669 CACAGTCTGGGGATGGGGGCAGG + Exonic
1183458166 22:37933918-37933940 CAGACTGTGGGGATGGTGGCAGG + Intronic
1183545763 22:38454285-38454307 CAGAAATGTGGGTAGGGGGCAGG + Intronic
1183779677 22:39990729-39990751 CAGATTTGGGGAAAGGGGGATGG + Intergenic
1184421230 22:44384055-44384077 CGGAGTTTGAGGAAGGGGTCTGG - Intergenic
1184464227 22:44659533-44659555 CTGACTGTGGGGAAGAGGGCAGG - Intergenic
1184553502 22:45218815-45218837 CAGAAGTTGGGGGAGGGGAGAGG - Intronic
1185286632 22:50003226-50003248 GAGAATTTGAGGGAGTGGGCCGG + Intronic
949586894 3:5449557-5449579 CAGATTTGGGGGAAGGGGGTGGG + Intergenic
949607480 3:5670192-5670214 CAAAATTTGGTGAAGTAGGCTGG + Intergenic
949872522 3:8601499-8601521 CAGAAGTGAAGGAAGGGGGCAGG + Intergenic
950641216 3:14349736-14349758 TAGGAATTGGGGTAGGGGGCGGG - Intergenic
950931178 3:16790473-16790495 AAGAATTTGGGGAAGCAGGCTGG - Intergenic
952419390 3:33117758-33117780 CAGATTTTGGAGAAGGTGGTAGG - Intronic
952838905 3:37627934-37627956 CTGCCTCTGGGGAAGGGGGCTGG + Intronic
953262509 3:41353419-41353441 CAGCATTTTGGGAAGGGGAGAGG + Intronic
953714066 3:45301003-45301025 CAGGAATTGGGGGTGGGGGCAGG - Intergenic
954071147 3:48143759-48143781 CAGAATGGTGGGAAGGGTGCTGG - Intergenic
954326937 3:49869064-49869086 CAGCACTTGGGAAAGGGGTCAGG - Intronic
956717117 3:72088321-72088343 AAGAATGTGGGAACGGGGGCCGG + Intergenic
957239420 3:77639124-77639146 AAGAACTAGGGGAAAGGGGCCGG - Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
958265643 3:91434319-91434341 GTGACTGTGGGGAAGGGGGCAGG - Intergenic
958586160 3:96091029-96091051 CAGAAGTGGGGCATGGGGGCAGG + Intergenic
959903467 3:111685084-111685106 CAGAATTGGGAGAAGGGCACAGG + Intronic
960340494 3:116469134-116469156 CTGAATTTCGAGAAGGGAGCTGG - Intronic
960973118 3:123153254-123153276 CAGGTTTTGAGGAAGGGGGGTGG + Intronic
961250628 3:125501692-125501714 CAGGATTTGGGGTAGGGCCCAGG - Intronic
961510249 3:127396454-127396476 CAGACGTTAGGGCAGGGGGCAGG + Intergenic
962311820 3:134332208-134332230 AAGAGTTTTGGGAAGGGGCCTGG + Intergenic
962738469 3:138346417-138346439 CAGAACTTGGGAAGGCGGGCAGG - Intergenic
963754532 3:149220130-149220152 TAGAATTTGGTGAATGGGGGCGG - Intronic
964771018 3:160224970-160224992 CAGAGTTTGGGGGTGGGGGGTGG - Intergenic
966303061 3:178500173-178500195 TAGAATGTGGGGAAGAGGCCAGG - Intronic
966440553 3:179940059-179940081 CAGAATTTCAGGAAGAGGGATGG + Intronic
967126347 3:186427868-186427890 CTGCAGCTGGGGAAGGGGGCAGG + Intergenic
968332356 3:197882003-197882025 CAGACTTTGGGGAATTGGGTTGG + Intronic
970500258 4:16669810-16669832 AAAAATTTGGGAAAGAGGGCTGG - Intronic
970652454 4:18193628-18193650 AAGAAACTGGGGGAGGGGGCGGG - Intergenic
971004971 4:22362931-22362953 CAGACTTTTGAGAAGGGGACTGG - Intronic
972291449 4:37693734-37693756 CAAACGTTGGGGAGGGGGGCAGG + Intergenic
972564391 4:40257126-40257148 GAGCATTTGGGGAAAGGGGTGGG - Intergenic
972620061 4:40738602-40738624 CAGATTTGGGAGAAGGGAGCAGG - Intergenic
973680083 4:53308259-53308281 CACAATTTGGGGAATGGGGAAGG - Intronic
974040838 4:56856001-56856023 ATGAATTTGGAGAAGGGGGTTGG + Intergenic
974056480 4:56988162-56988184 CAGGGTTTGGAGAAGGGGCCGGG + Intronic
974072924 4:57141416-57141438 CTGACTTTGGGTAAGAGGGCGGG - Intergenic
974728397 4:65827341-65827363 TAGAATCTAGGAAAGGGGGCTGG - Intergenic
974748568 4:66106763-66106785 ACCAATTTTGGGAAGGGGGCTGG - Intergenic
976275354 4:83271439-83271461 AAGAATTTGGGGGATGGGGTAGG - Intronic
976370622 4:84284611-84284633 GAGAATTTGGGGATGAGGGATGG - Intergenic
977595536 4:98875269-98875291 CAGTATTTTGGGAAGGTGGTTGG + Intronic
977900112 4:102412663-102412685 CAGATGTTGGGGCCGGGGGCAGG + Intronic
977919425 4:102626819-102626841 CATAATTTGCTGAAGTGGGCTGG - Intergenic
978082519 4:104611948-104611970 CTGAATTGGGGGCAGGGTGCGGG - Intergenic
978159476 4:105528824-105528846 TAGAATTTGGGGAAAGTAGCAGG + Intergenic
978618182 4:110615825-110615847 GGGGATTTGGGGATGGGGGCTGG - Intergenic
979238095 4:118424201-118424223 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
979435681 4:120686731-120686753 CATATTTTGGGGAAGGGGAAGGG - Intronic
979833458 4:125330352-125330374 TAGAAATTGGTGAAGGAGGCTGG - Intronic
981307575 4:143262977-143262999 GAGGGTTTGGGGTAGGGGGCAGG + Intergenic
981438123 4:144750122-144750144 ATGAATTTGGGGAAGGGAGAGGG + Intergenic
982195670 4:152910287-152910309 CAGAGTTGGGGGAAGTGGGAGGG + Exonic
982699080 4:158639103-158639125 GAGGATTTGGGGAAGTGGGTGGG + Intronic
983739753 4:171114686-171114708 TAGAATGTGGGGGAAGGGGCAGG + Intergenic
983963154 4:173778551-173778573 CAGAATTTGGGATGGGGGTCAGG - Intergenic
985653043 5:1115834-1115856 GAGAATCGGGGGAAGGGGGAGGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986671329 5:10145592-10145614 CAGAAGATGGGGAAGAGGGGAGG + Intergenic
987106614 5:14645975-14645997 CAGGACTTGCGGAAGGGAGCAGG + Intergenic
987295297 5:16545179-16545201 CAGAATTTGAGGATTGGAGCTGG - Intronic
987330255 5:16850737-16850759 AAAAGTTTGGGGAAGGGGGCTGG + Intronic
987689923 5:21253262-21253284 CAGCAATTGGGGATGGGGGAAGG + Intergenic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
988711497 5:33781413-33781435 CAGAATATGTGGATGTGGGCTGG + Intronic
989749459 5:44875878-44875900 CAGGATTTGGTGAAGAGGACTGG + Intergenic
990335341 5:54767090-54767112 CTGAATTGAGGGAAAGGGGCTGG - Intergenic
990795343 5:59533745-59533767 GAAATTTTGGGGAAGGGGCCTGG + Intronic
992615327 5:78541570-78541592 AAGATTTTGGGGAAGGAGGTGGG + Intronic
993177359 5:84503708-84503730 CAGGATTTGGAGAGGGAGGCTGG + Intergenic
993554244 5:89315888-89315910 CAGATTGTGGGGGCGGGGGCGGG - Intergenic
993701673 5:91126236-91126258 GAGAATTTGTGGAAGGGGAGTGG - Intronic
994087004 5:95770001-95770023 CAGTGTTTGGAGAAGGGGGTAGG + Intronic
995127009 5:108588208-108588230 CAAGATTTGGGAAAGGGAGCTGG + Intergenic
995516376 5:112958281-112958303 CAGAATTTTGGGAAGGGATGCGG - Intergenic
996096177 5:119401389-119401411 CAGCACTTTGGGAAGTGGGCAGG + Intergenic
996219318 5:120910164-120910186 ATTAATTTGGGGAAGGGGGTGGG + Intergenic
996415600 5:123206944-123206966 CAGCATTTGGGGTAGGGGCGAGG + Intergenic
996714001 5:126571801-126571823 CACAAATTGGGGAAGGGGAAGGG + Intronic
996786076 5:127237820-127237842 CAGAAATAGAGGAAGGGAGCAGG - Intergenic
997226641 5:132214160-132214182 CAGCCTTTGAGGGAGGGGGCGGG - Intronic
997234906 5:132267194-132267216 CAGAGTTTGGGCAAGGAGACTGG + Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
998004732 5:138649382-138649404 CAGACTCTGGGGGCGGGGGCAGG + Intronic
998010972 5:138695353-138695375 AAGAATTTGAGGGAGGTGGCTGG + Intronic
998033733 5:138895227-138895249 CAGAATCTTGGGGAGGGGGCTGG - Intronic
998219690 5:140266564-140266586 CTTATTTTGGGGAAGGGGGTGGG - Intronic
998383318 5:141741460-141741482 CAGAACTGGGGCCAGGGGGCTGG - Intergenic
999145719 5:149391953-149391975 GAGAAGCTGGGGAAGAGGGCAGG - Intronic
999152058 5:149432856-149432878 GGGAATTTGGGGAAGGGGGGAGG + Intergenic
1000116372 5:158157543-158157565 CAGCATTTGGGGGAGGGGAGGGG + Intergenic
1000375417 5:160576482-160576504 CAGAAGTTAGGAAAGGGAGCTGG + Intronic
1000916379 5:167087140-167087162 CAGCATCTGGGCATGGGGGCAGG - Intergenic
1002192010 5:177483337-177483359 CAGAATTTGAGGCACGTGGCAGG - Intergenic
1002424857 5:179168939-179168961 CAGGCTTTGGGGAAGATGGCTGG - Intronic
1002738522 5:181416177-181416199 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1002968021 6:1986855-1986877 CAGAATGAGAGTAAGGGGGCTGG + Intronic
1003836565 6:10077743-10077765 AAGAATTTGGGGCAGTAGGCTGG + Intronic
1004570527 6:16840344-16840366 CTGACTTTGGGGAAAGGAGCAGG + Intergenic
1004737330 6:18420623-18420645 GAGAATTTGGGGAGCGGGGGAGG + Intronic
1005385466 6:25280205-25280227 CCGAGTTTGGGGCAGTGGGCTGG - Intronic
1005423006 6:25672431-25672453 GAGCATTTGGGGTAGGGGACTGG + Intronic
1005507331 6:26481222-26481244 CAGTTTGTGTGGAAGGGGGCAGG - Intergenic
1005641132 6:27797517-27797539 CAAAATGTGGGGTAGGGGGAAGG - Intergenic
1005916401 6:30355760-30355782 CAGAGTTTGGGGCAGGGTGCAGG - Intergenic
1005960221 6:30688488-30688510 CAGAATTTAGGGTATGGAGCTGG + Exonic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1006922067 6:37633679-37633701 CAGAATTTGGAGCCGAGGGCAGG + Exonic
1007543585 6:42672785-42672807 AAGAAAGTGGGGAAGGAGGCAGG - Intronic
1007698164 6:43747000-43747022 CAGGAGTTGGGGCAGGGGTCAGG + Intergenic
1007715861 6:43855783-43855805 TAAAATTTGGGGAAGGGAGAAGG + Intergenic
1008022852 6:46600526-46600548 CAGAGGCTGGGGAATGGGGCTGG - Intronic
1008675291 6:53812392-53812414 CAGAATTTGAAGAAAGAGGCCGG + Intronic
1008989724 6:57588335-57588357 GTGACTGTGGGGAAGGGGGCAGG + Intronic
1009178307 6:60486879-60486901 GTGACTGTGGGGAAGGGGGCAGG + Intergenic
1009372650 6:62926484-62926506 CAGAATTTGGTGAAGGTGATGGG - Intergenic
1010786155 6:80004055-80004077 CAGAATTTTGACAAGGGGGAGGG + Intronic
1011726120 6:90212298-90212320 ATGCATTGGGGGAAGGGGGCAGG - Intronic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1014421041 6:121245733-121245755 CTGAATCTGGGGATGGGGGGAGG - Intronic
1015506357 6:133992783-133992805 CAGTACTTGAGGAAGTGGGCTGG + Intronic
1016855631 6:148667927-148667949 CAGGGTTTGGGGTAGGGGGAGGG - Intergenic
1016856307 6:148673984-148674006 CAGAATTGGGGCAAGGGAGATGG + Intergenic
1017347839 6:153405404-153405426 CTCAATTTGGGGAAAGGGGTGGG + Intergenic
1017476167 6:154795542-154795564 TAGATTTGGGGGAAGGGGTCAGG + Intronic
1017813315 6:157999669-157999691 CAGAAATTGGGGCAGGTGGTGGG + Intronic
1018923867 6:168193627-168193649 CAGGGTTTGGGAACGGGGGCAGG + Intergenic
1019243625 6:170691729-170691751 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1019343860 7:520356-520378 CAGTCTTTGGGGAAGGAGGGGGG + Intergenic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019619393 7:1982562-1982584 CGGAATTTAGTGAAGGGGGCGGG - Intronic
1020013354 7:4818010-4818032 CAGCACCTGGGGAAGGGGCCAGG + Intronic
1021536300 7:21708623-21708645 TGGGATTTGGGGACGGGGGCAGG - Intronic
1021720194 7:23497380-23497402 CAAGATTTGGGGCTGGGGGCGGG - Intergenic
1022008505 7:26289040-26289062 CAGAAATTGCGGAATGGGGCTGG + Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022367059 7:29731547-29731569 CAGAACTGGGGGATGGGGGGTGG + Intergenic
1022695837 7:32704701-32704723 CAGACTGTGGGGTAGGGGGTTGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023400134 7:39786741-39786763 GAGAATTAGGGGAGGGGGCCAGG + Intergenic
1023986780 7:45101609-45101631 CAGCATCTGGGGAAGGGGTGTGG + Exonic
1024141354 7:46466168-46466190 GAGGATTTGGGGAAGGGGAAGGG + Intergenic
1024421893 7:49177626-49177648 AAGCCTTTGGGGAAGGAGGCAGG - Intergenic
1024529868 7:50382866-50382888 GAGAATATGGGGAGGGGGGATGG - Intronic
1024650270 7:51397696-51397718 GAGAATTAGGGGAGGGGGCCAGG - Intergenic
1024755458 7:52525032-52525054 GAGATTCAGGGGAAGGGGGCCGG + Intergenic
1025054414 7:55753346-55753368 GAGAATTCGGGGAGGGGGCCAGG - Intergenic
1025132466 7:56383498-56383520 GAGAATTAGGGGAGGGGGCCAGG - Intergenic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1026876452 7:73881737-73881759 CAGAATCAGGGGAGGGGGGTGGG + Intergenic
1027556697 7:79672550-79672572 TGGAAATTGGGGGAGGGGGCAGG - Intergenic
1027682722 7:81240679-81240701 AAGAATTTGGGGAATGGGCTGGG + Intergenic
1027682836 7:81241555-81241577 CAGCATTTTGGGTATGGGGCAGG - Intergenic
1027990690 7:85357002-85357024 CAGAAATGGGGGATGGGGACAGG - Intergenic
1028841686 7:95435328-95435350 CAGCTTTTGGGGATGGGGGTCGG + Intergenic
1029375912 7:100176989-100177011 GAGAATTGGGGGTGGGGGGCGGG - Intronic
1029704796 7:102270574-102270596 CAGAATTGGGGGATGGCTGCTGG - Intronic
1030230336 7:107201964-107201986 CAGAACATGGGGCAGGTGGCTGG + Exonic
1030799761 7:113835475-113835497 GAGAATATGGGAATGGGGGCTGG + Intergenic
1031580510 7:123468558-123468580 CTGAATTTAGGCAAGGGGCCAGG - Intronic
1031891256 7:127295536-127295558 CAGATGTCGGGGACGGGGGCCGG + Intergenic
1032050449 7:128646186-128646208 GAGAATTAGGGGAGGGGGCCAGG + Intergenic
1032070134 7:128799707-128799729 CAGAAGTTGGGGGAAGGGGATGG + Intronic
1032316490 7:130843197-130843219 AAGAATTTGTAGAAGGCGGCCGG + Intergenic
1032399049 7:131610996-131611018 CACAAGTTGGGGCAGGGCGCAGG - Intergenic
1032750756 7:134838416-134838438 AATAATTTGGGGAAGGTGGGTGG + Intronic
1033354201 7:140586220-140586242 AAGAAATGGAGGAAGGGGGCTGG + Intronic
1033896208 7:146073899-146073921 CAGTAATACGGGAAGGGGGCAGG + Intergenic
1034231247 7:149530324-149530346 AAGAATTTGGGGTAGGGGAAAGG - Intergenic
1034400785 7:150860289-150860311 GTGCATTTGGGGAGGGGGGCGGG + Intronic
1035504497 8:116431-116453 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036708158 8:11060137-11060159 CAGAGCTTGGGGAGGGTGGCAGG + Intronic
1037273286 8:17153536-17153558 AAGAATTTGGGGGACTGGGCTGG + Intergenic
1037431261 8:18815605-18815627 AAGAATTTGAAGAAAGGGGCTGG - Intronic
1037782709 8:21881697-21881719 CAGCAGTAGGGGAAGGGGGTGGG - Intergenic
1038471360 8:27825508-27825530 TAGAAGCTGGGGAAGGGGGGTGG - Intronic
1039298942 8:36188558-36188580 AATTATTTGGGGAAAGGGGCAGG + Intergenic
1039613264 8:38935991-38936013 CAGAATCTGGCAATGGGGGCAGG + Exonic
1039881946 8:41630598-41630620 CAGAATGTGGGGTGGGGGGCCGG - Intergenic
1040881310 8:52207810-52207832 CCTAATTAGAGGAAGGGGGCTGG + Intronic
1041058015 8:54007724-54007746 CAGAATTTAGGGAAAGGTGGTGG - Intronic
1043072820 8:75660965-75660987 AAGAATTTGGGGAGGTTGGCTGG + Intergenic
1043363968 8:79510161-79510183 CTGAATTTAGAGAAGGGGGAGGG - Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1043865990 8:85376363-85376385 TAAAAATTGGGTAAGGGGGCCGG + Intronic
1043925724 8:86034538-86034560 CAGAGCTTGGGGAAGGGTTCAGG - Intronic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1046644957 8:116776082-116776104 CAGGGTATGGGGAAGGGGCCAGG - Intronic
1048106743 8:131419400-131419422 CAGAATCTGCTGAAGGGGCCAGG - Intergenic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049804752 8:144533809-144533831 GAGGATGTGGGGAAGGGGCCAGG + Intronic
1050144507 9:2552243-2552265 CAGAATTTGTGGAAGGCAGCAGG + Intergenic
1050519814 9:6485611-6485633 AATAATTTGGGGCGGGGGGCGGG - Intronic
1051007508 9:12364856-12364878 AAGAACTTGGGGAAGAGGGGAGG - Intergenic
1051594989 9:18816142-18816164 CAGAGACTGGGGAAGGGAGCGGG - Intronic
1051635002 9:19173584-19173606 CAGAATTTGGGGAGGTAGGTGGG + Intergenic
1052854062 9:33396102-33396124 TGGAGTTTGGGGAAGGTGGCGGG + Intronic
1052947420 9:34179279-34179301 CGGAGTTGGGGGAGGGGGGCTGG + Intronic
1053139691 9:35674864-35674886 AGGAATTTGGGGAAAGGGGTTGG + Intronic
1053216215 9:36272773-36272795 AAGAATGTGGAGAAGGGGCCGGG + Intronic
1053682077 9:40492266-40492288 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1053932064 9:43120592-43120614 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1054281636 9:63132666-63132688 TGGAGTTTGGGGAAGGTGGCGGG - Intergenic
1054295174 9:63327763-63327785 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1054393194 9:64632269-64632291 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1054427843 9:65137479-65137501 TGGAGTTTGGGGAAGGTGGCGGG + Intergenic
1054502533 9:65884059-65884081 TGGAGTTTGGGGAAGGTGGCGGG - Intronic
1055236988 9:74133953-74133975 CAGGATATGGGGAGCGGGGCAGG + Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1057483132 9:95461421-95461443 CAGAATTTGGGGTAGGTGGGTGG - Intronic
1058040431 9:100296016-100296038 CAGCCTTTGGGGAAGGAGGGAGG + Intronic
1059108188 9:111530047-111530069 CTGGAATTGGGGAAGGGTGCTGG + Intronic
1059283589 9:113154476-113154498 CAGAATCTCCTGAAGGGGGCTGG + Intronic
1059305149 9:113348207-113348229 AAGAATTTGGGGTTGGTGGCCGG + Intergenic
1059392846 9:114009821-114009843 AAGCATTTGGGGGAGGGGGAGGG - Intronic
1059869368 9:118554668-118554690 CATAATTTGGGGAAGATGGCAGG - Intergenic
1060885419 9:127148851-127148873 CAGAATGTGGGGATGGCGGAGGG + Intronic
1061005768 9:127927827-127927849 CACAGGTCGGGGAAGGGGGCCGG - Intronic
1061262521 9:129488162-129488184 CAGATTTGGGGGAGGGGGGTTGG - Intergenic
1061309808 9:129754826-129754848 CAGAACCCGGGGAAGCGGGCAGG - Intergenic
1061453789 9:130682673-130682695 CCGAATTTGAGGAAACGGGCAGG - Exonic
1062254586 9:135614943-135614965 CAGCAAGTGGGGAAGGGGACTGG + Intergenic
1062478847 9:136742353-136742375 CAGAGTTGGGGGCCGGGGGCCGG - Intronic
1062640537 9:137515986-137516008 GAGGATTTGGGGGAGGGGGTTGG - Intronic
1203603814 Un_KI270748v1:40952-40974 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1185612794 X:1402447-1402469 CTGAATTTTGGGAGGGGGGAAGG - Intergenic
1185612892 X:1402785-1402807 CTGCATTTGGGGAGGGGGGAAGG - Intergenic
1186766009 X:12771416-12771438 CATAATATAGGGAAGAGGGCAGG - Intergenic
1186900969 X:14055659-14055681 CAGAAGCTGGGGAAGGGAGGGGG - Intergenic
1187018737 X:15357552-15357574 CAGAATTGGGGAAAGAGGGATGG - Intronic
1187470715 X:19567097-19567119 CAGAGGTTAGGGAAGGGGGTGGG + Intronic
1187722446 X:22165435-22165457 CTGAATTGAGGCAAGGGGGCTGG + Intronic
1187825996 X:23334187-23334209 CAGGAGTGGGGGGAGGGGGCGGG - Exonic
1188619236 X:32199523-32199545 CAAATTTTGGGGAAGGGGGAGGG + Intronic
1189309597 X:40010176-40010198 CAGGCTTTGGGGGAGGGGGTGGG - Intergenic
1190217976 X:48492799-48492821 CAGAGTTTGGAGCTGGGGGCGGG + Intergenic
1192144151 X:68669739-68669761 CAGAGCTTGGGGGAGGGGTCTGG - Intronic
1192433181 X:71126168-71126190 CAGAATGTGGGAAAGGGGCTGGG - Intronic
1192795386 X:74421255-74421277 CAGTAGTTTGGGAAGGGAGCTGG + Intergenic
1195397242 X:104424919-104424941 CAGGGTTTGGGAAAGGGGGCTGG - Intergenic
1196940341 X:120769584-120769606 CAGAATTAGGGGGAGGGGTAAGG + Intergenic
1197253520 X:124238868-124238890 CAGAGGTTGGGATAGGGGGCAGG + Intronic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1198574773 X:137998136-137998158 CTGGGTTTGGGGCAGGGGGCTGG - Intergenic
1198675327 X:139124837-139124859 CAGGATTTGGGGAAGAAAGCAGG + Intronic
1198724462 X:139662788-139662810 GTGAATTTGGAGAAGGGGGAGGG - Intronic
1199951107 X:152706771-152706793 CAGTGTCTGGGGTAGGGGGCTGG + Intergenic
1199958577 X:152761690-152761712 CAGTGTCTGGGGTAGGGGGCTGG - Intergenic
1201564186 Y:15348520-15348542 TAGAATTTGGGTATGTGGGCAGG - Intergenic
1201791701 Y:17848292-17848314 TAGAATTTTGGGGATGGGGCTGG + Intergenic
1201809853 Y:18057697-18057719 TAGAATTTTGGGGATGGGGCTGG - Intergenic
1202385875 Y:24325997-24326019 CTGAGTCTGGGGAAGGGAGCTGG - Intergenic
1202484911 Y:25344131-25344153 CTGAGTCTGGGGAAGGGAGCTGG + Intergenic