ID: 1127892691

View in Genome Browser
Species Human (GRCh38)
Location 15:63269262-63269284
Sequence CTGTGAGACCAAGAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127892691_1127892695 -7 Left 1127892691 15:63269262-63269284 CCTCCTTCCTCTTGGTCTCACAG No data
Right 1127892695 15:63269278-63269300 CTCACAGGCATTCTTAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127892691 Original CRISPR CTGTGAGACCAAGAGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr