ID: 1127894734

View in Genome Browser
Species Human (GRCh38)
Location 15:63287028-63287050
Sequence GTGTATTCCTGAGCCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127894734 Original CRISPR GTGTATTCCTGAGCCCAAGT GGG (reversed) Intronic
901330145 1:8401327-8401349 GGGTCTTCCAGAGCCCAAGGTGG + Intronic
902773654 1:18660720-18660742 CAGGATTCCTGAGCCCAAGGAGG - Intronic
903658686 1:24964120-24964142 GTGACCTCCTGAGCCCAGGTGGG + Intronic
905464247 1:38140694-38140716 CTGGGTTCCTGAGCCCCAGTAGG + Intergenic
908255477 1:62299995-62300017 TTGTGTTCCAGAGCACAAGTGGG - Intronic
912867091 1:113267279-113267301 GAGTATCCCTGTGCCCAAGGGGG - Intergenic
915659584 1:157391419-157391441 GTGTATTTCTGAGGACAAATTGG - Intergenic
921800073 1:219392559-219392581 CTGTATTGCTGAGCTCAAGGTGG - Intergenic
1069845687 10:71369608-71369630 GTGGATTGCAGAGCCCAGGTTGG - Intergenic
1070442199 10:76457571-76457593 TGGTATTCCTAAGCCCAAGAAGG + Intronic
1078169291 11:8916530-8916552 GTCTATTCCAGAGTCTAAGTTGG + Intronic
1083766534 11:64844143-64844165 GTCGATACCTGAGCACAAGTTGG + Intronic
1086324049 11:85680714-85680736 GTGTATTCCTAAGGACAAATTGG - Intronic
1091958773 12:4672634-4672656 GTGTCTTCCTGAGCTGCAGTGGG - Intronic
1093750961 12:22799644-22799666 GTGTATTAATTAGCCCAAGAGGG - Intergenic
1094265186 12:28550634-28550656 GTGAAGACCTGACCCCAAGTGGG + Intronic
1103367706 12:120395054-120395076 GTGTTTTCCAGAGCCCAAGGGGG - Intergenic
1105941574 13:25152596-25152618 GTGGTTTCCCGAGCCCAAGGAGG - Intergenic
1106298762 13:28442984-28443006 GTGATTTCCTGAGACCAAATTGG + Intronic
1111774861 13:92647448-92647470 ATTTATTCCTGAGCCTATGTAGG - Intronic
1113439178 13:110314638-110314660 GTTGTTTCCTGAGCCCAAGATGG + Intronic
1114369107 14:22065889-22065911 GGGTACTCCTGTTCCCAAGTGGG + Intergenic
1115173003 14:30529636-30529658 GGGTATGCCTGAGCACAAGCCGG + Intergenic
1116763376 14:49041549-49041571 GTGAATTGGTGAGGCCAAGTAGG + Intergenic
1119648322 14:76364758-76364780 GTCTCTTCCTGCCCCCAAGTTGG - Intronic
1121809358 14:96868044-96868066 GTGTATACCTCAGTCAAAGTTGG + Intronic
1122178606 14:99938643-99938665 CTGCATCCCTGAGCCCAGGTGGG - Intronic
1122880148 14:104687181-104687203 GTGTGTTTCTGAGGCCAAATCGG + Intergenic
1122988248 14:105222969-105222991 TGGAACTCCTGAGCCCAAGTGGG - Intronic
1125230422 15:37448769-37448791 GTGTATTGCTGACCTCAAATGGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1126044739 15:44628418-44628440 GTTTGTTACTGAACCCAAGTGGG + Intronic
1126706183 15:51407592-51407614 GTGTCCTCCTGAAGCCAAGTAGG + Exonic
1126706666 15:51412523-51412545 GTATATTCCAGAGCACAAGTTGG - Intergenic
1127894734 15:63287028-63287050 GTGTATTCCTGAGCCCAAGTGGG - Intronic
1129451224 15:75652337-75652359 GTGTCTCCCTGAGCACAAGTGGG + Intronic
1131952245 15:97693370-97693392 GTGTATCACTGAGCCAAAGGGGG + Intergenic
1137712505 16:50576061-50576083 GAATATTCTTGAGCCCAGGTAGG - Intronic
1151143559 17:72017964-72017986 ATTTAATCCTGACCCCAAGTTGG - Intergenic
1152230384 17:79111331-79111353 GTGTTTTCCAGAGCCCACGTGGG - Intronic
930351989 2:50268376-50268398 GTGTAGTACTAAGCCTAAGTAGG - Intronic
936974993 2:118209658-118209680 GAGTATCCCTGAGGGCAAGTTGG + Intergenic
940765594 2:157786559-157786581 CTATATTCGTGAGCCCAAGTAGG - Intronic
942211003 2:173670149-173670171 CTGTATTCATTAGCCCAAGTTGG + Intergenic
1170065972 20:12311095-12311117 GTGTTGCCCTGAGGCCAAGTGGG - Intergenic
1172510682 20:35498800-35498822 TTTTATTCCTGAGATCAAGTTGG + Intronic
1175621035 20:60447823-60447845 GTGGATTCCAGAGCCCAGGGTGG + Intergenic
1177497673 21:21910515-21910537 GTGACTTCCAGAGCCCAAATGGG + Intergenic
1181299480 22:21869187-21869209 TTGAATTCTTGGGCCCAAGTTGG - Intergenic
1184964659 22:47962436-47962458 GTTTATTCCTGAGTCCAGGCTGG - Intergenic
1185390107 22:50555414-50555436 GTGTATTGCTTGGCCAAAGTTGG + Intronic
953031481 3:39182810-39182832 GAGAATTCCTGTGCCCAAGATGG - Intergenic
953521802 3:43649940-43649962 GTGACTCCCTGAGCCCAAGAGGG + Intronic
961009000 3:123423747-123423769 CTGTCTTCCTGAGGCCAAGAAGG + Intronic
961820623 3:129573937-129573959 GTGCATTACTGAGCCCACGTGGG + Intronic
964930795 3:162019583-162019605 GTTTCTACTTGAGCCCAAGTTGG - Intergenic
965156297 3:165061780-165061802 TTGTATACCTGAGCCCAATATGG - Intronic
967005859 3:185381674-185381696 TAGTGTTCCTGAGCCCAAGAAGG + Intronic
973825253 4:54698429-54698451 GTTTATTCCTGACCCCAAGGCGG + Exonic
983781468 4:171674918-171674940 GTGACTCCCAGAGCCCAAGTGGG - Intergenic
985836006 5:2272337-2272359 GTGTGTTCTTGGGCCCCAGTGGG + Intergenic
986836861 5:11648473-11648495 GTGTAAAGCTGAACCCAAGTGGG - Intronic
989701342 5:44268831-44268853 GGGTCTCCCTGAGCCAAAGTAGG + Intergenic
992687980 5:79216623-79216645 GTGCATGCCTGGGCCCAAGGAGG + Intronic
996547685 5:124697635-124697657 CTTTATTCCTGAGCACAACTTGG + Intronic
996654967 5:125924780-125924802 GTATATTCCTGACCCGATGTGGG - Intergenic
997527599 5:134563407-134563429 GTGTGTTTCTGAGTCCATGTGGG + Intronic
1003038869 6:2669168-2669190 GTGAATTTCTGAGGCCAAATGGG + Intronic
1006831747 6:36972354-36972376 CTGACTTCCTGAGCCCTAGTTGG + Intronic
1012145214 6:95671564-95671586 GAGTTTTCCTGAGCACAGGTGGG - Intergenic
1013203840 6:107928397-107928419 GAGGATGCCTGAGCCCAAGGAGG + Intronic
1013584739 6:111568404-111568426 GTATAAGCCTGAGCCCAAGAAGG - Intronic
1013904773 6:115202344-115202366 CTCTATTCCTGAGCCCAGCTGGG - Intergenic
1017416933 6:154230584-154230606 GTGTATTCCCGAGTCTAAATAGG + Intronic
1019870573 7:3757219-3757241 GTGAGTTACTGAGCCCAAGGAGG - Intronic
1022229921 7:28404834-28404856 TGGTAGTCCTGAGCACAAGTTGG - Intronic
1023970373 7:44986520-44986542 GACCATTCCTGAGCCCAGGTAGG - Intergenic
1028674132 7:93439366-93439388 TTCTCTTTCTGAGCCCAAGTGGG - Intronic
1029545859 7:101210271-101210293 GTGTCTTCCTTAGCACAAGGCGG + Intronic
1030178535 7:106679995-106680017 ATGTATTCCTGGGCACAATTTGG - Intergenic
1032155149 7:129461930-129461952 GTGGGATCCTGAGCACAAGTAGG + Intronic
1033109297 7:138560516-138560538 CTGTATTCCTGGGGCCGAGTGGG + Intronic
1034753452 7:153592283-153592305 GTGTAATCCTCAGCTGAAGTGGG + Intergenic
1041391436 8:57350584-57350606 GTGTATTCCTAGGCTCAGGTCGG - Intergenic
1041523624 8:58781540-58781562 GTGGAGTCCAGAGCCCAAATGGG - Intergenic
1047085838 8:121514277-121514299 GTGTATTCTTCAGGCCAAGCTGG - Intergenic
1047983777 8:130211934-130211956 GGGTACTCCTGAGCCCCAGGAGG + Intronic
1048202946 8:132391901-132391923 GTGTTTTCCTGAGCCACAGAAGG + Intronic
1051122162 9:13763172-13763194 GTGTATTCCTGTACCCACATTGG - Intergenic
1057705318 9:97391503-97391525 GAGGTTTCCTGAGCACAAGTGGG + Intergenic
1189592986 X:42535209-42535231 GTGGATGCCTCAGCCCAATTTGG + Intergenic
1189794014 X:44630307-44630329 TTGAATTCCTGGGCTCAAGTGGG + Intergenic
1190170552 X:48108694-48108716 TTGTAGTCCTGAGGCCAAGGTGG - Intergenic
1191228650 X:58075091-58075113 GTGCATTTCTGAGCCCATTTAGG - Intergenic