ID: 1127896075

View in Genome Browser
Species Human (GRCh38)
Location 15:63300014-63300036
Sequence TTATATGTGCATGAAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127896071_1127896075 19 Left 1127896071 15:63299972-63299994 CCAGACGTGAAGGTGCTATCCAT 0: 1
1: 0
2: 0
3: 1
4: 43
Right 1127896075 15:63300014-63300036 TTATATGTGCATGAAATGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 183
1127896072_1127896075 0 Left 1127896072 15:63299991-63300013 CCATGAACATATGCCTTCATATA 0: 1
1: 0
2: 0
3: 23
4: 254
Right 1127896075 15:63300014-63300036 TTATATGTGCATGAAATGGCAGG 0: 1
1: 0
2: 1
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127896075 Original CRISPR TTATATGTGCATGAAATGGC AGG Intronic
906021523 1:42633484-42633506 TTGTATGTTAATGAAATGACTGG - Intronic
906108929 1:43310719-43310741 TTAGATGTCCAGGAAGTGGCTGG - Intronic
908426865 1:64015907-64015929 TGATATGTACTTGAAAGGGCTGG + Intronic
909768241 1:79385785-79385807 TTATATGAGGTTGAAATGGCAGG + Intergenic
911164089 1:94709707-94709729 TGATAAATGCATGAAATTGCAGG + Intergenic
911448071 1:98025055-98025077 GTATATGTGCTTAAAATTGCTGG + Intergenic
911529177 1:99023381-99023403 CTATTTGTGGATGAAATGACAGG - Intergenic
913448054 1:118970860-118970882 GAATATGTGCATGAACTGACAGG - Intronic
915984327 1:160448613-160448635 TTAAATATGAATGAATTGGCTGG - Intergenic
916361435 1:163974366-163974388 TTATGTGAGGATGAAATGACAGG + Intergenic
917131467 1:171746543-171746565 TTATCTGAGCATGAATTTGCTGG + Intergenic
919541952 1:198858259-198858281 TTCTATGTGCATGAACTGCGTGG - Intergenic
919784946 1:201253062-201253084 TTCTCTGTGCATGAGAAGGCTGG + Intergenic
919948252 1:202338612-202338634 TTATATGTGGATGACATGATTGG - Intronic
920461889 1:206146874-206146896 ATATATATGCATAAAAAGGCAGG + Intergenic
923670276 1:236034559-236034581 TTCTATGTGCATGAAACGTCTGG + Intronic
923740036 1:236646597-236646619 TTATATGTGAAGGAAAGGACCGG - Intergenic
1065723843 10:28651336-28651358 TTAATAGTGCATGAACTGGCTGG - Intergenic
1066117606 10:32254175-32254197 TTATATCTGCACCAGATGGCAGG + Intergenic
1067531781 10:47079521-47079543 TTTTATTTGTATGAAATGGCTGG - Intergenic
1072262390 10:93692212-93692234 TTACATGTGCATGGAATATCTGG + Intronic
1073414661 10:103370621-103370643 TTATAAGTGCCTCAAGTGGCCGG - Intronic
1076041753 10:127255802-127255824 CTCTATTTGCATGAAATTGCTGG - Intronic
1077263227 11:1634443-1634465 TTAAATGTAAAGGAAATGGCTGG + Intergenic
1079356079 11:19731208-19731230 TTTTATGTACAGGAAATGGGAGG - Intronic
1081659737 11:44880702-44880724 TCATCTGTGCATGAAGTGGTTGG + Intronic
1085976675 11:81663206-81663228 TTATATGTACTAGAAATGGTTGG + Intergenic
1086402501 11:86472273-86472295 TTACATGGGCATGAAAGGGGTGG - Intronic
1087665244 11:101037926-101037948 TCAAATGTGCACAAAATGGCAGG + Exonic
1088923287 11:114277384-114277406 ATATATATGCATGAAATGAGTGG + Intronic
1093051654 12:14511391-14511413 TTATAGGTGCCTGAAATATCAGG + Exonic
1093441778 12:19206738-19206760 TTATATATTCATGAAAAGGGAGG + Intronic
1095733836 12:45535335-45535357 TACTATGTGCAGGATATGGCTGG + Intergenic
1097292952 12:57934793-57934815 TTATTTTTGCAAGAATTGGCTGG + Intergenic
1097645777 12:62234121-62234143 GTATATGTCCAAGAAATGGGAGG + Intronic
1097964476 12:65564185-65564207 ATATAAGTCCATGAAATGGAAGG - Intergenic
1098186166 12:67898535-67898557 TTATATGATTATGAAAAGGCAGG - Intergenic
1098583664 12:72131574-72131596 ATATATTTGCATGAAATGATTGG + Intronic
1099491022 12:83288226-83288248 TTAAAAGTGTGTGAAATGGCTGG - Intergenic
1100485939 12:95027388-95027410 TTATATGGGTATGAAAAGGGAGG - Intronic
1100666608 12:96760503-96760525 TTCTATTTACATGAAATGTCTGG - Intronic
1100769577 12:97906786-97906808 GTATAAATGAATGAAATGGCTGG - Intergenic
1106582422 13:31029625-31029647 ATATATGTGCAGGAAGGGGCTGG + Intergenic
1107751507 13:43572187-43572209 TTATGTGAGCATGGAAGGGCTGG - Intronic
1107847845 13:44535926-44535948 CTATATGTGTATGAAAGGGTAGG - Intronic
1111606989 13:90551357-90551379 TTCTTTGTGCCTGAAATGACAGG - Intergenic
1112183188 13:97104905-97104927 TAATATGTTAATGAGATGGCTGG - Intergenic
1112543246 13:100337875-100337897 TTATATGTGCATACTATGTCAGG - Intronic
1117046276 14:51816575-51816597 TTCTATGGGCATGGGATGGCGGG + Intergenic
1118045759 14:61969381-61969403 TTATAGCTGAATGCAATGGCTGG + Intergenic
1123874587 15:24610980-24611002 TTGTATTTGCATGACATGGGTGG - Intergenic
1125431362 15:39597685-39597707 TTATATGTTTTTGATATGGCAGG - Exonic
1127668001 15:61167970-61167992 TTATAGGTGCCTGAAAAGGTAGG - Intronic
1127896075 15:63300014-63300036 TTATATGTGCATGAAATGGCAGG + Intronic
1130389210 15:83440265-83440287 TTACTTGTGCATGAAAGGGTGGG - Intergenic
1135246223 16:20859584-20859606 AAATTTGTGCAAGAAATGGCAGG + Exonic
1140922313 16:79550765-79550787 TTATGTGTGCCTGAAATTTCAGG - Intergenic
1141181754 16:81757880-81757902 TTCTATGTACATGAAATGTCCGG - Intronic
1146118093 17:30161241-30161263 ATACCTGTGCATGGAATGGCTGG + Intronic
1146748164 17:35350723-35350745 TTATCTGGGCTTGAAATTGCAGG - Exonic
1149091503 17:52788648-52788670 TCATATGTGAAGGAAATGGTAGG - Intergenic
1150153185 17:62827964-62827986 GTATATGTGCTGGAAAAGGCTGG - Intergenic
1150334561 17:64321115-64321137 GTATATGCTCATGAAATGGGTGG + Exonic
1151015990 17:70553456-70553478 TTATAGGTGGACTAAATGGCAGG - Intergenic
1152268966 17:79312686-79312708 TTTTATGTGCATGAAGGAGCTGG - Intronic
1154496890 18:14967795-14967817 TTTTATCTCAATGAAATGGCAGG - Intergenic
1155738330 18:29252618-29252640 TAATATGTTCATAAATTGGCGGG - Intergenic
1156737418 18:40277510-40277532 GTACATATGCATGAAATGACAGG + Intergenic
1156942965 18:42793176-42793198 TTAAATGTGCATAATATGGGAGG + Intronic
1157015485 18:43707526-43707548 TTATAAGAGCTGGAAATGGCTGG + Intergenic
1160055584 18:75476718-75476740 TTATAAGTTCACAAAATGGCAGG - Intergenic
1162198356 19:9003166-9003188 TTATTTGGGAATGAAATGGGAGG - Intergenic
1162579517 19:11520093-11520115 TTCCATTTGTATGAAATGGCCGG - Intronic
1164820398 19:31245949-31245971 GCTGATGTGCATGAAATGGCTGG + Intergenic
1165985973 19:39769123-39769145 TTACATGTGAATGAGATGACTGG - Intergenic
926652476 2:15361680-15361702 TAATATTTCCAGGAAATGGCTGG + Intronic
930355436 2:50312826-50312848 TTATATGATCAGGAAATGGAGGG - Intronic
931601067 2:64003578-64003600 TTATAGATGAATGAAATGGATGG + Intronic
935313667 2:101810102-101810124 TTTTAAGTGAAGGAAATGGCTGG + Intronic
935380140 2:102443594-102443616 TAATATGTCCAAGAAATGGGAGG + Intronic
935605071 2:104963640-104963662 TTAAATGTGAATGGACTGGCCGG - Intergenic
935894436 2:107719603-107719625 TTATATGGGTATAAAATGGGGGG - Intergenic
941218365 2:162741923-162741945 TTATAGATGCATAGAATGGCTGG + Intronic
941961767 2:171261037-171261059 TCACATGTGCATGAAAAGGAAGG - Intergenic
942260649 2:174158282-174158304 TTCTAGGTGAATGAAATGACAGG - Intronic
945335113 2:208582967-208582989 TTGTCTTTGCATGAAGTGGCTGG + Intronic
946086169 2:217174751-217174773 TTATAGGTTCATGTACTGGCAGG + Intergenic
946089580 2:217208812-217208834 TTATAAGTGACTGAGATGGCAGG + Intergenic
948677366 2:239605694-239605716 CAATATATGCATGAACTGGCTGG - Intergenic
1170050674 20:12141435-12141457 TTTTATGTGCATGAATTTCCTGG + Intergenic
1172831549 20:37839728-37839750 TTATTTGTTCATGCCATGGCTGG + Intronic
1173014450 20:39212255-39212277 ATATGTGTGCATGAAATGTGGGG - Intergenic
1177571253 21:22890081-22890103 TCATATTGGCATAAAATGGCAGG - Intergenic
1179816504 21:43909590-43909612 TCAAATGTGTATGAAAAGGCCGG - Intronic
1181561068 22:23700721-23700743 TTATCTGTGCATGAACAGGTAGG - Intergenic
1182203096 22:28593572-28593594 TTATATGTTCATCAAATACCCGG + Intronic
949968309 3:9378886-9378908 TGATATGTGTATGAAATAGCAGG + Intronic
950398182 3:12750100-12750122 TTATCTGTGCCTGAAAAGTCAGG + Intronic
950517539 3:13477194-13477216 TTAAATGTGTATGAAATCACAGG + Intergenic
954955376 3:54513997-54514019 TTATATGTGCGGCAAATGGAAGG + Intronic
955469694 3:59273641-59273663 TTAGATGTGCGTGAAATGTATGG - Intergenic
955705243 3:61720677-61720699 CTGTATGTGCAGGATATGGCAGG + Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
957856996 3:85892369-85892391 TAATATGTTCATGATATGGTTGG + Intronic
959606577 3:108248185-108248207 TAAAATGTACATGAAATGCCTGG + Intergenic
963941527 3:151100363-151100385 TTATCCATGAATGAAATGGCTGG - Intronic
964097110 3:152944928-152944950 TTAAATGTGCAGGAAATTACAGG + Intergenic
964467093 3:157006483-157006505 ATACATAGGCATGAAATGGCTGG - Intronic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
965337652 3:167447768-167447790 TTATATTTGGATGAAATTGCTGG - Intronic
967254874 3:187580345-187580367 TTATATGTGCTTGAAACAGTAGG + Intergenic
967787891 3:193517204-193517226 TTACATGTCCACCAAATGGCAGG + Intronic
972387095 4:38577667-38577689 ATAAATGTCCATGAAATGGGTGG - Intergenic
974560971 4:63517547-63517569 GTATATGTGAATGATGTGGCTGG - Intergenic
976961217 4:90977444-90977466 TTATATGTGCTTGAATTGGTGGG + Intronic
977312815 4:95408249-95408271 TACTATGTGCTTTAAATGGCTGG + Intronic
978046078 4:104129403-104129425 GTATATGTGCATGGAGTGGCAGG - Intergenic
978214665 4:106184755-106184777 GTATATGTGCATGCAATTACTGG + Intronic
978378720 4:108104177-108104199 GTATATGTATATGAAATGTCCGG + Intronic
978407879 4:108398982-108399004 TTAGATGTGAATGAAGTGGGTGG + Intergenic
979220144 4:118213381-118213403 TTAGAAGTGGATGAAATTGCAGG - Intronic
980976811 4:139618950-139618972 TTATATCTGCATACAATGCCTGG + Intergenic
982292926 4:153797022-153797044 TTATGTTGGCATGAAATAGCTGG + Intergenic
982585648 4:157234275-157234297 TTATAGGTGCATGGAAGGGAAGG + Intronic
983256475 4:165405892-165405914 TTATATTGGCATAAAATGGCAGG + Intronic
983717599 4:170804881-170804903 TTATATGTTAATGATATGGGAGG + Intergenic
984139358 4:175983855-175983877 TTATATTTTCCTTAAATGGCGGG + Intronic
984446810 4:179847948-179847970 TTTCATGTGTATGAAATGTCCGG + Intergenic
985348244 4:189030267-189030289 TCAAGTGTGCATGAAAAGGCTGG + Intergenic
986201317 5:5581453-5581475 TAATATGGGCAGGACATGGCAGG - Intergenic
986380792 5:7183567-7183589 CTAAATGTGCGTGAGATGGCTGG + Intergenic
986423022 5:7603044-7603066 TTGAATGTAGATGAAATGGCTGG - Intronic
987675619 5:21069437-21069459 TTATATGCTAATGAGATGGCTGG + Intergenic
990925204 5:61014042-61014064 TTGTATGCTCATGAGATGGCTGG + Intronic
991271885 5:64793617-64793639 TTTTAAGTGTATGAAATGACTGG + Intronic
992709979 5:79442570-79442592 TTTTATTGGCATGAAATGGAAGG - Intronic
992867557 5:80973085-80973107 TTATCTGTCCATGAAATGAATGG + Intronic
995625584 5:114072434-114072456 TTAGCTATGCATAAAATGGCAGG + Intergenic
995625612 5:114072952-114072974 TTACCTATGCATAAAATGGCAGG - Intergenic
998509826 5:142702499-142702521 TTGCATGTGCATGCAATTGCTGG + Intergenic
998727407 5:145033388-145033410 TTTTAAGTGTATGAATTGGCTGG - Intergenic
999564403 5:152841312-152841334 CAATATGAGCATAAAATGGCAGG + Intergenic
1000579653 5:163019842-163019864 TTGTAAGTGCATGAAATTGAAGG - Intergenic
1002390563 5:178908641-178908663 TAATTTGTGCAAGAAATGGCAGG + Intronic
1003735474 6:8873325-8873347 TTATTTATCCATGAAACGGCAGG + Intergenic
1004591479 6:17055976-17055998 TTCTAAGTGTTTGAAATGGCAGG - Intergenic
1009462747 6:63933702-63933724 TTCTATGTTCATGAGATGGCTGG - Intronic
1012927328 6:105280889-105280911 ATATATGCTCCTGAAATGGCAGG - Intronic
1013068253 6:106704392-106704414 TTAAATGTGCATGATGTGCCTGG + Intergenic
1013499541 6:110734304-110734326 TTAAAAGTTGATGAAATGGCTGG - Intronic
1015269047 6:131320716-131320738 TTAAAGGTCAATGAAATGGCAGG + Intergenic
1017772998 6:157657532-157657554 TGATATGTGCACGAAATCTCAGG + Intronic
1020645842 7:10813105-10813127 TTATAGGGGCATGAATAGGCAGG - Intergenic
1022001073 7:26226718-26226740 TTCTATGAGCATGAAATGTGAGG - Intergenic
1023228060 7:37992762-37992784 TCATTTTTGCATGAAATAGCTGG + Intronic
1024944408 7:54794420-54794442 TTATGTGTGGAAGAAATGGGGGG + Intergenic
1027463421 7:78484485-78484507 TTATATCTGCATGAACTGGGTGG - Intronic
1028121506 7:87060084-87060106 TAGGGTGTGCATGAAATGGCGGG + Intergenic
1028568782 7:92263127-92263149 TTGTATGGGAATGAAATGACAGG + Intronic
1029455673 7:100670341-100670363 TTATATGTCACTGAATTGGCAGG + Intergenic
1030201530 7:106910645-106910667 TTATATATGCATGAAAAGGCTGG + Intergenic
1030424756 7:109360948-109360970 TTATGTGTGAAGAAAATGGCAGG + Intergenic
1031109566 7:117591109-117591131 GTATATGTATATAAAATGGCTGG + Intronic
1033705843 7:143884352-143884374 TTTTATGTAAAGGAAATGGCAGG + Intronic
1036058514 8:5288380-5288402 TAATATGGGAATAAAATGGCAGG - Intergenic
1036083555 8:5586987-5587009 TTCTATTTACATGAAATGTCTGG - Intergenic
1037393688 8:18420307-18420329 TTATATGGACATGATATGGCAGG - Intergenic
1039876071 8:41587278-41587300 TTATATGCCTCTGAAATGGCTGG - Intronic
1040809216 8:51431781-51431803 GTAGATGTCCATGAAATGGTTGG - Intronic
1041901185 8:62985018-62985040 TTATTTGTGCATGAAATAGGGGG - Intronic
1042403959 8:68381946-68381968 ATATATGTGCATTAAAAGACTGG - Intronic
1043155553 8:76774344-76774366 TTAAATCTGAATGAAATGGATGG - Intronic
1043504797 8:80891681-80891703 TTAAATGTGCATGAAAAAACGGG - Intergenic
1043701462 8:83293261-83293283 ACATATGTGCATCAAATTGCTGG - Intergenic
1045937144 8:107693581-107693603 TAATATGTACATGAAAATGCAGG + Intergenic
1046629573 8:116610039-116610061 TTGTGTGTGCAGGAAATGACAGG - Intergenic
1053531896 9:38890855-38890877 GTATATGTGCCTGAAAGGTCGGG - Intergenic
1053942394 9:43265860-43265882 TTATAAATGCATGCAATCGCAGG - Intergenic
1054204121 9:62115265-62115287 GTATATGTGCCTGAAAGGTCGGG - Intergenic
1054634242 9:67473100-67473122 GTATATGTGCCTGAAAGGTCGGG + Intergenic
1055015250 9:71609799-71609821 TTATATGTGAATGAAATGAATGG - Intergenic
1056342219 9:85647717-85647739 TTCTATGTGAATGTAATGGTGGG + Intronic
1056997332 9:91475178-91475200 TTATGAGTACATGAAATGGTTGG - Intergenic
1057816756 9:98301579-98301601 TTCTATGTGACTTAAATGGCAGG + Intronic
1057817705 9:98307740-98307762 TTGTGTGTGGATGAAATGGGAGG + Intronic
1058169216 9:101659085-101659107 TTATCTGTGTATGAAGTTGCAGG - Intronic
1058197890 9:102001261-102001283 TTATCAGTGAATGAAATGGCTGG - Intergenic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1062651837 9:137581777-137581799 TGATTTATGCATGAAGTGGCTGG - Intergenic
1187537189 X:20152747-20152769 TTATATGTTCACAAAATGGAAGG - Exonic
1192003477 X:67182806-67182828 TTAGAGATGAATGAAATGGCTGG - Intergenic
1192557549 X:72102416-72102438 TTATATATACAGGAAATAGCAGG - Intergenic
1193665952 X:84316901-84316923 TAATATGTGGAAGAAATGACTGG + Intergenic
1195117859 X:101717877-101717899 TTATATGATAATGAAATGACTGG + Intergenic
1197282849 X:124557856-124557878 TCATATGTGCATGTAATGTATGG + Intronic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198319747 X:135508574-135508596 GTATATGTGCATAAAATATCTGG - Intergenic
1201254119 Y:12090246-12090268 TTATATGTGGATGAAAAGAATGG - Intergenic
1201637594 Y:16142576-16142598 CTATGTTTGCATCAAATGGCTGG - Intergenic
1202269561 Y:23058299-23058321 TCAAATCTACATGAAATGGCTGG - Intergenic
1202422555 Y:24692045-24692067 TCAAATCTACATGAAATGGCTGG - Intergenic
1202448234 Y:24978041-24978063 TCAAATCTACATGAAATGGCTGG + Intergenic