ID: 1127896094

View in Genome Browser
Species Human (GRCh38)
Location 15:63300174-63300196
Sequence TGGTGCCATCTCGAGCCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127896092_1127896094 9 Left 1127896092 15:63300142-63300164 CCTCTGGTATCTGGTCAGGGGTC 0: 3
1: 6
2: 11
3: 13
4: 116
Right 1127896094 15:63300174-63300196 TGGTGCCATCTCGAGCCATCTGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127896094 Original CRISPR TGGTGCCATCTCGAGCCATC TGG Intronic
904143016 1:28368657-28368679 TGGTGCGATCTCGACCCCCCAGG + Intergenic
905877979 1:41445565-41445587 TGGTGCCATCTAGAGGGGTCAGG - Intergenic
912129774 1:106587077-106587099 TGGTGCCATATCGAGGGCTCAGG + Intergenic
912964930 1:114229142-114229164 TGGTCCCATCTCTAGCCACATGG - Intergenic
924019409 1:239765139-239765161 TAGTGCCATCTCAAACAATCTGG - Intronic
1063965545 10:11343550-11343572 TTGTGCCACCTCGATCCCTCAGG + Intergenic
1065415218 10:25477637-25477659 TGGTGCCCTTTAGAGCCATTTGG + Intronic
1067452258 10:46389220-46389242 TGTTGCCATCTTGAAACATCTGG - Intronic
1067569550 10:47361381-47361403 TGGCGCCATCTGGAGGCAGCAGG - Intergenic
1067584979 10:47470535-47470557 TGTTGCCATCTTGAAACATCTGG + Intronic
1074013338 10:109507007-109507029 GGATCCCATCTCTAGCCATCTGG + Intergenic
1077366094 11:2161980-2162002 TGGCGGCATCTTGGGCCATCCGG - Intergenic
1083144305 11:60747254-60747276 CTGTGCCATCTTGAGCCCTCAGG + Intergenic
1090473211 11:126998040-126998062 TGGAGCCATTTAGAGCCATGTGG + Intronic
1094445408 12:30524338-30524360 TGGTGCCACAGGGAGCCATCAGG - Intergenic
1097688803 12:62715002-62715024 TCGTGCCATGTCCAGCCACCTGG - Intronic
1098497653 12:71154927-71154949 TTGTTCCATCTCTGGCCATCAGG - Intronic
1100833452 12:98541060-98541082 TTGTGCCATCTGTAGCCATTAGG + Intronic
1106681290 13:32011273-32011295 TGTTGCCCTCTCGAGTCACCTGG + Intergenic
1107877024 13:44799907-44799929 TGGTGCCATCCCAGGCCATCTGG + Intergenic
1113541699 13:111114818-111114840 TGGTTCCATCTGAAGCCATATGG - Intronic
1114037663 14:18645287-18645309 TGGTGCCACCTGGAGGCAGCCGG - Intergenic
1114120971 14:19669736-19669758 TGGTGCCACCTGGAGGCAGCCGG + Intergenic
1120506310 14:85356873-85356895 TGAAGCCAGCTCTAGCCATCTGG - Intergenic
1122956780 14:105074894-105074916 TGGAGCCAGCTGGAGCCAACAGG + Intergenic
1123084943 14:105713042-105713064 TGGAGCCATGTGGAGCCATGAGG - Intergenic
1127896094 15:63300174-63300196 TGGTGCCATCTCGAGCCATCTGG + Intronic
1129003539 15:72353574-72353596 TGGGGCTATCTCAAGCCACCAGG + Intronic
1132100508 15:99019791-99019813 TGATGAAATCTCGAGGCATCTGG - Intergenic
1137483761 16:48874702-48874724 TGGTGCCTCCTCCAGCCCTCAGG + Intergenic
1137626579 16:49912651-49912673 TGGTTCCATCCAGAGCCATCTGG - Intergenic
1138386554 16:56639337-56639359 TGGGGCCATCTCCAGGAATCTGG + Intronic
1141848142 16:86625287-86625309 TGCTGCCAAATGGAGCCATCAGG + Intergenic
1142111701 16:88335439-88335461 TGGTGCCATGGCGAGACAGCTGG + Intergenic
1142500973 17:332805-332827 TGGTGCCACCTCGACCCCGCCGG + Intronic
1153508749 18:5830527-5830549 TGGTGGCATCTCTGGCCCTCAGG - Intergenic
1158396321 18:57080980-57081002 GGCTGCCCTCTGGAGCCATCAGG - Intergenic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1164386687 19:27777353-27777375 TGGCGCCAGCTAGAGCCATCTGG - Intergenic
1167040868 19:47021714-47021736 CGGCGCCATCTCCAGCCAGCTGG + Exonic
928456716 2:31429013-31429035 TTGTGCCATCTGGACCCATGTGG + Intergenic
929277134 2:40038146-40038168 TGATGCCATCTAGAAGCATCAGG - Intergenic
936878012 2:117215578-117215600 TGGAGCCATGTTGTGCCATCAGG - Intergenic
936922090 2:117699402-117699424 TGTTGCCATCCCGGGCCACCTGG - Intergenic
943527772 2:189039322-189039344 GGGTGCTTTTTCGAGCCATCGGG + Exonic
946404140 2:219483769-219483791 TGGAGGCAGCTCGTGCCATCCGG - Exonic
948366219 2:237456485-237456507 TGAGGACATCTGGAGCCATCTGG + Intergenic
1180461792 22:15572329-15572351 TGGTGCCACCTGGAGGCAGCCGG - Intergenic
1184026685 22:41862843-41862865 TGGAGCCATCTCCAGTCAGCCGG - Intronic
950136222 3:10582847-10582869 TGGTACCAGCTGGAGCCATGTGG - Intronic
952011567 3:28905951-28905973 TGGTGCCATCCTGGGCCATGTGG + Intergenic
952877194 3:37956222-37956244 AGCTGCCATTGCGAGCCATCAGG + Intronic
966216719 3:177511030-177511052 TGATGGCATCTGGAACCATCTGG + Intergenic
969077504 4:4591776-4591798 TGGTGCCATCTCCAGACAATAGG - Intergenic
997192046 5:131946266-131946288 AGGAGCCATCTCTAGACATCTGG + Intronic
1010395051 6:75382072-75382094 TGGTGCCATCCATAGCCATCTGG + Intronic
1016041474 6:139436295-139436317 TGGTGTCATCTCTTGCCATGTGG - Intergenic
1017036516 6:150272089-150272111 TGGTGCCATCCCAGGCCTTCTGG + Intergenic
1019361577 7:607613-607635 CGGTGCCATCTCTGGCCTTCGGG - Intronic
1023106150 7:36764954-36764976 TGGCGCCATCTCAGGCCATTCGG + Intergenic
1024913002 7:54467221-54467243 GGGTGCCATCTGGAGCTGTCTGG + Intergenic
1026237252 7:68538140-68538162 TGGTGCCATCTCGGGCTGTCTGG - Intergenic
1026933436 7:74238020-74238042 GGGTGACCTCTGGAGCCATCAGG - Intronic
1029820680 7:103143604-103143626 TGGAGCCATCTTGAGCCAGGAGG + Intronic
1037969508 8:23162025-23162047 TGTTGCCATCTAGAGGCAGCTGG - Intronic
1039850912 8:41364259-41364281 TGCTGCCATCTCAGGCTATCTGG + Intergenic
1040029827 8:42814214-42814236 TGTTGCCCTCTGGAGCCACCTGG + Intergenic
1040587444 8:48756956-48756978 TGGAGCCATCTTGGGCCATCTGG - Intergenic
1040997852 8:53419871-53419893 TGGTGCCATCCCAGGCCATCTGG + Intergenic
1046679548 8:117153280-117153302 TGGTGCTATCTCTAGTCCTCTGG + Intronic
1051920245 9:22256696-22256718 TGGTGCCTTCGCCTGCCATCAGG - Intergenic
1055209509 9:73773178-73773200 TGGAGCCCTCTGGAGCCCTCTGG + Intergenic
1060788085 9:126466175-126466197 TGGGGCCATCTCAGGCCATCCGG - Intronic
1186208153 X:7221579-7221601 TGGTGCCATCTTGAGCTCTCTGG - Intronic