ID: 1127899512

View in Genome Browser
Species Human (GRCh38)
Location 15:63330602-63330624
Sequence TACCCCCACCAGCCACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127899512_1127899520 18 Left 1127899512 15:63330602-63330624 CCAGTCTGTGGCTGGTGGGGGTA 0: 1
1: 0
2: 3
3: 24
4: 219
Right 1127899520 15:63330643-63330665 GGGGAGCTGAGCAAAGTCTATGG 0: 1
1: 0
2: 1
3: 17
4: 196
1127899512_1127899516 -1 Left 1127899512 15:63330602-63330624 CCAGTCTGTGGCTGGTGGGGGTA 0: 1
1: 0
2: 3
3: 24
4: 219
Right 1127899516 15:63330624-63330646 ACCCTTCATGCCTGGTCTTGGGG 0: 1
1: 0
2: 1
3: 9
4: 161
1127899512_1127899515 -2 Left 1127899512 15:63330602-63330624 CCAGTCTGTGGCTGGTGGGGGTA 0: 1
1: 0
2: 3
3: 24
4: 219
Right 1127899515 15:63330623-63330645 TACCCTTCATGCCTGGTCTTGGG 0: 1
1: 0
2: 2
3: 6
4: 119
1127899512_1127899514 -3 Left 1127899512 15:63330602-63330624 CCAGTCTGTGGCTGGTGGGGGTA 0: 1
1: 0
2: 3
3: 24
4: 219
Right 1127899514 15:63330622-63330644 GTACCCTTCATGCCTGGTCTTGG 0: 1
1: 0
2: 0
3: 4
4: 91
1127899512_1127899513 -9 Left 1127899512 15:63330602-63330624 CCAGTCTGTGGCTGGTGGGGGTA 0: 1
1: 0
2: 3
3: 24
4: 219
Right 1127899513 15:63330616-63330638 GTGGGGGTACCCTTCATGCCTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1127899512_1127899521 27 Left 1127899512 15:63330602-63330624 CCAGTCTGTGGCTGGTGGGGGTA 0: 1
1: 0
2: 3
3: 24
4: 219
Right 1127899521 15:63330652-63330674 AGCAAAGTCTATGGAGAGCAAGG 0: 1
1: 0
2: 1
3: 11
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127899512 Original CRISPR TACCCCCACCAGCCACAGAC TGG (reversed) Intronic
900965252 1:5952908-5952930 TACCCACCCCAGCCTCAGCCGGG + Intronic
902470019 1:16642766-16642788 CACCCCCAGCAGCCACCGGCAGG - Intergenic
902618141 1:17635055-17635077 CGCCCTCACCAGCCACAGCCTGG + Intronic
903153880 1:21431019-21431041 GACCCCCACCAACCCCAGCCAGG - Intergenic
903280243 1:22245992-22246014 AAGCCCCTCCAGCCCCAGACTGG - Intergenic
903360392 1:22773392-22773414 CAGCCCCACCAGCCCCAGACAGG + Intronic
905094509 1:35457705-35457727 TCTCACCACCAGCCACAGACAGG + Intronic
906009795 1:42512435-42512457 TCCCCCCACCCGCCACAGTGAGG - Intronic
906157042 1:43619905-43619927 CACCCCCACCAGCCAGGCACAGG - Intronic
910748613 1:90601829-90601851 TAGCCCCACCACCCCCTGACAGG - Intergenic
912635844 1:111291825-111291847 TACCCCCACCCCCCCCCGACAGG - Intronic
914437033 1:147669794-147669816 TCGCCCCACCAGCCCCAGCCCGG + Intronic
915625777 1:157113293-157113315 GCACCCCACCAGCCACAGGCAGG - Intergenic
916648256 1:166810658-166810680 TACCCCCACACCCCACTGACAGG + Intergenic
919756506 1:201069413-201069435 TGCCCCCTCCAGCCTCAGTCTGG - Intronic
919973337 1:202594798-202594820 TACCCCCACCAGAAACAGACTGG - Exonic
920061682 1:203231118-203231140 TAAGCCCACCGGCCAAAGACTGG - Intronic
921158154 1:212453835-212453857 TGCACCCACCAGCCACCCACTGG - Intergenic
922798296 1:228352302-228352324 TACCATCACTAGCCACACACGGG + Intronic
1064647852 10:17478528-17478550 TTCACCCACCATCCACACACAGG + Intergenic
1067057965 10:43063414-43063436 AACACCCTCCAGCCAGAGACTGG - Intergenic
1067099634 10:43325240-43325262 TGACCCCATCAGCCACAGGCCGG + Intergenic
1070289451 10:75105004-75105026 TACCACCCCATGCCACAGACGGG - Intronic
1071049444 10:81428639-81428661 TATCCCCAGCTGCCACATACTGG - Intergenic
1071686881 10:87767541-87767563 CAGCCCCTGCAGCCACAGACTGG - Intronic
1072355524 10:94605950-94605972 TCCCCCCACCTTCAACAGACTGG - Intronic
1075702918 10:124480940-124480962 AACCCCCAACAGAAACAGACAGG - Intronic
1076479142 10:130772868-130772890 TACCCCCTCAAGCCTCACACTGG - Intergenic
1076599650 10:131648884-131648906 TACCACTGCCAGCCACACACTGG + Intergenic
1076678478 10:132159960-132159982 GACCCCCACCAGCATCACACAGG - Intronic
1076678663 10:132160640-132160662 GACCCCCACCAGCATCACACAGG - Intronic
1076678720 10:132160825-132160847 GACCCCCACCAGCATCACACAGG - Intronic
1076910447 10:133385465-133385487 TACCACCCCGTGCCACAGACAGG - Intronic
1077269058 11:1666545-1666567 TACCCCCACCACCCACCCAGGGG + Intergenic
1077271490 11:1684170-1684192 TACCCCCACCACCCACCCAGGGG - Intergenic
1077441885 11:2572658-2572680 AACCCCCACCCGCCACTTACCGG + Intronic
1077562214 11:3271118-3271140 TCCCACCACCACCCACAGGCAGG - Intergenic
1077568108 11:3316938-3316960 TCCCACCACCACCCACAGGCAGG - Intergenic
1078293185 11:10036254-10036276 TAACCCCACTACCCACTGACAGG - Intronic
1080873574 11:36257791-36257813 TGCCTCCACCCTCCACAGACGGG - Intergenic
1082000469 11:47391268-47391290 TACCCTCACCAGCCCCACCCAGG - Intergenic
1084422001 11:69065171-69065193 TGCCCCCACCACCCACAGACAGG - Intronic
1084668680 11:70592496-70592518 CACCCCCTCCAGCCACGGCCAGG + Intronic
1085542162 11:77281756-77281778 TTCCCCCACAAGTCACAAACTGG - Intronic
1088223964 11:107598731-107598753 TGCCACCACCAGGCACAGACTGG - Intronic
1089604802 11:119635649-119635671 TCCACCCACCAGCCACGGGCAGG - Intronic
1090645758 11:128765467-128765489 TATCCCCACCGTCCACAAACGGG + Intronic
1093343414 12:18007882-18007904 TCCCCCCACCACACACACACTGG - Intergenic
1094189781 12:27686430-27686452 TATTCCCAAGAGCCACAGACTGG + Intronic
1094440472 12:30470512-30470534 TACTCCCACCACCCACAGCTCGG + Intergenic
1094761429 12:33537795-33537817 TAACCCCCCCACCCACCGACAGG + Intergenic
1096392633 12:51240963-51240985 AAGGCCCAACAGCCACAGACTGG - Exonic
1098443090 12:70538313-70538335 TCCCCACAACAGCCACAGATGGG + Intronic
1099516282 12:83600282-83600304 TACCCCCACAACCCCCTGACAGG - Intergenic
1103950904 12:124550475-124550497 TTCCCCCAGCAGCCACTGGCAGG + Intronic
1104328311 12:127820833-127820855 ACACCCCACCAGCCTCAGACTGG + Intergenic
1105438327 13:20395884-20395906 TGTCCACACCAGCCACAGCCTGG + Intergenic
1105741162 13:23324484-23324506 TGCTCACACCGGCCACAGACAGG - Exonic
1106125229 13:26895660-26895682 TACTCCCTCCACTCACAGACAGG - Intergenic
1107371793 13:39758618-39758640 TATCCCCACCAGCAACATATGGG - Intronic
1107585263 13:41840305-41840327 TAGCCCCGCCATCCCCAGACAGG - Intronic
1114161901 14:20177820-20177842 TACCCCTAACAGCCCCAAACTGG + Intergenic
1116143845 14:41037764-41037786 TACCCCAACCAGTGACAGACAGG - Intergenic
1116154777 14:41189405-41189427 GACCCCCACCAGCCGAAGACAGG - Intergenic
1117240263 14:53825147-53825169 AACCCCCAGGGGCCACAGACTGG + Intergenic
1118249800 14:64148529-64148551 CGCCCCCACCATCCACACACAGG + Intronic
1118614882 14:67568437-67568459 CACCGCCACCATCCACTGACAGG - Intronic
1119195096 14:72711913-72711935 CACCCCCACCACCCCCAAACTGG - Intronic
1120826581 14:88961659-88961681 TACCCCCAACTGCCCCAGCCTGG - Intergenic
1122264825 14:100541681-100541703 GAGCCCCACCAGCCACAGCCAGG + Intronic
1122694156 14:103544792-103544814 TACACCCCACAGCCACAGGCAGG + Intergenic
1124360314 15:29032127-29032149 GACACACACCAGCCACAGGCTGG - Intronic
1124646505 15:31440956-31440978 TCCCACCCCCAGCCAAAGACTGG - Intergenic
1125171740 15:36773059-36773081 TCCCCCCACCCCCCACAAACAGG - Intronic
1125745445 15:41994425-41994447 CAGGCCCACCAGTCACAGACAGG + Intronic
1127150976 15:56075130-56075152 TCCTCCCACCAGCCACTGGCAGG - Intergenic
1127326380 15:57899409-57899431 TACCCCCACCCCCCGCCGACAGG + Intergenic
1127899449 15:63330172-63330194 TACCTCCCCAAGCCACAGGCTGG - Intronic
1127899512 15:63330602-63330624 TACCCCCACCAGCCACAGACTGG - Intronic
1127961294 15:63892886-63892908 AAACCACACCAGCCACAGACAGG + Intergenic
1127996817 15:64157866-64157888 TGTCCCCACCAGCCAGAGTCTGG - Intronic
1129072589 15:72963523-72963545 TACCCCAACCAGTCCCAGGCTGG + Intergenic
1130750370 15:86705126-86705148 GCCCCCCACCAGCCACTGACAGG - Intronic
1131158541 15:90089828-90089850 TGCCCCCACCAGGCCTAGACTGG - Intronic
1131510019 15:93044678-93044700 CACCCCCACCAGAGACACACTGG - Intronic
1132643534 16:988560-988582 AACCCCCACCAGCCGGAAACAGG - Intergenic
1133288226 16:4701193-4701215 AACCCCCACCCGCCACACAGGGG + Intronic
1135877234 16:26214010-26214032 AACCCCCATCAGCAGCAGACTGG - Intergenic
1136412024 16:30083144-30083166 TTCACCTACCAGACACAGACCGG - Intronic
1137551324 16:49439682-49439704 TAACCCCATAAGCCACAAACTGG - Intergenic
1139563670 16:67759450-67759472 TCCCCCTACCAGCCTCAGTCAGG + Intronic
1140249980 16:73287324-73287346 CACACCCACCACCCACACACTGG - Intergenic
1140249996 16:73287379-73287401 CACACCCACCACCCACACACTGG - Intergenic
1140250011 16:73287434-73287456 CACACCCACCACCCACACACTGG - Intergenic
1141180913 16:81752812-81752834 TGCCCCCAACAGCCACTCACCGG - Intronic
1141986598 16:87584387-87584409 TACCCACAACAGCCAGAGGCTGG + Intergenic
1142278967 16:89137878-89137900 TACCCCAACACGCCTCAGACAGG - Intronic
1142593944 17:1020610-1020632 GACCTCCACCAGCCACCTACGGG - Intronic
1142594462 17:1022776-1022798 TACCCAGGCCAGCCACAGATAGG + Intronic
1144021763 17:11244327-11244349 TCCCCCTACCACACACAGACAGG - Intronic
1144725396 17:17499384-17499406 CCCCCCCACCAGCCCCAGGCAGG + Intergenic
1145014554 17:19387722-19387744 TCCCCCCACCAGCCCCAGCCAGG - Intergenic
1145822724 17:27852168-27852190 CACCCCCACCATCACCAGACTGG + Intronic
1146496025 17:33323249-33323271 TATTCCTACTAGCCACAGACTGG + Intronic
1148292460 17:46466432-46466454 TAGCCCCCCCACCCACTGACAGG + Intergenic
1148314644 17:46684124-46684146 TAGCCCCCCCACCCACTGACAGG + Intronic
1149559032 17:57594919-57594941 TACCACCACCCGCCAAATACTGG - Intronic
1151658878 17:75508345-75508367 TCCCCCCACCTGTCACAGCCCGG + Intronic
1152231398 17:79115666-79115688 TACCCCCCTCCGCCACAGAACGG - Exonic
1152412382 17:80134179-80134201 TACACACATGAGCCACAGACCGG - Intergenic
1152881077 17:82815584-82815606 TCTCCCCACCAAACACAGACAGG - Intronic
1154000029 18:10474802-10474824 TCCCTCCAGGAGCCACAGACAGG - Intronic
1154171852 18:12057818-12057840 TACCACCACCAACCACAGTGAGG + Intergenic
1154939798 18:21100475-21100497 AGCCCCCATCAGCCAAAGACAGG + Intronic
1157551583 18:48585524-48585546 CACCCACACCATCCACACACTGG + Intronic
1157580856 18:48773472-48773494 CACCCCCACCAGCCAGAGCCAGG + Intronic
1160691796 19:463768-463790 TAGCCCCTCCAGCCAAAGCCAGG + Exonic
1160715669 19:575516-575538 CACCCCCACCGGCCGCAGCCAGG - Intronic
1161106679 19:2447208-2447230 TCCCTCCACCATCCACACACAGG + Intronic
1161219927 19:3113781-3113803 TTCCCCCACAGGCCACAGGCCGG - Intronic
1163033690 19:14560120-14560142 TACCCCCTCCTGCCGCAGCCCGG + Intronic
1163241874 19:16068984-16069006 GACCCCCACCATCTACACACAGG - Intronic
1163931151 19:20393281-20393303 AACTCCTACCAGCCACAGTCTGG - Intergenic
1164489754 19:28697007-28697029 TACCCAAACCAGACAAAGACGGG + Intergenic
1165907981 19:39205070-39205092 CACCCCCACCAGGCTCAGACTGG + Intergenic
1167064320 19:47172899-47172921 TAACACCACCAGCTACAGAGGGG + Intronic
1167568657 19:50272833-50272855 GCCACTCACCAGCCACAGACAGG + Intronic
927642306 2:24852858-24852880 CAGCCCCACCAGCCACACTCTGG - Intronic
928816890 2:35307681-35307703 GACCCCCTGCTGCCACAGACTGG + Intergenic
934715227 2:96539113-96539135 TTCCCCCACAAACCACAGCCAGG - Intronic
934980596 2:98836594-98836616 TGGCCCCTCCAACCACAGACAGG - Intronic
935627636 2:105184493-105184515 TAGCCCTTGCAGCCACAGACTGG + Intergenic
937906266 2:127054349-127054371 TTCCGCCACCATCCACAGACTGG + Intronic
938062940 2:128266656-128266678 GACCCCCACCAACCCCAGCCAGG + Exonic
940876963 2:158907481-158907503 TACCCCCACCACCCTGGGACTGG - Intergenic
944696092 2:202201640-202201662 AAGACCCAACAGCCACAGACTGG + Intergenic
947188227 2:227472949-227472971 TTCCCCCACCCCCCACAGCCCGG - Intronic
948183931 2:236004169-236004191 GACCCCCAACTGCCACAGTCAGG - Intronic
948638838 2:239360400-239360422 TAGCTCCAACAGCCACAGACAGG + Intronic
948785975 2:240353188-240353210 TTTCCCAAGCAGCCACAGACAGG + Intergenic
1168861359 20:1048231-1048253 TTCCCCATCCAGCCACACACTGG - Intergenic
1172190281 20:33058118-33058140 TTCACCCACCAGCCATAGACTGG - Intronic
1172691214 20:36791570-36791592 TACCACTCCCAGCCATAGACTGG + Intronic
1172884362 20:38221382-38221404 AACCCCCACCAGGCACTGAGGGG + Intronic
1174143244 20:48431919-48431941 TTCCACAACCAGCGACAGACAGG - Intergenic
1174199091 20:48794540-48794562 CACCCCCACCACCCACTGATGGG - Intronic
1175309741 20:58003495-58003517 TGCCCCCTCCAGCCTCAGCCTGG - Intergenic
1175394029 20:58646401-58646423 TACCCCCACCAGGCAGAGAAAGG + Intergenic
1176269834 20:64230613-64230635 CACCTGCACCAGGCACAGACTGG - Intronic
1176867275 21:14060500-14060522 CACCACCACCAGCCACAGTGAGG + Intergenic
1177320393 21:19513020-19513042 TACCCCCACCAGCGATAGCCAGG + Intergenic
1179154116 21:38835017-38835039 AGCCCCCACCAGCCCCAGAGTGG - Intergenic
1179173833 21:38992789-38992811 CACCCCCACAGGCCACAGGCTGG - Intergenic
1179295473 21:40058238-40058260 TACCCCCAAAACCCACATACTGG + Intronic
1180245254 21:46542926-46542948 TGCCAGCACCACCCACAGACAGG - Intronic
1180928732 22:19574290-19574312 CACCCCCAACAGCCTCAGTCTGG - Intergenic
1181093336 22:20489289-20489311 CAGCCCCACCACACACAGACTGG + Intronic
1181523115 22:23460568-23460590 TTGCCCCGCCAGCCACAGGCTGG + Intergenic
1181531694 22:23521005-23521027 GACTCCCACCAGCCACTGCCGGG + Intergenic
1181662443 22:24362230-24362252 AGCCCCCACCAAACACAGACCGG - Intronic
1182474383 22:30568509-30568531 TCCACCCACCAGACACTGACTGG + Intronic
1184243678 22:43224743-43224765 TCCCCCAACCAGACACAGGCTGG - Intronic
1184348107 22:43925278-43925300 CACCCCCACCACACACACACAGG - Intronic
950148743 3:10669763-10669785 CACCCCCACCCCCCAGAGACAGG + Intronic
954618126 3:51980662-51980684 AACCCCCCCAAGCCACAGACAGG - Intronic
954979135 3:54727750-54727772 TGCCCCCACCAGCCACTGACAGG - Intronic
956303304 3:67796212-67796234 TGCTCCCACCAGCCAAATACGGG - Intergenic
959091172 3:101904700-101904722 TAACCCCCCCACCCCCAGACAGG + Intergenic
959117927 3:102199165-102199187 TACTCCCACCAGTCACTGGCTGG - Intronic
961447572 3:126988066-126988088 TGTCCCCACCAGCCTCAGGCAGG + Intergenic
963296099 3:143548286-143548308 CACCCCCACCACCCCCAGACAGG - Intronic
968910767 4:3476032-3476054 TGCCCCCACCTGCCCCAGCCTGG + Intronic
969053899 4:4390001-4390023 TATCCCCACCTGCCACTAACAGG - Intronic
969553553 4:7889859-7889881 TCCTCCCACCAGACATAGACTGG - Intronic
969676389 4:8616615-8616637 TACCCTCACCAGCCCCTCACCGG - Intronic
969695140 4:8729957-8729979 TACACCCCCCAGCCAGACACAGG + Intergenic
970245081 4:14052779-14052801 TAGCCCCCCCAGCCCCCGACAGG - Intergenic
970791181 4:19859907-19859929 TACCCCCGCCACCCACCGACAGG + Intergenic
971953373 4:33383183-33383205 TACCTCCTTCAGCCACATACAGG + Intergenic
973886432 4:55326538-55326560 TTCCCTCACCACACACAGACTGG + Intergenic
984339494 4:178437592-178437614 AATCCCCAGCAGTCACAGACAGG - Intergenic
984501005 4:180558566-180558588 TACTCCCCTCAGCCACAGCCAGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
985635358 5:1033185-1033207 TATCCCGGCCAGCCACAGCCGGG - Intronic
986779936 5:11055848-11055870 TACTGCCACAAGCCACAGGCAGG + Intronic
987090414 5:14504561-14504583 GACCCCCACCAGCTACATCCTGG + Exonic
988311971 5:29571152-29571174 TAGCCCCCCCACCCACCGACAGG + Intergenic
991206064 5:64051428-64051450 TGCCCACTCCAGCCACAGGCTGG + Intergenic
992663790 5:78985772-78985794 TCCTCCCACCTGCCACAGGCTGG - Exonic
992857286 5:80875496-80875518 TACCCCTGCCAGCCCCAGAGGGG - Intronic
994653558 5:102560752-102560774 TTCCCCCACCACCCACAGATAGG - Intergenic
999130752 5:149281439-149281461 TACCACCACCCTCCTCAGACTGG + Intronic
1002702414 5:181134028-181134050 CACACGCATCAGCCACAGACTGG + Intergenic
1002721489 5:181263981-181264003 CACCCCCATCAGCTTCAGACTGG + Intergenic
1004413124 6:15400207-15400229 TGCCCCCACCAACAACAGAGGGG - Intronic
1005633295 6:27729381-27729403 TACCATCATCACCCACAGACCGG + Intergenic
1006374101 6:33662438-33662460 CAGCCCCACCTGCCTCAGACAGG - Intronic
1006691571 6:35892108-35892130 CATCCCCACCAGCCACACATGGG + Intronic
1006839219 6:37017702-37017724 TACCCCCTTCAGCCCCAGAAGGG + Intronic
1010099095 6:72081613-72081635 TACCCTCACCAGCCACTGCTTGG - Intronic
1010661212 6:78572617-78572639 CACCCCCACCCCCCACAGACAGG - Intergenic
1013645866 6:112140470-112140492 TACCCCCACCTGCCACAGGAAGG - Intronic
1014890401 6:126837319-126837341 TAGCCCCACCACCCACTGAGAGG + Intergenic
1015332608 6:131997995-131998017 TGCTCCCACCTACCACAGACTGG + Intergenic
1018049505 6:159996918-159996940 TTCCCCTAACAGCCACAGAATGG + Intronic
1019205822 6:170360809-170360831 TCTCCCCACCAGCCAAGGACTGG + Intronic
1019262239 7:88087-88109 CTCCCCCACCAGCGACAGGCGGG - Intergenic
1019341299 7:510323-510345 CACCCCCACCAGCCACACCAGGG + Intronic
1019750581 7:2726653-2726675 AGCCCCCACCAGCCACACATGGG + Intronic
1019887501 7:3918214-3918236 CAACCCCCCCAGCCACAGACTGG + Intronic
1023621515 7:42077992-42078014 TACACCCACAAGCCTCAGAATGG + Intronic
1023844040 7:44111274-44111296 CACTCCCGTCAGCCACAGACAGG - Intronic
1023888781 7:44378245-44378267 TGCTGCCACCAGCCACAGCCAGG + Intergenic
1023974422 7:45017345-45017367 GAAGACCACCAGCCACAGACTGG - Intronic
1032574366 7:133036476-133036498 TACCCCCAACACCCACACAGTGG - Intronic
1033389242 7:140910559-140910581 TACCCCCACAAACCAGAGGCTGG + Intronic
1034105007 7:148482769-148482791 TACCCCCACCATGCAGAAACTGG + Intergenic
1034203125 7:149294712-149294734 CACCCCCGCCAGCCACCGTCGGG + Intronic
1034397194 7:150836134-150836156 TGCCCACATCAGTCACAGACAGG + Intronic
1035269198 7:157710050-157710072 TGTCCCCACCACCCACAGAAGGG + Intronic
1036626829 8:10479357-10479379 TCCTCCCATCAGCCACAGAGAGG + Intergenic
1037808283 8:22070315-22070337 TACCCACAACAGCCAGAGACGGG - Exonic
1037820831 8:22133796-22133818 TACCCCCACAAGCTACCCACCGG + Intergenic
1038200177 8:25404828-25404850 CACTCCCACCAGCAACACACAGG + Intronic
1041854711 8:62438426-62438448 TGCCCCCAGGAGCCACAGAGAGG - Intronic
1042218293 8:66449187-66449209 GATCCCCCCCAGCCACAGCCAGG + Intronic
1044760233 8:95510180-95510202 TACACTCACCAGCAACAGAGGGG + Intergenic
1049564808 8:143332478-143332500 CACCCCCACCTGCCAGAGCCAGG + Intronic
1056904172 9:90631192-90631214 GAACCCCACCACCCACACACAGG - Intronic
1057390519 9:94638776-94638798 TACCCGCCCTAGCCTCAGACAGG - Intronic
1059630611 9:116117833-116117855 TAGCCCCCCCACCCCCAGACAGG + Intergenic
1060211832 9:121715249-121715271 AACCCTCAACAGCCACAGCCAGG + Intronic
1061549199 9:131323482-131323504 TACCGCACCCAGCCAGAGACAGG + Intergenic
1186505763 X:10090792-10090814 TACTCACACCAGCTACAAACTGG + Exonic
1187293812 X:17979873-17979895 TACCCTCCCAACCCACAGACAGG + Intergenic
1188154786 X:26727728-26727750 TACCCTCGCCATCCACACACAGG - Intergenic
1190790724 X:53697367-53697389 TCACCCCACCAGTCACAGAAAGG - Intergenic
1191762831 X:64663321-64663343 TACCCCCACCACTCATAGCCAGG + Intergenic
1192128432 X:68524670-68524692 TAGCCCCCCCAGCCTCTGACAGG + Intronic
1192223145 X:69211027-69211049 TCCCCCCAGCTGCCACAGGCTGG + Intergenic
1193902837 X:87203952-87203974 TATTTCCACCAGCCATAGACAGG - Intergenic
1195695478 X:107663801-107663823 TTCCCCCACCTGCCACTGAGTGG + Intergenic
1196043586 X:111232222-111232244 TATCCCCACAAGCAAGAGACTGG - Intergenic
1197413332 X:126145120-126145142 TGCCCCCACCACCCCCAAACAGG + Intergenic
1198333574 X:135644661-135644683 TTCCTCCAGCAGCCACAGCCTGG - Intergenic
1199656944 X:150005739-150005761 TACCCCCTAGAGCCACAGCCGGG - Intergenic
1202594448 Y:26521745-26521767 TACCCCCAGCAGTCACATCCAGG + Intergenic