ID: 1127899637

View in Genome Browser
Species Human (GRCh38)
Location 15:63331410-63331432
Sequence TTGTTTCTGAATAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 8, 3: 47, 4: 442}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127899637 Original CRISPR TTGTTTCTGAATAGGAAAGA AGG Intronic
901552864 1:10009038-10009060 TTATTTGTGAATGGGAAAAATGG - Intronic
901768776 1:11520015-11520037 TTCATTCTGCACAGGAAAGAGGG - Intronic
903025803 1:20429250-20429272 ATGTTTCTGAACAGGAAAGTGGG - Intergenic
903429510 1:23282817-23282839 TTGTTTCCTATTAGTAAAGATGG - Intergenic
903433670 1:23329474-23329496 TTGGTTCTGAAAAGGGAGGAGGG - Intronic
905766607 1:40606970-40606992 TTGTTTCTGAATTTATAAGATGG + Intergenic
906115958 1:43357530-43357552 TTTTTTCTGTAAAGGGAAGATGG + Intergenic
907711731 1:56889330-56889352 CTGTTTGTCAAAAGGAAAGAAGG - Intronic
907825734 1:58015216-58015238 TTGGCTCTGAAGAGGAAAGTTGG - Intronic
908978876 1:69929791-69929813 TTGATTCTGAGTAGGATAGGGGG - Intronic
909378496 1:74968611-74968633 CAGTTTATAAATAGGAAAGATGG - Intergenic
909456535 1:75856200-75856222 TTTTTTCTGAACAGAAAAAAAGG - Intronic
909593766 1:77381255-77381277 ATGTTTATGAACTGGAAAGAGGG + Intronic
909750298 1:79151306-79151328 TTATTTCTGAAGGGGAAAAAAGG - Intergenic
909873275 1:80771648-80771670 TTCTTTCTACAAAGGAAAGAAGG + Intergenic
910055162 1:83024835-83024857 GTGTTTCTGAAAAGGATATATGG + Intergenic
910432289 1:87170837-87170859 TTTTCTTTGAATAGAAAAGAAGG + Intergenic
910629490 1:89340831-89340853 TTGTTTCTCGTTAGGAAAGGAGG - Intergenic
911166332 1:94727841-94727863 TTGTTTCCGTATAGGAAAAGAGG + Intergenic
911413213 1:97537412-97537434 ATCTTTCTGAAGAGGAAAAAAGG - Intronic
913678884 1:121169618-121169640 TTTTTTCTGAATCAGAAAAATGG - Intronic
913708876 1:121459177-121459199 TTAATTCTTAATAGGAAAAAAGG - Intergenic
914030715 1:143957264-143957286 TTTTTTCTGAATCAGAAAAATGG - Intronic
914158733 1:145110698-145110720 TTTTTTCTGAATCAGAAAAATGG + Intronic
916032131 1:160886503-160886525 TTGTTTGTAAATATGAAAGCTGG - Intergenic
917851077 1:179064529-179064551 GGGTTTCTGTATATGAAAGAAGG + Intronic
917962632 1:180156549-180156571 TGGTTTCTGAAGAGGCGAGATGG + Intronic
918209893 1:182341181-182341203 TAGTTTTTGGATGGGAAAGAAGG - Intergenic
919059250 1:192609579-192609601 TTGTTTCAGAAAAGGAAACAAGG - Intergenic
919059755 1:192617207-192617229 TTGTAAATGAATGGGAAAGAAGG - Intergenic
919276844 1:195429257-195429279 TTTTTTCTCATTAGGAATGATGG + Intergenic
919421812 1:197379081-197379103 TTGTTTGTGGATAGGAAAGATGG + Intronic
919912254 1:202118809-202118831 ATGCTTCTGAATAGGGGAGATGG + Intergenic
920466182 1:206188156-206188178 TTTTTTCTGAATCAGAAAAATGG - Intronic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
922916040 1:229258669-229258691 ATGTGTCTGAACAGGAAGGAAGG - Intergenic
923745456 1:236695653-236695675 TTGTTTTTGTATAGAAAACATGG + Intronic
923778550 1:237001195-237001217 TTTTTTCTGGATAGGACAAAGGG + Intergenic
924221871 1:241885516-241885538 TTGTTTCAGAATAAGAAACAAGG - Intronic
924905596 1:248448746-248448768 TTGTTCCTGAATGAGAAAAAGGG - Intergenic
924922294 1:248643290-248643312 TTGTTCCTGAATGAGAAAAAGGG + Intergenic
1063129539 10:3166141-3166163 TAGTTTCTGAGAAGGAATGAGGG - Intronic
1063908871 10:10809474-10809496 TTGTTCCAGAATGAGAAAGATGG - Intergenic
1065689012 10:28314426-28314448 TAGTTTCTGAATAGGATTAATGG + Intronic
1067017289 10:42767781-42767803 TTTTTTCTTAATAGTAGAGATGG - Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1068303589 10:55176491-55176513 TTGTCTCTGGTTAGGAAAAAAGG - Intronic
1069285694 10:66712512-66712534 TTTTTTCTGAATATAAAATATGG + Intronic
1069533007 10:69232750-69232772 TTGTTTCTTAATAGAAAATGGGG + Exonic
1069652290 10:70058483-70058505 TTGTTTCTGGATATGAAAGGCGG + Intronic
1070676635 10:78416220-78416242 TAGTTTCTGAAGAAGGAAGATGG - Intergenic
1070855675 10:79606538-79606560 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1070985915 10:80689755-80689777 ATGTTTATGAATGGGCAAGAAGG + Intergenic
1071200853 10:83219774-83219796 TTGTTTCTGGCTAGGAAATGAGG + Intergenic
1072085682 10:92077126-92077148 TTTTTTCTGAAAAAGAAAAAGGG + Intronic
1072498504 10:95987775-95987797 TTATTACTGAAGAGGAAAGTGGG + Intronic
1073260600 10:102187298-102187320 TTGCTGCTGAATGGGAAAGTGGG + Intergenic
1073657443 10:105431986-105432008 TTGCTTCTTAATAAGAAACATGG + Intergenic
1074605626 10:114961929-114961951 TTATTTCAGGATAGTAAAGAAGG - Intronic
1074821129 10:117179447-117179469 TTGCGTCTGAAAAGGAAACATGG - Intergenic
1075219328 10:120570940-120570962 CTGTCTGTGAGTAGGAAAGATGG - Intronic
1075506048 10:123023775-123023797 TTGCTGCTGAATGGGAAAGTGGG - Intronic
1075780600 10:125014869-125014891 TTATTGCTGAAAAGGACAGAAGG - Intronic
1076035136 10:127193956-127193978 CTGTTTCTTAATAGGATAAAGGG + Intronic
1076256343 10:129028332-129028354 TTGTTTCTCAATAGGTCAGTAGG + Intergenic
1078884489 11:15486446-15486468 TATTTTCTGAGAAGGAAAGAAGG - Intergenic
1078939917 11:15991050-15991072 TTTTTTCTAAACAGGAAGGAGGG + Intronic
1079052277 11:17172613-17172635 TTGTTGCTAAATAGTAAAAATGG - Intronic
1080456637 11:32425477-32425499 TTGTTTAGGAGTAGGAAAGAGGG + Intronic
1080626543 11:34035522-34035544 ATGATTCTGAATAGTCAAGATGG - Intergenic
1082045146 11:47719718-47719740 TTGTTTCTGATTTTGAAAAAAGG + Intronic
1082749203 11:56999431-56999453 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1084657107 11:70526006-70526028 TTGTGTCTGAATTGAAAAGGTGG - Intronic
1086002631 11:82000464-82000486 CTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1086151500 11:83615693-83615715 TTGATTCTGAAGATGGAAGAAGG + Intronic
1086570409 11:88277443-88277465 TTGTTTCATAAAAGAAAAGAGGG - Intergenic
1086862236 11:91938658-91938680 TAGCTTCTGAAGAGGAAGGAAGG + Intergenic
1087433096 11:98078366-98078388 TTGTTTCTTGATAGAAAATAGGG + Intergenic
1088406784 11:109490143-109490165 TTGTTTGTGGAAAGGAAGGATGG + Intergenic
1088863978 11:113828704-113828726 TTTTTTCTGGGTTGGAAAGACGG - Intronic
1088901409 11:114120497-114120519 TCTTTCCTGAAGAGGAAAGAAGG + Intronic
1088990811 11:114951774-114951796 TTGTTTCTCTTTAGGAAAGAAGG - Intergenic
1089921659 11:122214851-122214873 TTGTTTGTTAAAAGGAAAAATGG - Intergenic
1090091463 11:123702038-123702060 TGGTGTCTGAAGTGGAAAGAAGG + Intergenic
1090135065 11:124189205-124189227 TTGTTTCTTATTAAGAAAGGAGG - Intergenic
1090188818 11:124754796-124754818 TTTTTTTTTAATGGGAAAGAGGG - Intronic
1090453173 11:126824285-126824307 CTGTTTCTGAATAGGATTCAAGG - Intronic
1090465162 11:126926761-126926783 TGGCTTCTGAATACTAAAGAGGG + Intronic
1090600952 11:128370661-128370683 CTGTTTCTGAATGACAAAGAGGG - Intergenic
1092274773 12:7051337-7051359 TTGTTTTTGTATAGGAATGCTGG + Intronic
1092808186 12:12246942-12246964 TTGTTTTTGACTAAGAAAGTTGG - Intronic
1094230255 12:28094203-28094225 TTGTCTCTAAGAAGGAAAGAAGG - Intergenic
1094307982 12:29042366-29042388 TTGTTTCTGAATTAAAGAGATGG - Intergenic
1094436305 12:30424338-30424360 TTGCTGTTGAATAGGAAAGTAGG + Intergenic
1094628077 12:32144877-32144899 TTGTATTTGAATAGAAAAGAGGG - Intronic
1095350677 12:41207798-41207820 TTATGTCTGAAGAGGAAATATGG + Intronic
1095406073 12:41868847-41868869 TTATTTCCTTATAGGAAAGAAGG + Intergenic
1095663282 12:44763202-44763224 TTATTTCTTAGTTGGAAAGAAGG - Intronic
1096417466 12:51425992-51426014 TGGTTTCTGCCTTGGAAAGAGGG + Intronic
1097274649 12:57804382-57804404 TTGTTTCTGATTATGAATAAAGG + Intronic
1097355617 12:58597672-58597694 TGGTTTGTGTATAGGAAACAAGG + Intronic
1098435379 12:70463353-70463375 TTGCTTTTGAATGGGAAAGTGGG - Intergenic
1099832649 12:87865043-87865065 TTGTTTCTGAGGAAGAAAGGAGG - Intergenic
1101136314 12:101747378-101747400 TTGTTTTGGAAGAGGAATGATGG - Intronic
1101574691 12:105986641-105986663 TTTTTTTTAAATAGAAAAGAGGG - Intergenic
1101924784 12:108962449-108962471 TTTTTTCTGGATAGTTAAGAAGG + Intronic
1102061671 12:109937176-109937198 TTATTTCCCACTAGGAAAGAAGG - Intronic
1103210238 12:119160353-119160375 TTGTTTTTGGATAGAAAAAAAGG - Exonic
1103454859 12:121057278-121057300 TTGTTTCTGTATTGGGAAGAAGG - Intergenic
1103748077 12:123139939-123139961 TTGGTTCTAAATTTGAAAGAGGG - Intronic
1104204506 12:126625260-126625282 TTATTGCTTAATAGGAGAGAAGG + Intergenic
1104241955 12:126998848-126998870 TTGTGTCTGAATAGTAACGAAGG - Intergenic
1104500486 12:129281096-129281118 TATTTTCTGATTAGCAAAGAAGG - Intronic
1105249331 13:18683266-18683288 TTGTTCCTGAATTTGAAACATGG + Intergenic
1105391914 13:19987589-19987611 GTGTGTGTGTATAGGAAAGATGG + Intronic
1105391918 13:19987649-19987671 GTGTGTGTGTATAGGAAAGATGG + Intronic
1106455196 13:29920867-29920889 TTGTTTTTTAATGTGAAAGAGGG - Intergenic
1108051913 13:46453363-46453385 TTATTTCTGAGTATTAAAGAGGG + Intergenic
1108561162 13:51645665-51645687 TTGTGTCTGTAAAGTAAAGAAGG + Intronic
1108847636 13:54696114-54696136 TTGTTTCTGGTTAGGGAAGGAGG + Intergenic
1109539377 13:63752848-63752870 TTATTTCTGAGTATTAAAGAGGG - Intergenic
1109544467 13:63826986-63827008 TTATTTCTGAGTATTAAAGAGGG + Intergenic
1109668671 13:65574045-65574067 TTGTTTCTCCTTGGGAAAGATGG + Intergenic
1109948166 13:69465229-69465251 ATATTTTTTAATAGGAAAGAAGG - Intergenic
1110103123 13:71634432-71634454 TTGCTAGTGAAAAGGAAAGAAGG - Intronic
1110224738 13:73107813-73107835 TTGTTTATAAATAGTAATGAGGG - Intergenic
1110575028 13:77045859-77045881 ATTTTTCTGAATAGAAAACAGGG + Intronic
1111275442 13:85939707-85939729 TTGTCTCTGGTTAGGAAAGGAGG - Intergenic
1111458201 13:88510388-88510410 TTGTCTGTGAATAAAAAAGAGGG + Intergenic
1112956226 13:105061421-105061443 TTATTTCTGCATGGGAAAAATGG + Intergenic
1114559447 14:23579523-23579545 TTGCTTCTGAATGGGGAGGAGGG + Intergenic
1115503325 14:34068520-34068542 TTGTTTATGAATAAGAAAGTGGG - Intronic
1115724741 14:36200840-36200862 CTGTTTCTGATTAATAAAGAAGG + Intergenic
1115892016 14:38041179-38041201 TTTTTTCTGAATGTTAAAGATGG + Intronic
1116791336 14:49343390-49343412 TAGTTACTGACTAGGAAGGAAGG - Intergenic
1117270272 14:54136419-54136441 GTGTTTATGAAGAGGAGAGAAGG + Intergenic
1117715065 14:58572024-58572046 TTGTACCTGATTTGGAAAGACGG - Intergenic
1117946935 14:61037166-61037188 TTGTTTAGAAAAAGGAAAGAAGG + Intronic
1118858744 14:69645267-69645289 TAGTTTCTGACTAGAAAGGAGGG + Intronic
1119122721 14:72094422-72094444 TTGTCTCTGAAAAGAAAAGTGGG - Intronic
1120155307 14:81086722-81086744 TTATTTCTGAATAGCCCAGATGG - Intronic
1121521202 14:94587329-94587351 TTTGTTCTGAAAGGGAAAGAAGG - Exonic
1121757037 14:96411842-96411864 TTCTTTCTGATTAAGAAAGCTGG - Intronic
1121787175 14:96670797-96670819 TTTTCCCTGAATAGGAAGGAAGG + Intergenic
1121882335 14:97512056-97512078 ATGTTTCTGAATAGTGATGAGGG - Intergenic
1123777719 15:23597229-23597251 TTGCTGTTGAATAGGAAAGCAGG - Intronic
1123894273 15:24812934-24812956 ATGTGTATGAACAGGAAAGATGG - Intergenic
1123949315 15:25255142-25255164 TTGTTGCTCCATAGGTAAGATGG - Intergenic
1124204599 15:27706370-27706392 TTGATTGTGAATAGAAAATAAGG - Intergenic
1124208088 15:27740359-27740381 TTGTGTCTGAATTGGGAGGACGG - Intergenic
1125119693 15:36139834-36139856 TTGTTTGTGTATAGGAATGCTGG + Intergenic
1125195328 15:37039558-37039580 TTCTTTCTTAAAAGCAAAGAGGG + Intronic
1125732005 15:41897844-41897866 GTGTTTATGTATAGGAGAGAGGG - Exonic
1125741464 15:41967739-41967761 TGGATTCTGAATAGGAACAAAGG - Intronic
1126867591 15:52953052-52953074 TGGATTCTGAATAGGAAATGGGG + Intergenic
1127899637 15:63331410-63331432 TTGTTTCTGAATAGGAAAGAAGG + Intronic
1128855906 15:71014914-71014936 TTTTTTCTGAATTGGGAATAAGG - Intronic
1129164962 15:73771694-73771716 TTGTTTCTGAGGAGGAAACAAGG - Intergenic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129905285 15:79182948-79182970 TTGTCTCTGAAAAAGAAGGAAGG - Intergenic
1130312979 15:82771106-82771128 GTGTTTCTGCCCAGGAAAGAAGG - Intronic
1130367473 15:83253447-83253469 TTGATAATGAATGGGAAAGAAGG + Intergenic
1130753320 15:86736614-86736636 TTGTTTCACAATATGAAAAAGGG - Intronic
1131198221 15:90374114-90374136 TTGTTTCTGTATTGTAAGGAAGG + Intergenic
1131951052 15:97682554-97682576 TAGTTTCTGAATAAGAAGCATGG + Intergenic
1132037850 15:98501551-98501573 TTATTTTGGAATTGGAAAGATGG - Intronic
1133537521 16:6716275-6716297 TTGTTTATGAAAAGCAACGATGG - Intronic
1133675092 16:8063655-8063677 TTGTTTCCATATGGGAAAGAAGG - Intergenic
1134750587 16:16621772-16621794 TTGTTGTTGAATGGGAAAGTGGG + Intergenic
1134994867 16:18731814-18731836 TTGTTGTTGAATGGGAAAGTGGG - Intergenic
1135054328 16:19218483-19218505 TTGTATCTGCAAAGGGAAGAAGG + Intronic
1135192784 16:20368368-20368390 GGGTTTCTGAAGATGAAAGAAGG + Intronic
1138437467 16:57011808-57011830 TTTTTTCTGTATAGTAAAAATGG - Intronic
1138773100 16:59688074-59688096 TTGCTTTTGGATAAGAAAGAAGG + Intergenic
1139133666 16:64176668-64176690 TTGTTCCTGAGAAGGGAAGAGGG - Intergenic
1140071341 16:71653013-71653035 TTCTTTCTGAACAGGAAATTAGG - Exonic
1140958680 16:79891761-79891783 TTCTCTCTAAATAGGAGAGATGG + Intergenic
1141353836 16:83324409-83324431 TTGTTTAGAGATAGGAAAGAGGG - Intronic
1143475659 17:7202416-7202438 TTGTTTCAGAAAACTAAAGATGG - Intronic
1144042425 17:11424630-11424652 TTATTGCTGGATAGGATAGAAGG + Intronic
1144301498 17:13925878-13925900 TTGTTTCTGGTTAGGAAAGGAGG - Intergenic
1144615790 17:16770474-16770496 TCTTTTCTGAATATGAAGGAAGG + Intronic
1144658981 17:17056222-17056244 CTGTTTCTGAATGGGAAGGACGG + Intronic
1144858085 17:18281770-18281792 TTGCTGCTGAATAAGAAAGGAGG - Intronic
1144896912 17:18545198-18545220 TCTTTTCTGAATATGAAGGAAGG - Intergenic
1145135300 17:20399016-20399038 TCTTTTCTGAATATGAAGGAAGG + Intergenic
1146002248 17:29138409-29138431 GTGCCTCTGAATGGGAAAGAGGG - Intronic
1148514951 17:48208129-48208151 TGTTTTCAGAATAGGAAGGAAGG + Intronic
1149625801 17:58079932-58079954 TTTATTCTGAGCAGGAAAGAGGG + Intergenic
1151689282 17:75671390-75671412 GTGTATATGAAAAGGAAAGAAGG + Intronic
1153190516 18:2532740-2532762 ATGGTTCTGAATTGGACAGAGGG + Intergenic
1153379003 18:4413922-4413944 TTATTTCTGAATTGTTAAGAAGG - Intronic
1154156544 18:11948231-11948253 TTTTTTCTTAATAGGAAATCTGG + Intergenic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156249205 18:35335109-35335131 TTGTATCAGAGTAGGTAAGAAGG - Exonic
1156279425 18:35620507-35620529 TTGTTTCTGAGGAGGGAGGAAGG - Intronic
1156325474 18:36070855-36070877 TTGTCTCTAAATTGGAAAGCAGG + Intergenic
1156552841 18:38036295-38036317 TTGTTTCTAAAAAGGAAAACAGG - Intergenic
1156564857 18:38176306-38176328 TTCCTTTTGAATTGGAAAGATGG - Intergenic
1156711427 18:39951159-39951181 TTGTTTTAGAAAAAGAAAGAGGG + Intergenic
1156841790 18:41617637-41617659 TTGTTTCTGAATAGAGTATAAGG + Intergenic
1159403160 18:67963545-67963567 TTGTTTTTAAAGAGGAAAGTAGG - Intergenic
1159968800 18:74623592-74623614 TTCTTTCTGCATATCAAAGAAGG - Intronic
1160279872 18:77478941-77478963 ATGGTTCTGAATAGTCAAGATGG + Intergenic
1162921453 19:13905739-13905761 TCGTTTCTGATAAGGACAGAGGG - Intronic
1164039199 19:21479928-21479950 TTGTTTGTGTATAGGAATGCTGG + Intronic
1164276689 19:23724835-23724857 TTGTTGCTGGTTAGGAAAAAAGG + Intergenic
1164551816 19:29218434-29218456 TTGGTTGTGAAGATGAAAGAAGG + Intergenic
1165947306 19:39451956-39451978 TTGTTTCTGGTATGGAAAGAGGG + Intronic
925819144 2:7782492-7782514 TGGTTTCTGATCAGAAAAGAAGG - Intergenic
926466382 2:13194172-13194194 TTGATTCAAAATAGGAGAGATGG + Intergenic
926521036 2:13913780-13913802 TTGTTTCTGAATAATGAAAATGG - Intergenic
927318702 2:21717569-21717591 TTGTTTCCAAAGAAGAAAGATGG - Intergenic
927353323 2:22144631-22144653 TTGTTTCTGGGTAGGAAGTATGG + Intergenic
929365109 2:41144923-41144945 TTATTTCTGCAGAAGAAAGAAGG - Intergenic
929368756 2:41195161-41195183 TTGTTCCTGAAAAATAAAGAGGG - Intergenic
931086175 2:58832947-58832969 TTGTCTTTGAATGTGAAAGATGG - Intergenic
932071777 2:68627862-68627884 TTGTTTTTGCAGATGAAAGATGG - Intronic
933073799 2:77896676-77896698 ATGTTTTTAAATAGGAAAGCAGG - Intergenic
933463486 2:82619993-82620015 TTGTTACTGAATGGGAAAGTGGG + Intergenic
934739285 2:96707522-96707544 TTGTTTCTCAGTTGGAAAGAGGG - Intronic
934896327 2:98123187-98123209 TTTGCTCTGAATAGAAAAGATGG + Intronic
935327455 2:101949609-101949631 TTGTTTTTGAATATGGAATAAGG - Intergenic
935352633 2:102166749-102166771 TTGTTACAGAAGAGGAAACAGGG - Intronic
935514579 2:104020688-104020710 TTTTTTCACAATAGGAAAAAAGG - Intergenic
936231735 2:110707849-110707871 TTGTTTCTTATTATGAAAGCAGG + Intergenic
936768704 2:115885653-115885675 TTTTGACTGAAAAGGAAAGAAGG - Intergenic
937691329 2:124758671-124758693 TTGGCTCTGAAGAGAAAAGAAGG + Intronic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
937969827 2:127540912-127540934 TTATCTCTGTATAGGAAAGGGGG + Intronic
938939780 2:136159748-136159770 TTGGCTCTGGATAGGAAAAATGG + Intergenic
939047854 2:137270488-137270510 TTGTTTCTGAGAAGGAATTAGGG - Intronic
939247513 2:139645010-139645032 CTGTCTCTGCACAGGAAAGATGG + Intergenic
939674513 2:145055362-145055384 TTGTTTGTGAATAATAGAGACGG + Intergenic
939854315 2:147339622-147339644 TTGTTTGTGAATTGGGAAGCTGG - Intergenic
940811540 2:158248228-158248250 TTGTCTCTGGGGAGGAAAGAAGG + Intronic
941331671 2:164185319-164185341 TTTTTTTTGTATTGGAAAGATGG - Intergenic
941710011 2:168702045-168702067 GTGTGTCTGAATAAGAAAAATGG - Intronic
942081923 2:172408352-172408374 TTGTAGCTGAATAGGACACAGGG - Intergenic
942167017 2:173251649-173251671 TTGTTTGGGAATAGGCACGAGGG + Intronic
942474044 2:176296618-176296640 TTGTTTTTTAATGGGGAAGAGGG - Intronic
943189218 2:184654358-184654380 TTGGTTCTGAGTTGGAAATAAGG + Intronic
943383156 2:187174658-187174680 CTGTTTCTGGTTAGGAAAAAAGG + Intergenic
944269992 2:197771613-197771635 TTACTTTTGAACAGGAAAGAGGG + Intronic
945372563 2:209037467-209037489 TTTCTTCTGAAGAGGAAAGAGGG + Intergenic
945644516 2:212473927-212473949 TTAATCCTGAATAGGAAAAAAGG + Intronic
946124890 2:217553833-217553855 TTGTTTCTTGAGAAGAAAGAAGG + Intronic
946125092 2:217555708-217555730 TGTTTTATGAAAAGGAAAGATGG + Intronic
946375309 2:219304718-219304740 ATGTTCCTGAATAGGTGAGAGGG - Intronic
947453006 2:230225577-230225599 TTGTTCCTGCCAAGGAAAGAGGG - Intronic
947490413 2:230589936-230589958 GTGTTTATGCAAAGGAAAGAGGG + Intergenic
948194670 2:236086471-236086493 TAGTTTCTGAATAGAAAAAGAGG - Intronic
948333848 2:237192835-237192857 TTATATTTTAATAGGAAAGATGG + Intergenic
948585957 2:239019684-239019706 TTGTTTTTTAATAAGAAAAAAGG - Intergenic
1169519382 20:6354757-6354779 CTGTTTCTGAAGAGGAAAAGGGG + Intergenic
1170086119 20:12534195-12534217 TTGTTTGCAAATAGGAAACACGG - Intergenic
1170347179 20:15400260-15400282 TAGCTTCTGCATAGGAAACAAGG + Intronic
1171046526 20:21813289-21813311 TTGTTTCTGGATAGGAGTGTAGG - Intergenic
1171468856 20:25353824-25353846 TTGGTTCTGCAGAGGACAGAAGG - Intronic
1173261116 20:41437219-41437241 TTCTTTCTTAATATGAAAGACGG + Intronic
1173383930 20:42571278-42571300 ATTTTTCTAAATAGGAAAGAAGG + Intronic
1173504937 20:43579442-43579464 TTGATTTTGATTAGGAAAGGTGG + Intronic
1173517707 20:43676920-43676942 TTGTTTTTAAATAGAGAAGAGGG + Intronic
1174601935 20:51731922-51731944 GTGTTGCTGAAAAGGAAAGCTGG - Intronic
1174628764 20:51938161-51938183 TTGTCTCTGAAGAGGGAAGATGG - Intergenic
1174756819 20:53167124-53167146 TTCTTTCTGGAAAAGAAAGATGG + Intronic
1177124817 21:17182439-17182461 TTGTTTCTGGTTAGGAAAGGAGG - Intergenic
1178048572 21:28723528-28723550 TTATTTCTAAAGAGAAAAGATGG + Intergenic
1179286254 21:39979633-39979655 TTGTTTCCCACTAGGAAAGGTGG - Intergenic
1179426916 21:41288001-41288023 TTGTTTGTGAATACGAAAACTGG + Intergenic
1181485816 22:23231134-23231156 TTTTTTCCTAATGGGAAAGAAGG + Intronic
1181933342 22:26420877-26420899 TTATTTCTGAGGAGGAAGGAAGG - Intergenic
1182597254 22:31431339-31431361 TTTTTTCTGAATAGGAAAAAGGG + Intronic
1182768160 22:32773834-32773856 TTCTATCTGAAGAGGAAGGAGGG + Intronic
1182864973 22:33596437-33596459 TGGTTTCTGAATACGAAGGCTGG - Intronic
1183225971 22:36550127-36550149 TTAATTCAGAATAGGGAAGACGG + Intergenic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1184995727 22:48206022-48206044 TTGTCTCTGGATTGGGAAGAGGG + Intergenic
1185164011 22:49247212-49247234 TTGCTGGGGAATAGGAAAGATGG + Intergenic
949771635 3:7585796-7585818 TTCTTTCTGAAAATGAGAGATGG - Intronic
950317039 3:12011608-12011630 ATGCTGCTGAAAAGGAAAGAAGG - Intronic
951148549 3:19259028-19259050 TTATTTCTAAATAGTAAAAAAGG + Intronic
952326992 3:32329443-32329465 TTATTTCTGAAATGCAAAGATGG + Intronic
952384562 3:32830733-32830755 TTGTTTCTGCAAAGGAATGAAGG - Intronic
953621977 3:44541414-44541436 TTGTTTAGGATTAGAAAAGACGG - Intergenic
955510897 3:59679393-59679415 GTGTTTCCAGATAGGAAAGAAGG + Intergenic
955896912 3:63710133-63710155 ATATTTCTGAAGAGGATAGATGG + Intergenic
957691680 3:83579130-83579152 TTGTTTCTGAACAGGAAAAATGG - Intergenic
957701866 3:83725763-83725785 TTGTTTCTTTCTAGAAAAGAGGG + Intergenic
957973135 3:87408306-87408328 TTGTTTGTGTATAGAAAAGCTGG - Intergenic
958047131 3:88299021-88299043 TTGTTTCTGCATTGAAGAGAAGG + Intergenic
958116392 3:89224483-89224505 TTATTTCTGAAGAAGGAAGATGG + Intronic
958422089 3:93940849-93940871 TGGTTTTTGAATAGGTAAAATGG - Intronic
958832734 3:99109462-99109484 TTGTTCCAGAATTGGAAACAGGG + Intergenic
959460071 3:106614540-106614562 TTCTATTTGAATAGGAATGAGGG - Intergenic
959946048 3:112126318-112126340 GTGTTTCTGAAGAAGAAAAATGG - Intronic
961223471 3:125218501-125218523 TTGTTACTGAATAGAAGAAAAGG + Intergenic
962306154 3:134288211-134288233 TGTTTTCTGGATAGAAAAGATGG - Intergenic
962448420 3:135490640-135490662 TAATTACTGAATAGGAAATAGGG - Intergenic
962672081 3:137718628-137718650 TTGTTGGTGTATAGGAATGATGG + Intergenic
962735907 3:138325088-138325110 TTTTTTCTGGGTAGGGAAGAAGG - Intronic
963002789 3:140698161-140698183 TAATTTCTGAAAAAGAAAGAAGG - Intronic
963416740 3:145005170-145005192 TTATTTCAGAATAGCAAGGATGG + Intergenic
963489458 3:145981336-145981358 TTATTGCTGAATAAGAAACAAGG + Intergenic
963761669 3:149291479-149291501 TTGTTTCTGGTTAGGAAAGGAGG - Intergenic
963979809 3:151524906-151524928 TTGATACTAAAAAGGAAAGAAGG - Intergenic
965148238 3:164934889-164934911 TTGTTTATTAAAAGGAAAGCAGG - Intergenic
965152262 3:164993082-164993104 TTAATGCTGAATTGGAAAGATGG + Intronic
965197733 3:165622482-165622504 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
965826796 3:172739083-172739105 TTGTTTCTTACTAGGTATGATGG - Intergenic
965835131 3:172842822-172842844 TTGTTTTTGAATAAGAAAACTGG - Intergenic
967364136 3:188666605-188666627 TTATTTTTCAACAGGAAAGAAGG + Intronic
967672668 3:192257319-192257341 TTGTTATTGAATAGGAAATTGGG - Intronic
970633741 4:17983571-17983593 TTGTTGGTGTATAGGAATGAGGG + Intronic
970737065 4:19184447-19184469 ATGTTTGTTTATAGGAAAGATGG - Intergenic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
971198406 4:24491082-24491104 ATGAGACTGAATAGGAAAGAGGG + Intergenic
971216201 4:24664310-24664332 TTGTTGCTGTATAGGAATGCTGG + Intergenic
972416154 4:38842486-38842508 ATGTTTGTGACTGGGAAAGAGGG + Intronic
972898187 4:43649846-43649868 TTGTTTCTGCTTTGGGAAGATGG - Intergenic
973041959 4:45479003-45479025 TTGTTTCAGAACATGAAAGAAGG - Intergenic
973794026 4:54405684-54405706 TTGTTTAGGAATAGGAGAGCTGG - Intergenic
974245885 4:59316969-59316991 TTGTTTCGGCATAAGAAAAATGG - Intergenic
974676028 4:65090374-65090396 TGGTCTCTGAATAGGAAAGATGG + Intergenic
974696666 4:65384452-65384474 TTGATCCTGAATTGGAAATAGGG - Intronic
975291838 4:72686327-72686349 TCATTGCTGAATGGGAAAGATGG - Intergenic
977922190 4:102658033-102658055 TGGTTGTTGAATAGGGAAGAAGG - Intronic
978090169 4:104706347-104706369 TTCTTTCTGGAAAAGAAAGATGG + Intergenic
978486126 4:109255476-109255498 GTGTCTCTGAATGGGAAAGAGGG + Intronic
978826115 4:113026085-113026107 TTGTTTCCTTATAGTAAAGAGGG - Intronic
979102002 4:116629753-116629775 TTGTCTCTGAAAAGGAGAGAAGG - Intergenic
979938002 4:126721953-126721975 TTTCTTGTGAATAGGAAAAATGG - Intergenic
980349319 4:131666455-131666477 TGGTTTTTGAATAGGTAAAATGG - Intergenic
980496039 4:133588171-133588193 TTGTTTCTGGTTAGGAAAGGAGG - Intergenic
980563785 4:134511031-134511053 TTGGTTCTAAATTGGAAAAATGG - Intergenic
981563425 4:146072405-146072427 TTCTTGCTGAAAAGAAAAGAGGG - Intergenic
981813624 4:148803760-148803782 TTGTTTGTTAGTAGGAAAGGGGG + Intergenic
981990098 4:150908142-150908164 TTGTTTATCAGTAGGAAATATGG - Intronic
982878331 4:160675973-160675995 TGGTTTCTGAATAAGAAATCAGG + Intergenic
983455978 4:167965331-167965353 TTGTTTCTGAGTATGTAAAATGG + Intergenic
983460281 4:168018107-168018129 TTGTTTCAGAGTAAGTAAGAGGG - Intergenic
983693224 4:170497913-170497935 CTGTTTCTAGATAGGAAATAGGG + Intergenic
983738747 4:171100268-171100290 TTGTATTTCTATAGGAAAGAAGG - Intergenic
984342116 4:178470574-178470596 TTATTTCTGAATAGGAAATGAGG - Intergenic
986017755 5:3772677-3772699 ATGTTGCAGGATAGGAAAGATGG - Intergenic
986222800 5:5784866-5784888 TTACTTCTCAATAGGAAAGGAGG + Intergenic
986351624 5:6885497-6885519 TTTTTCCTGAATAGGAAAAGGGG + Intergenic
986765773 5:10924649-10924671 TGGATGCTAAATAGGAAAGATGG - Intergenic
987852206 5:23370668-23370690 TTCTTTCTGCATTAGAAAGAAGG + Intergenic
988408281 5:30852697-30852719 TTGTCTCTGAGAAGGAAAGGAGG - Intergenic
988644264 5:33077089-33077111 TTGTTGCTAAATAGGAAGCAAGG - Intergenic
988713948 5:33805881-33805903 TTGTCTCTGAAAAGAAAAGGGGG + Intronic
989295553 5:39821623-39821645 CTGTTTGTGACTAGGGAAGATGG + Intergenic
990128562 5:52550069-52550091 TTGTTTCAAAATATCAAAGATGG + Intergenic
990193897 5:53291052-53291074 TTGTTTGTAAAAAGAAAAGAAGG + Intergenic
990331958 5:54736482-54736504 TAGTTTCTGAACAAGAAGGAAGG - Intergenic
990650021 5:57887802-57887824 TGGTTTCTGAGCAGGCAAGAAGG + Intergenic
993365891 5:87033818-87033840 TTGTTTCAGGAGAGTAAAGATGG + Intergenic
993905950 5:93622755-93622777 TTGTTACTCAATAGGAAGGAGGG + Intronic
994189631 5:96855270-96855292 GTGTTTTTTAATAGGAAATAAGG - Intronic
994348437 5:98716282-98716304 TTGTTAGTGTATAGGAATGATGG + Intergenic
995106996 5:108386136-108386158 TTAATTCTGAATTGGATAGAGGG + Intergenic
996842736 5:127865588-127865610 TTGTTTCAGTATTGGAAACATGG + Intergenic
999024015 5:148205084-148205106 TTGTTTTTTAATTTGAAAGAAGG - Intronic
999852983 5:155562953-155562975 TTGTTTATGAATAGTAATAATGG - Intergenic
999915163 5:156250642-156250664 TTGTTACAGAATCGGAAAGTTGG - Intronic
1000131628 5:158305692-158305714 TTGTCTCTGAAGAGGAGAGCTGG - Intergenic
1001355115 5:171013320-171013342 TGGTTTCTCAATAGGAAAGTCGG - Intronic
1001451997 5:171833773-171833795 ATGTTACTGATTAAGAAAGATGG - Intergenic
1003026630 6:2560702-2560724 ATTTTTCTGAATAGGAAATCGGG - Intergenic
1004232899 6:13849148-13849170 TTAGTACTGAATTGGAAAGAAGG + Intergenic
1004871802 6:19912731-19912753 GTGTTACTGAACAGGAGAGATGG + Intergenic
1005335754 6:24794402-24794424 TTCCTTCTGAATAGGACAGATGG - Intergenic
1008893640 6:56525872-56525894 TTTTTTCTGAAGATGACAGAAGG - Intronic
1009245142 6:61228099-61228121 TTATTTTTTAATAGGAAAAAAGG - Intergenic
1009508060 6:64511021-64511043 CTAATTCTGAATAGCAAAGATGG + Intronic
1010051786 6:71512970-71512992 TTCTTTCTGCATAGAAAATATGG + Intergenic
1010573960 6:77509976-77509998 TTGTTTCTGGTTAGGAAAAATGG + Intergenic
1011350183 6:86414431-86414453 TTCTGTCTGAATAGGAGACAGGG + Intergenic
1011621226 6:89244688-89244710 TTGTTTTAAAATAGAAAAGAAGG + Intergenic
1011911247 6:92442327-92442349 TTGTGTTTGAATATGAATGACGG + Intergenic
1013420103 6:109959705-109959727 TTGATGCTGAAGAGGCAAGAAGG - Intergenic
1013865763 6:114694501-114694523 TTGTTTAAGACAAGGAAAGAAGG + Intergenic
1014276844 6:119398057-119398079 TTGTTTCTGGCTAGGAAAGATGG + Intergenic
1015452989 6:133391939-133391961 TTGTCTCTAATTAGGAAAGGGGG - Intronic
1015506717 6:133995857-133995879 TTGTTCCAGAAATGGAAAGAAGG - Intronic
1015577492 6:134688708-134688730 TTGTTCCTGTAGAGGAGAGAGGG - Intergenic
1015769148 6:136751484-136751506 TTGTGTATGCATAGGACAGAAGG - Intronic
1016120443 6:140337043-140337065 TTGTCTCTGATTAGGGAAGTAGG + Intergenic
1016143350 6:140640934-140640956 TTATTTCCCAATAGGAAAGTAGG - Intergenic
1017125981 6:151065261-151065283 TTCCCTCTGGATAGGAAAGATGG - Intronic
1017430659 6:154367413-154367435 TTATTTCAAAATAGTAAAGAGGG + Intronic
1018138948 6:160807491-160807513 TTGTTACTTAATAGAGAAGAAGG + Intergenic
1019718439 7:2553947-2553969 TTCTTTCTGATTATGAAAGTAGG - Intronic
1020683287 7:11262919-11262941 TTGAATCTGAATTGGAATGAAGG - Intergenic
1020763206 7:12292173-12292195 TTATCTCTGATTAGGGAAGAAGG - Intergenic
1020985329 7:15126804-15126826 TTGGATCTGAAAAGGAAGGAAGG - Intergenic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021153594 7:17181779-17181801 TTGTTTAGGAACAGCAAAGAGGG - Intergenic
1021467560 7:20962715-20962737 TTGTTTCTGAAGAGCCAACATGG + Intergenic
1022539129 7:31120093-31120115 TTGTTTTGGAGAAGGAAAGAAGG - Intergenic
1023268694 7:38436131-38436153 ATATTTCCTAATAGGAAAGAGGG - Intronic
1024093957 7:45969780-45969802 CTGTTTCTAAATAGGACAGGTGG - Intergenic
1024402197 7:48937618-48937640 TTATTTCTAAAAAGGACAGATGG - Intergenic
1024458969 7:49639995-49640017 TGGTTTCTGACTAGTAAAAATGG - Intergenic
1026179642 7:68027676-68027698 TCAGTTCTGAATAGGCAAGAGGG + Intergenic
1028110126 7:86930362-86930384 ATGTTTCTTAATTGGGAAGATGG - Intronic
1028419420 7:90615580-90615602 TTTTTTTTGAGTGGGAAAGAAGG + Intronic
1028682857 7:93557725-93557747 TTGTTTCTGAGTATGATAGAAGG + Intronic
1029852433 7:103477179-103477201 TTGTTTCTGCATAGGAAATATGG + Intronic
1030664656 7:112262696-112262718 GAGTTTCTAAATAGGAAAAATGG - Intronic
1031019788 7:116614662-116614684 TGGTTACTGACTGGGAAAGAAGG - Intergenic
1031629322 7:124027781-124027803 TTGGTTCTGCTTAAGAAAGACGG - Intergenic
1031661409 7:124429626-124429648 TCCCTTCTGAATGGGAAAGAAGG + Intergenic
1033020000 7:137714989-137715011 TGTTTTCTGATTAGGAAGGAGGG - Intronic
1035707496 8:1688356-1688378 TTGTTTCTGTCTTGAAAAGAAGG - Intronic
1035994489 8:4530845-4530867 TTCTTTGTGAAAAGGAAATAAGG - Intronic
1036068698 8:5415259-5415281 TTGGTTCTGATTAGAGAAGAAGG + Intergenic
1037206529 8:16327474-16327496 ATGTTTCTGAAAAGAAAAAAGGG - Intronic
1037390886 8:18390368-18390390 TTGTTACTGGAGAGAAAAGAGGG + Intergenic
1037452181 8:19026274-19026296 TTTTCTCTGAATAGGAAGGATGG + Intronic
1037741211 8:21610633-21610655 CTGGTTCTGGATGGGAAAGAGGG - Intergenic
1037938142 8:22928774-22928796 TTGTTTGTGAAAAGGAAAAGTGG - Intronic
1041402649 8:57461500-57461522 ATGTGTCTAAATGGGAAAGAGGG + Intergenic
1041777912 8:61544451-61544473 TTGTTACTGCTTAAGAAAGAAGG - Intronic
1042424899 8:68636171-68636193 TTGGTTCTGAGTTGGAAATAGGG + Intronic
1042430216 8:68697991-68698013 TTGTTTCTAACTAGGAAGGATGG - Intronic
1042985017 8:74573876-74573898 CAGTTTTTGAATAGGAAGGATGG - Intergenic
1044311876 8:90702886-90702908 TAGTTTCTGAATACAAAATAGGG + Intronic
1044371903 8:91421687-91421709 TTGTTTCTGAGCAGCAATGAAGG - Intergenic
1045129741 8:99137601-99137623 TTGTTTTTGATGAAGAAAGAAGG + Intronic
1045643493 8:104278260-104278282 TTGCTGTTGAATAGGAAAGCAGG - Intergenic
1046632026 8:116630834-116630856 ATGTTTATGAAAAGGAAACATGG - Intergenic
1048129487 8:131678627-131678649 TTGTGTTTGAATTGGAAAGAAGG - Intergenic
1048148282 8:131867376-131867398 TTGTTTTTAACTAGGAAGGAAGG + Intergenic
1048386962 8:133921097-133921119 GTGTTTATGAATGGGAAAGGAGG + Intergenic
1048851566 8:138650232-138650254 TGGTTTCTGAACAAGGAAGAAGG + Intronic
1049535711 8:143180433-143180455 CTGGTTTTGAATTGGAAAGAGGG - Intergenic
1050579171 9:7032749-7032771 TTGTTTTTGGAGGGGAAAGAAGG + Intronic
1051583638 9:18704428-18704450 TTGTTTTCGAATCAGAAAGATGG - Intronic
1051674926 9:19549248-19549270 TTGTCTCTGAGAAGGTAAGAAGG - Intronic
1052575347 9:30283434-30283456 TTGTCTCTAATTAGGGAAGAAGG + Intergenic
1052649944 9:31290195-31290217 TTGTTTCTGAAAAATCAAGATGG - Intergenic
1052713394 9:32085449-32085471 CATTTTCTTAATAGGAAAGAAGG + Intergenic
1055886131 9:81065039-81065061 TAGTTTCCAAATTGGAAAGAAGG - Intergenic
1056537847 9:87546496-87546518 TTGGGTCTGCATAGGAAAGATGG + Intronic
1057066649 9:92059275-92059297 TCCTTTCTGAATAGCAAAGCAGG + Exonic
1057068276 9:92074703-92074725 TGGTTTTTGAATAGGTAGGATGG - Intronic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1057860455 9:98636767-98636789 TTGTTTTTGAAAAGCAAAAATGG + Intronic
1057925089 9:99139184-99139206 TTTTTTTTAAATAGGAAAGCTGG - Intronic
1057936134 9:99240402-99240424 TTGTACCTGAATAGGGAATAGGG - Intergenic
1059225709 9:112671047-112671069 TGGTGTCTAACTAGGAAAGATGG - Intergenic
1061266438 9:129507981-129508003 TTGATTCTGAAAGGCAAAGAGGG - Intergenic
1185484472 X:471908-471930 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1185767873 X:2740666-2740688 TTATTTCTGCATAAGAAAAATGG - Intronic
1185876580 X:3706818-3706840 TATTTTCTTAATGGGAAAGAGGG - Intronic
1186449359 X:9659154-9659176 TACTGTCTGAAGAGGAAAGAAGG + Intronic
1186529366 X:10279685-10279707 ATGTTTATGAAAAGGAAGGAGGG - Intergenic
1186711687 X:12204490-12204512 TTGGTTCTGAATTGGGAAGCTGG - Intronic
1187703203 X:21984031-21984053 TTGTTTCTGCATTGGTAAAATGG + Intronic
1188872517 X:35390428-35390450 CTGTTTAGGTATAGGAAAGAAGG + Intergenic
1189414448 X:40802267-40802289 TTGTTTCTGGTTAGGAAAGGAGG + Intergenic
1189724011 X:43950519-43950541 TAGTTTCTGAATAAGAAAATAGG + Intronic
1189910387 X:45805036-45805058 TTTCTTATGAAAAGGAAAGATGG + Intergenic
1189928436 X:45982307-45982329 TTGTTTATGAATATGAAATTTGG - Intergenic
1191021190 X:55862146-55862168 TTGTTTCTTAATCTGAAAAATGG + Intergenic
1191636759 X:63386376-63386398 TTATTTCTGAATAGGAATGAAGG - Intergenic
1191734061 X:64370203-64370225 ATGTTTCTGAAAAGGAAAGATGG - Intronic
1193075925 X:77355551-77355573 GTGGTTTTGAATAGGGAAGAGGG + Intergenic
1194757396 X:97753285-97753307 TTTTTGCTGAAAAGGAAATAAGG + Intergenic
1194760756 X:97793519-97793541 GTGTTTCCCCATAGGAAAGAAGG + Intergenic
1194804399 X:98309340-98309362 TTATTTCTGAAAAGCAGAGAGGG + Intergenic
1195129003 X:101836796-101836818 TTGTCTCTGAAGTGGAAGGATGG - Intronic
1195296751 X:103486091-103486113 CTGTGGCTGAATAGGAATGAAGG + Intergenic
1195441145 X:104899734-104899756 ATGGTTCTGAAGAGGAGAGAGGG - Intronic
1195721805 X:107875469-107875491 TTGTTTCTGATTAGGAAATGAGG + Intronic
1195752964 X:108175789-108175811 TTGTTTTTCAACAGGAGAGAAGG - Exonic
1195853476 X:109307469-109307491 TTGTCTCTGGTTAGGAAAGGAGG + Intergenic
1196263581 X:113614708-113614730 TTTTTTCTGTATAAGTAAGATGG + Intergenic
1196294177 X:113979909-113979931 TTGCTGTTGAATGGGAAAGAGGG + Intergenic
1197167480 X:123393812-123393834 CTGTTTATGAATAGAAATGATGG + Intronic
1197517862 X:127458527-127458549 TTGTTTTTGATTATGAAATAAGG + Intergenic
1198820823 X:140646393-140646415 TTCTTTCTGAATGGGAGGGAGGG + Intergenic
1199428519 X:147731809-147731831 CTGTTTTTGAGTAGGCAAGAAGG + Intergenic
1200010592 X:153117868-153117890 TTGTTCCTGTATTGTAAAGAGGG + Intergenic
1200029008 X:153282054-153282076 TTGTTCCTGTATTGTAAAGAGGG - Intergenic
1201012994 Y:9567700-9567722 TGGTTTCTGTTTGGGAAAGAAGG + Intergenic
1201434044 Y:13937363-13937385 TTGTTTTTCAATATGAGAGAGGG - Intergenic
1201535130 Y:15038874-15038896 GGATTTCTGAATAAGAAAGAAGG - Intergenic
1201577966 Y:15480272-15480294 TTGTTTCTGAATCAGAAAAAAGG - Intergenic
1201653049 Y:16312974-16312996 GTGTTTTTTAATAGGAAAAAAGG + Intergenic
1201724669 Y:17139327-17139349 TGGTTTCTGGACAGGTAAGATGG + Intergenic
1202174121 Y:22081840-22081862 AGGTTTCTGCAGAGGAAAGAAGG + Intronic
1202217239 Y:22504542-22504564 AGGTTTCTGCAGAGGAAAGAAGG - Intronic
1202325947 Y:23691517-23691539 AGGTTTCTGCAGAGGAAAGAAGG + Intergenic
1202544824 Y:25978537-25978559 AGGTTTCTGCAGAGGAAAGAAGG - Intergenic