ID: 1127899849

View in Genome Browser
Species Human (GRCh38)
Location 15:63333116-63333138
Sequence AGAATTTTCCAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 432}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127899843_1127899849 9 Left 1127899843 15:63333084-63333106 CCAGGAGGACGTGATTAGAGTTG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG 0: 1
1: 0
2: 5
3: 38
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127899849 Original CRISPR AGAATTTTCCAGATGGAGGA GGG Intronic
900853886 1:5165075-5165097 AGAAGTTTTCAGAAAGAGGATGG + Intergenic
901667751 1:10836065-10836087 TCAAGTTTCCAGCTGGAGGAGGG + Intergenic
901892540 1:12279842-12279864 AGCCTTTTTCATATGGAGGAGGG + Intronic
902592524 1:17485255-17485277 AAAATTAGCCAGATGGAGGCCGG - Intergenic
903798568 1:25949136-25949158 GGAGCTTTCCAGATGGATGAGGG - Intergenic
903877603 1:26486224-26486246 AGAAATTACCTGATGGAGGGTGG - Intergenic
904629763 1:31832064-31832086 TGGATTCCCCAGATGGAGGAAGG - Intergenic
904955261 1:34278365-34278387 AGCAAATTCCAGATGGAGCAAGG - Intergenic
905115988 1:35641341-35641363 AATATTGTCCAGATGAAGGACGG - Exonic
905570646 1:39001757-39001779 AGAATTTTCCATATCAATGAAGG + Intronic
906092980 1:43198529-43198551 TGAAGTGTCCAGATGGATGAAGG - Exonic
908295862 1:62712545-62712567 AGGACTCTCCAGCTGGAGGAAGG + Intergenic
908759396 1:67498112-67498134 TGCACTTTGCAGATGGAGGAAGG + Intergenic
908837847 1:68245905-68245927 AGACTTTTCTGGAGGGAGGAAGG - Intergenic
908859123 1:68463598-68463620 GGAATTTGCCAGATGGACAAGGG - Intergenic
909479512 1:76116398-76116420 AGCATTTTCCAGAATGCGGAAGG - Intronic
909514877 1:76496146-76496168 AGATTTTTCCATATGGAGGGAGG - Intronic
909602346 1:77473581-77473603 AGATTTCTCCAGAAGGAAGAAGG - Intronic
910113045 1:83702231-83702253 AGAGATTCCAAGATGGAGGAAGG - Intergenic
910113220 1:83703707-83703729 AGAGATTCCAAGATGGAGGAAGG + Intergenic
910185770 1:84538253-84538275 AGCATTTTCCAGATTAAGAATGG - Intergenic
910741782 1:90527141-90527163 ACAATGTTTCAGAGGGAGGAAGG + Intergenic
910825359 1:91401360-91401382 GGAATTTGCCAGTTGGAGAATGG - Intronic
911681905 1:100726518-100726540 AGATTTTGCCAGATGAAGGAAGG - Intronic
912415103 1:109502818-109502840 ACAACTTTCCAAATAGAGGAGGG + Intronic
913024756 1:114826390-114826412 AAAATTTTAGAAATGGAGGACGG + Intergenic
914265967 1:146038692-146038714 AGAATTTTTAAGATGGTGGCGGG + Intergenic
914724441 1:150315922-150315944 AGAAGGATCCAGAGGGAGGAAGG - Intergenic
914742279 1:150474867-150474889 AGAATATTAAAGATGGGGGAGGG + Intronic
914794854 1:150911380-150911402 AGAATTTTCTTGATGGAGTAAGG + Intergenic
916030213 1:160870281-160870303 AGAGTTCTGCAGATGGATGATGG - Intergenic
916091270 1:161309566-161309588 TGAATTTTACAGATGGAGTCTGG + Intronic
916254089 1:162768574-162768596 AGAGCTTTCTAGATGCAGGATGG + Intronic
916674503 1:167054405-167054427 AGAACTTTCCAGAGAGAGGGAGG - Exonic
917014282 1:170511916-170511938 AGAATATTTTAGATGGAGGTGGG + Intergenic
917297669 1:173538677-173538699 ACAATTATCCAGATGAAGAATGG + Intronic
917426236 1:174917468-174917490 AGAATTTAACAGCTGGTGGAAGG + Intronic
917463109 1:175249534-175249556 AGCATTTCCCAGATGGATGGTGG - Intergenic
917487288 1:175466783-175466805 AGAACATGCCAGATGGAGGGTGG - Intronic
917489669 1:175487468-175487490 AGCAGTTTCCAGAAGGAAGAAGG - Intronic
918584290 1:186168036-186168058 AGAAAAATCCAGATGTAGGAAGG + Intronic
919082490 1:192883255-192883277 AGAATTTAGTAGATGTAGGATGG + Intergenic
919394766 1:197032080-197032102 AGAATTTTGGAGATGGATGCTGG - Intergenic
920440337 1:205976333-205976355 AGAATGTTCCAAATGCAGGGTGG - Intergenic
920825482 1:209420992-209421014 AGAATGTTCTGGATGGAGGCAGG + Intergenic
921278388 1:213541881-213541903 AAAATTTGCCAGGTGGAGCAGGG + Intergenic
921352822 1:214255145-214255167 TGAAGTTTCCAGAGGGAGCAGGG - Intergenic
922340737 1:224652958-224652980 GGAAATTCCCAGCTGGAGGAAGG + Intronic
922390906 1:225140016-225140038 AGATTTTTCCAGATCGAGATAGG - Intronic
923105804 1:230852581-230852603 AGAGTTCTCGAGATGGATGATGG + Intronic
923678444 1:236100140-236100162 GGATTGTTGCAGATGGAGGAGGG - Intergenic
923682922 1:236133533-236133555 GGAATTTCCCAGGTGGAGAAAGG - Intergenic
924039708 1:239972392-239972414 AGATGTTTATAGATGGAGGAAGG + Intergenic
1063177286 10:3563299-3563321 AGATTTCTCCAGATAGAGGAAGG - Intergenic
1063489264 10:6448036-6448058 GGATTTTTCCAGGTGGAGTAGGG + Intronic
1063666252 10:8062436-8062458 AGACTTTTGCAAATGGAAGAGGG - Intronic
1063855099 10:10241235-10241257 AGAAATATCCAGGTAGAGGAAGG - Intergenic
1064331046 10:14394537-14394559 AGAATTTTAAAAATGGAGGAAGG + Intronic
1064344900 10:14523057-14523079 CGAATATTTCAGATGGAGGGTGG - Intronic
1064753429 10:18554638-18554660 AGAATGTAACAGATGGAGAATGG + Intronic
1064754823 10:18564346-18564368 AGAATGTAACAGATGGAGAATGG - Intronic
1065197935 10:23284803-23284825 AGAATCTTCCAGATGAAGCCAGG + Intronic
1065263559 10:23951782-23951804 AGCATTTTCCAAATGGAAAATGG + Intronic
1065816940 10:29491169-29491191 AGAATCTTGGAGATGGAAGAGGG + Intronic
1066549422 10:36539152-36539174 AGGCTTTTCCACATGGAGGCTGG - Intergenic
1067438135 10:46293031-46293053 AGAATTTTCCAGTAGAAGGGAGG + Intronic
1067574940 10:47403168-47403190 AGAATTTTCCAGTAGAAGGGAGG + Intergenic
1067844595 10:49709787-49709809 AGCATTTACCAGGTGGAGAAGGG - Exonic
1068462840 10:57350142-57350164 AGAATAGACCAAATGGAGGAAGG - Intergenic
1070315348 10:75305603-75305625 AGAATTTTGAAGATGGATGGAGG - Intergenic
1072486722 10:95863176-95863198 ACAGATTTCCAGAAGGAGGAGGG + Intronic
1072536086 10:96364252-96364274 ACAAATGTCCAGATAGAGGAGGG + Intergenic
1073875060 10:107913762-107913784 AGACTTTTCCATATGAAGAAGGG - Intergenic
1075605430 10:123802027-123802049 AGCATCTCACAGATGGAGGAAGG + Intronic
1076205030 10:128590732-128590754 GGCATTTTCCAGTAGGAGGAGGG + Intergenic
1077727337 11:4687886-4687908 AGAATATTCTAGGTGGAGGTAGG + Intronic
1079117537 11:17650098-17650120 AGAGTTTTCAAGATTGAGGAAGG + Intergenic
1079687507 11:23378474-23378496 CCAATTTTTCACATGGAGGATGG + Intergenic
1079970515 11:27030500-27030522 AGAGTGGTGCAGATGGAGGAGGG + Intergenic
1080109947 11:28555421-28555443 GGAATTTACCAGATGCAGAAGGG + Intergenic
1080606074 11:33865986-33866008 GGAATTTTACAGATGGAAGAAGG - Intronic
1081457227 11:43235865-43235887 GTGATTTTCCAGTTGGAGGATGG + Intergenic
1081602923 11:44507724-44507746 CCAATTATCCAGAAGGAGGAAGG + Intergenic
1081742175 11:45448476-45448498 AGAACATTCCAGACGGAGGGTGG + Intergenic
1081755552 11:45541833-45541855 AGAATTTTCAAGCTAGAGGGTGG - Intergenic
1081982994 11:47281606-47281628 AAATTTCTCCAGATTGAGGATGG - Exonic
1083030622 11:59588595-59588617 AGAGTTTTGGAGATGGAGGGTGG + Intronic
1083268821 11:61560389-61560411 AGAATATTCCATTTGGAGAAGGG + Intronic
1084837998 11:71818823-71818845 ATAATTTTGCAGCTGGAGCAAGG - Intergenic
1085417177 11:76327015-76327037 AAATTTTTTGAGATGGAGGATGG - Intergenic
1085581100 11:77651367-77651389 AGAGTTTTCCAGATAGATGGTGG - Intergenic
1085929190 11:81060149-81060171 GGAATTTTCCAGGTGGACAAAGG - Intergenic
1088604011 11:111512139-111512161 TGAATTTTCCAAATGGAGGTGGG - Intronic
1088846994 11:113676759-113676781 AGAAGTTTCCAGATGGATGTGGG + Intergenic
1089039334 11:115431689-115431711 AGAACTTTCCAGAGGGAACAGGG - Intronic
1090316028 11:125789304-125789326 AGAAATATTCAGATGGAGGTGGG - Intronic
1090769630 11:129908533-129908555 ATCATTATCCAGCTGGAGGATGG + Intronic
1091678656 12:2510437-2510459 ATAATTTTCCTCATAGAGGAAGG - Intronic
1092400706 12:8175251-8175273 ATAATTTTGCAGCTGGAGCAAGG + Exonic
1092991392 12:13905247-13905269 AGAATTTTCCAGAAGGCAGCAGG - Intronic
1094085059 12:26581288-26581310 AGCATTTGCCAAATGGAGGCGGG + Intronic
1095863572 12:46947180-46947202 AGACATTTACAGTTGGAGGAAGG - Intergenic
1096585504 12:52617174-52617196 AGGAGTTTTCAGATGGAGGTGGG - Intronic
1096988159 12:55775738-55775760 AGTATTTTGGAGATGGAGGTGGG - Intronic
1097502858 12:60427702-60427724 AGAAATTGCCAGTTGGAGAATGG - Intergenic
1097911173 12:64971055-64971077 AGAATTTGCCAGATGTAGTAAGG + Intergenic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098413287 12:70204295-70204317 AAAATTTTACAGATGGAGGAAGG + Intergenic
1099455380 12:82856661-82856683 TGAATATTCCAGATCGAGGCTGG - Intronic
1099841062 12:87967956-87967978 AGAGTATTTCAGATGGAGAATGG - Intergenic
1099850611 12:88091061-88091083 GGAATATTCAAGAGGGAGGAGGG - Intronic
1100506387 12:95224827-95224849 CAGTTTTTCCAGATGGAGGATGG + Intronic
1101227972 12:102708840-102708862 AGAATTATCCATGTGAAGGAGGG + Intergenic
1101573452 12:105976289-105976311 AGAATTTTCCTGATGAAGGAGGG - Intergenic
1102221670 12:111199024-111199046 TGCATTTTCCACATGGTGGATGG - Intronic
1102620941 12:114193934-114193956 AGCACTTTGAAGATGGAGGAAGG + Intergenic
1102621660 12:114200700-114200722 AAAATTGTACAGATGGGGGATGG - Intergenic
1102715035 12:114963178-114963200 AGGATGTTGCAGATGGGGGAAGG - Intergenic
1103151279 12:118641194-118641216 AGACTTTTCTTAATGGAGGAAGG + Intergenic
1103923616 12:124411988-124412010 AGAAGCTTCCAGAAAGAGGATGG + Intronic
1105336440 13:19474472-19474494 AGAATTATCCAGATTAATGAGGG - Intronic
1106567428 13:30898333-30898355 AGAATTGGCCAGATCCAGGAGGG + Intergenic
1106660283 13:31792420-31792442 GGAATTTTCTGGAAGGAGGAAGG - Intronic
1108676780 13:52743891-52743913 GGAATTTTCCAGGTGGAGATGGG + Intergenic
1108690910 13:52858245-52858267 AGAAAGTTCCAGATGGTGGCTGG - Intergenic
1109045308 13:57403505-57403527 AGCATTTTTCAGAAGGAGGAAGG + Intergenic
1109701675 13:66034002-66034024 AGAATGTGCCAGATAGGGGAGGG - Intergenic
1110240827 13:73264854-73264876 AGATTTTGCTAGATGCAGGAAGG + Intergenic
1110684426 13:78355058-78355080 GGCATTTTTCAGATGGAGGGGGG + Intergenic
1111395697 13:87666509-87666531 AGATTTTTTCAGATGGAGAAAGG + Intergenic
1111962097 13:94823152-94823174 AGACTTTTCCAGATTAAGAAGGG + Intergenic
1112235112 13:97629010-97629032 AGATTCTTCCAGATGGAGCCAGG - Intergenic
1112281382 13:98065737-98065759 AGTATTTTCAAAAGGGAGGAGGG + Intergenic
1112496696 13:99910975-99910997 ACAACTTTCCAGTTGGAGGGGGG - Intergenic
1112581693 13:100681692-100681714 TGAACTTTCCAGATTGAAGAAGG + Intergenic
1112831322 13:103455751-103455773 AGAATATTCCTGATGGAGTGCGG - Intergenic
1113794826 13:113050863-113050885 GGAGTTGTCCAGATGGAGGGGGG + Intronic
1113799633 13:113079741-113079763 AGGATTGTCCACACGGAGGAGGG + Intronic
1114661713 14:24350387-24350409 AGAATTGTCCACATGAAGGATGG + Intergenic
1114732146 14:25004417-25004439 AGAATTATACACATGGGGGAGGG + Intronic
1115049602 14:29041698-29041720 AGAATTTTCCAGAAAAAGAATGG - Intergenic
1116262050 14:42642985-42643007 AGAATTTTGGAGATGGATGATGG - Intergenic
1117528611 14:56637036-56637058 TGAACTTTGCAGATGGAGGAAGG + Intronic
1118702415 14:68446728-68446750 AGAATGTTCCAGGTGGAAGGAGG + Intronic
1119233114 14:72996633-72996655 AGACTTGGCTAGATGGAGGAGGG - Intronic
1119439819 14:74620568-74620590 CAAACTTTCCAGATGGAGGGAGG - Intergenic
1119651788 14:76389099-76389121 AAAGTTTTCCAGATGTAGGAGGG - Intronic
1119746077 14:77045047-77045069 AAGACTTTCCAGATGGGGGAAGG + Intergenic
1120901615 14:89580581-89580603 AGAATTACACAGATGGAGGTTGG - Intronic
1121257209 14:92539729-92539751 AGAAGATTCCAGAGGGAGGGAGG + Intronic
1121367692 14:93329855-93329877 AGAATTCTACAGATGGATGGTGG + Intronic
1122167388 14:99838536-99838558 AAAATTATGCAGATGGAGAAGGG - Intronic
1122593385 14:102871406-102871428 AGAAGCTTCCCGGTGGAGGAGGG + Intronic
1123492900 15:20796985-20797007 TGAATATCCCAGATGGAGGCTGG + Intergenic
1123549401 15:21366083-21366105 TGAATATCCCAGATGGAGGCTGG + Intergenic
1124166268 15:27328456-27328478 ACCAGTTTCCAAATGGAGGAAGG + Intronic
1126161345 15:45616529-45616551 AGATTTCTCCAGATGGTGGTGGG - Intronic
1126230184 15:46314803-46314825 AGAATTTTCCAACTGAGGGAGGG - Intergenic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127350878 15:58150763-58150785 AGAATTTTCTAGAGAAAGGAAGG - Intronic
1127464163 15:59227510-59227532 AGATTTTTCCAGAAGGAAGTTGG + Exonic
1127698177 15:61471994-61472016 AGAATTGGCCAGATGAAGAAGGG - Intergenic
1127899849 15:63333116-63333138 AGAATTTTCCAGATGGAGGAGGG + Intronic
1128133158 15:65244075-65244097 AGATCTTACCAGATGGAGAAAGG - Intronic
1128173515 15:65533069-65533091 AGAATGTTCCAGAAAGAGAAAGG + Intronic
1128524267 15:68401900-68401922 AGAATTAGCCAGATGGTGGTGGG + Intronic
1128593212 15:68921117-68921139 AGAATTTTTCAGGTGGAGTCTGG - Intronic
1128677835 15:69624830-69624852 AGCATGTCCCAGATGGAGGAAGG - Intergenic
1129685362 15:77683217-77683239 AGAATGTTCAATGTGGAGGATGG + Intronic
1130119590 15:81036112-81036134 AGAATTTTTCAGATGCACAAAGG - Intronic
1131681784 15:94731110-94731132 AGAATTTTCAAGCCTGAGGAAGG - Intergenic
1132300625 15:100773471-100773493 TGAATTTTCCAGATGGTGTATGG + Intergenic
1202957732 15_KI270727v1_random:93301-93323 TGAATATCCCAGATGGAGGCTGG + Intergenic
1134371846 16:13633288-13633310 TGTACTTTGCAGATGGAGGAAGG + Intergenic
1134379476 16:13710725-13710747 AGAGTTAGCCAGATGAAGGAAGG - Intergenic
1135791186 16:25397722-25397744 TAAGTTTTCCAGATGTAGGAGGG + Intergenic
1135905155 16:26505251-26505273 AGAATTTTCCAGAAAGAGCAAGG - Intergenic
1136067077 16:27766573-27766595 AGAATTTTCCAAACGGAGCTGGG + Intronic
1137315799 16:47321107-47321129 TAGATTTTCCAGATGGTGGAAGG - Intronic
1137871932 16:51958386-51958408 AAAATTTGGCAGTTGGAGGATGG - Intergenic
1138814320 16:60186791-60186813 AGAAATTTCCAGGATGAGGATGG - Intergenic
1139015623 16:62685185-62685207 AGAGGTTTCCAGCTGGAAGAGGG + Intergenic
1139142272 16:64280858-64280880 AGAATTTTCAAGAAAGAGGCTGG + Intergenic
1140342666 16:74180458-74180480 AGAAATTTAAAGATAGAGGAAGG + Intergenic
1141254363 16:82386787-82386809 AGAAATTTGCAGATAGAGGAAGG - Intergenic
1141487412 16:84349912-84349934 AGAGATTTGAAGATGGAGGAAGG + Intergenic
1141495395 16:84406334-84406356 AGAATTTTCCAGGTGCCTGAGGG + Intronic
1144311652 17:14019414-14019436 AGAGTTTTACAGATGGAGGGTGG + Intergenic
1144396951 17:14853664-14853686 AGAAAGTTCTAGAAGGAGGAAGG + Intergenic
1144429896 17:15181667-15181689 AGAGTTTCCAAGATGGAGCAGGG + Intergenic
1145397206 17:22505724-22505746 AGAATTTCCCAGGTGGAGCAAGG + Intergenic
1145902576 17:28498120-28498142 CGGTTTTTCCAGCTGGAGGAAGG - Intronic
1146227112 17:31076779-31076801 GTAATTTTCCAAAAGGAGGATGG + Intergenic
1146660592 17:34662904-34662926 CCAATTTCCCATATGGAGGATGG + Intergenic
1149490725 17:57083538-57083560 AGAATATTCCATGTGGAGGGAGG + Intergenic
1150202091 17:63368216-63368238 AGAACTTTCTGAATGGAGGAGGG + Intronic
1151027183 17:70691534-70691556 AGAAATATTGAGATGGAGGAAGG + Intergenic
1151447854 17:74178818-74178840 AGAATCTTCCAAATGAGGGAGGG + Intergenic
1153944152 18:10004053-10004075 TGCCTTTTCCAGATGGTGGAGGG + Intergenic
1154450441 18:14471518-14471540 TGAATATCCCAGATGGAGGCTGG + Intergenic
1155280625 18:24235970-24235992 AGAGACTTCCAGATGGAGGATGG + Intronic
1155656216 18:28195760-28195782 AGAATTTCCCAGATGTCAGATGG - Intergenic
1155843398 18:30674789-30674811 CAAATTTTGAAGATGGAGGAAGG - Intergenic
1157428375 18:47602911-47602933 CAAATTTTCCAGATGGAGTTGGG + Intergenic
1159392891 18:67817274-67817296 AAAATTTTGGAGATGGATGATGG - Intergenic
1164558934 19:29275309-29275331 AGGATTTTGCAAATGGAGGTAGG - Intergenic
1164619545 19:29686454-29686476 AGAATATTCCAGACAGAGGGAGG + Intergenic
1164987527 19:32659376-32659398 AGAAATTGCCAGATGCAGGTCGG - Intronic
1167237996 19:48326452-48326474 AGATGTCTCCTGATGGAGGAAGG - Intronic
1167804512 19:51771216-51771238 AGTATTTTACACATAGAGGATGG - Intronic
1168533095 19:57145677-57145699 AGATTTTGCCAGTTGGAGGTTGG - Intergenic
1168634144 19:57982252-57982274 TGAGCTTTGCAGATGGAGGAAGG - Intronic
925568040 2:5277863-5277885 GAATTTGTCCAGATGGAGGAAGG - Intergenic
925639980 2:5978187-5978209 TGAATTTTCCTGAAGAAGGAAGG + Intergenic
925811199 2:7702600-7702622 AGAACTTACCAGAGGGAGGCAGG + Intergenic
925991718 2:9259972-9259994 AGAGTTTCCCAGATAGGGGAGGG - Intronic
926372583 2:12194971-12194993 GGGATTTCCCAGATGGAGCAGGG + Intergenic
927073547 2:19553989-19554011 AGCATTTGACAGATGGAGGCGGG - Intergenic
927269027 2:21185734-21185756 AGAATTTTCCAAATATAGAAAGG + Intergenic
927669809 2:25059641-25059663 AGAATTTTGGAGATAGATGATGG + Intronic
927942766 2:27115850-27115872 AGGACATTCCAGATTGAGGATGG - Intronic
929939820 2:46325057-46325079 TGACCTTTCCAGATGGAGCAGGG + Intronic
930419017 2:51126180-51126202 AGCATTTTCCAGTTGGAAAAGGG - Intergenic
931332736 2:61305027-61305049 AAAATTTTACAGACGTAGGACGG + Intronic
931844857 2:66193101-66193123 GGCATTTTCCAGGTAGAGGAGGG + Intergenic
931978661 2:67670637-67670659 ATAAATTTTCAGAAGGAGGATGG + Intergenic
932730162 2:74214493-74214515 AGACATTACCATATGGAGGATGG + Exonic
933159129 2:79005207-79005229 AGAATTTTACAGGTGGAAAAGGG + Intergenic
933225065 2:79738496-79738518 AGGCTTTTCCTGTTGGAGGAGGG + Intronic
933314138 2:80695822-80695844 TGATTTTTCCAGATGTTGGAGGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936715983 2:115188131-115188153 AGAATTTTGCTGATCAAGGAAGG + Intronic
937107253 2:119328162-119328184 AGATTCTTCCAGAAGAAGGATGG - Intronic
937801457 2:126085261-126085283 AGAAGTTACCAGAATGAGGATGG - Intergenic
938206251 2:129426721-129426743 AGAACTGAACAGATGGAGGAAGG - Intergenic
938795392 2:134714729-134714751 AGATTTTTACAGAGAGAGGATGG - Intronic
940124741 2:150310890-150310912 AGAATATACCAAATGGAGGAAGG + Intergenic
940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG + Intronic
941485436 2:166074348-166074370 AGAAATTGCTAGATGGAGGTGGG + Intronic
941764236 2:169278950-169278972 AGATTTTTAAAGATGGAGGTTGG - Intronic
941892164 2:170594006-170594028 ATAATTTTCCAAAGGAAGGAAGG - Intronic
942062838 2:172243706-172243728 AGAAGTTACCAGTTGGAGCAGGG + Intergenic
944279099 2:197873739-197873761 AGGATTTTCCTATTGGAGGAAGG - Intronic
945369505 2:208999598-208999620 AGAAATTTCTAGAAGGAGGGTGG - Intergenic
945968171 2:216210212-216210234 AGAGTTTTAGAGATGGAGGTGGG + Intergenic
946227839 2:218273858-218273880 ACAGTTTTGCAGATGGAGGAGGG - Intronic
946608163 2:221429239-221429261 AGAACTTTCTACATGGAGAATGG - Intronic
948338724 2:237231992-237232014 AGAAGTCAACAGATGGAGGAAGG + Intergenic
948644369 2:239394640-239394662 AGAAGTTCCCAGATGGGGGCAGG + Intronic
1168759278 20:338003-338025 AGAGTTCTCAAGATGGATGATGG - Intergenic
1168919739 20:1521402-1521424 AGCATTATGCAGAAGGAGGATGG + Intergenic
1168994689 20:2124426-2124448 TGAATTTCCCAAAGGGAGGATGG + Intronic
1169497846 20:6132245-6132267 AGAAGCTACAAGATGGAGGAAGG + Intergenic
1170390670 20:15870343-15870365 AGAATTTTCCAGATTCTGAAAGG - Intronic
1170467667 20:16637727-16637749 AGAAGTTTCCAAATGAAGAAAGG + Intergenic
1170489812 20:16861633-16861655 AGAATTATACACATGGAAGATGG + Intergenic
1171277952 20:23874724-23874746 ATAATTTTCCATGTGGATGAAGG - Intergenic
1173467175 20:43292498-43292520 ACCATTTTCCAGATGGAGAGAGG + Intergenic
1173537623 20:43828211-43828233 AGAGTTTTCCAGGTGGACAAGGG + Intergenic
1174009621 20:47439147-47439169 AGCTGTTTCCAGAAGGAGGAGGG - Intergenic
1174532072 20:51222098-51222120 AGAGTTAACCAGATGGAGAAAGG + Intergenic
1174707388 20:52670370-52670392 AGAAATTTCCAGAGGAAGGGTGG - Intergenic
1174930089 20:54804274-54804296 GGAGTTTTCCAGGTGGAAGAGGG + Intergenic
1175456757 20:59121240-59121262 AGCACTTTCCAGAGGGAGCAGGG + Intergenic
1175609002 20:60334582-60334604 GGTATTTTCCAGATGTAGGCAGG + Intergenic
1176445751 21:6818866-6818888 TGAATATCCCAGATGGAGGCTGG - Intergenic
1176737117 21:10560635-10560657 AGAATTATCCAGATTAATGAGGG + Intronic
1176823919 21:13683899-13683921 TGAATATCCCAGATGGAGGCTGG - Intergenic
1177053257 21:16265906-16265928 GGAATTTTCCAGGTGAAGAAGGG + Intergenic
1178102789 21:29287993-29288015 GGAATGTTTCAGGTGGAGGAAGG + Intronic
1178708434 21:34892405-34892427 AGAAACATTCAGATGGAGGAAGG - Intronic
1178809919 21:35872205-35872227 GGAATTGTTCAGATGGAAGAGGG - Intronic
1178839624 21:36128429-36128451 AGAGATTTGGAGATGGAGGAAGG - Intergenic
1180563115 22:16638157-16638179 AGAATTATCCAGATTAATGAGGG + Intergenic
1181312782 22:21954419-21954441 ATAATTTTTTAAATGGAGGATGG + Intergenic
1181593442 22:23898133-23898155 AGAAGTCTCCAGATGGAGCCGGG + Intronic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1182449695 22:30411947-30411969 AGAGTCTGCCAGATGGAGCAAGG + Intronic
1182970023 22:34564951-34564973 AAAATTATCCAGGTGGAGGTGGG + Intergenic
1183511235 22:38236232-38236254 AGAAAGTTCCAGATGGGGCATGG - Intronic
1183532010 22:38361969-38361991 AGAATTATCCAGATTAATGAGGG - Intronic
1183669657 22:39264911-39264933 AGATTTGGTCAGATGGAGGAGGG - Intergenic
1184532472 22:45065002-45065024 GGAATGTTCCAGATGGTGCAAGG - Intergenic
1185242771 22:49755377-49755399 AGAAGCTTCTAGAAGGAGGAGGG - Intergenic
950160962 3:10760961-10760983 ACAATTGTCAAGGTGGAGGAAGG + Intergenic
950236954 3:11330806-11330828 AGAGTTTTCCAGATGAAGATCGG + Intronic
950387536 3:12672047-12672069 AGAATGTTCCAGACTGAGAAGGG + Intergenic
950850081 3:16053890-16053912 AGAATTTTCCAGGCATAGGAAGG + Intergenic
951698511 3:25470495-25470517 AGCATTTTCCAGATGAGGAAGGG + Intronic
952065818 3:29568776-29568798 AGAATTGTCCAGGTGGAGTTTGG + Intronic
952733154 3:36661097-36661119 TCCCTTTTCCAGATGGAGGAGGG + Intergenic
954241567 3:49297906-49297928 AAAATTTTCCAAATGGATGAAGG - Exonic
954627484 3:52030505-52030527 AGTATTTTCCAGATGAATGGTGG + Intergenic
957514073 3:81228768-81228790 AGAATTTTGCAGCTGGGGAAAGG - Intergenic
958078877 3:88719597-88719619 AGAGTTCTGCAGATGGATGATGG + Intergenic
958577727 3:95974098-95974120 AGAATTTTGCTGCTGGAGCAGGG + Intergenic
960179536 3:114559083-114559105 AGAATGTTCCAGAAGGAAGGAGG + Intronic
961207941 3:125102215-125102237 AGAGTTTTCCAGATGGAGAAGGG + Intronic
961754348 3:129119181-129119203 GGCACTTTACAGATGGAGGAGGG + Intronic
961988436 3:131161670-131161692 GGAATTTTTCAGAGGGTGGAGGG + Intronic
962302978 3:134259609-134259631 AAAATTTTCCAGAGGGCAGAGGG - Intergenic
962408400 3:135119797-135119819 ATAAAGTTCCAGATGGAAGAAGG - Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
965695928 3:171408266-171408288 AAAATTTTCCAGATTGAGCGGGG - Intronic
966168662 3:177051722-177051744 ACAATTTTCCAAATCCAGGATGG - Exonic
966723935 3:183091664-183091686 ATAATTTTACAGATGAAGCAAGG + Intronic
967597791 3:191348190-191348212 TGAATTTTCTAGATGGTAGAGGG + Intronic
968600125 4:1504748-1504770 AGAATTCTCCAGAATGAGGGCGG + Intergenic
969427904 4:7136644-7136666 AGAATCTTACAGGTGGAGGCGGG - Intergenic
969779415 4:9386327-9386349 ATAATTTTGCAGCTGGAGCAAGG - Exonic
969856947 4:10007630-10007652 AGAATGTTCCAGCAGGAGGAAGG - Intronic
970493372 4:16599323-16599345 TGAGTTTTGAAGATGGAGGAAGG - Intronic
971569080 4:28186807-28186829 ATAAATATCCAGATAGAGGAAGG - Intergenic
973201931 4:47513576-47513598 AGCATATTTCAGATGGAGGAAGG + Intronic
973622967 4:52745611-52745633 AGAATTTTCCAGGTTGAGGAGGG + Exonic
973804575 4:54513517-54513539 AGAATTTGACAGATGCAAGAAGG + Intergenic
974581038 4:63801838-63801860 AGAGTATTCCAGATAGAAGATGG + Intergenic
975135611 4:70871356-70871378 AGAATTTTAAAAATTGAGGATGG + Intergenic
976455476 4:85241927-85241949 AGAATTATGGAGATGGATGATGG - Intergenic
976859291 4:89643768-89643790 AGAATTCTCCAGGTGGGGAAGGG + Intergenic
977118785 4:93069617-93069639 AGAATGTGCCAACTGGAGGAAGG + Intronic
979805092 4:124961132-124961154 TGATTTTTCCAGATGGATGCTGG + Intergenic
979943734 4:126798000-126798022 AAAATCTTCCAGTTGGTGGACGG + Intergenic
981348081 4:143699105-143699127 ATCATCTTCCGGATGGAGGACGG - Exonic
981486985 4:145297207-145297229 AGAGTATTTCAGATGGAGGCCGG - Intergenic
983682174 4:170365906-170365928 AGAATGTTCCAGGTGGACAAGGG + Intergenic
984338419 4:178421952-178421974 AGATTTTTCCAAATGGAATAGGG + Intergenic
984483777 4:180339201-180339223 AGAGATTTCCAGATTGAGGGAGG + Intergenic
986260773 5:6144142-6144164 AGAACTGTCCAAATGGAGGCAGG + Intergenic
987239269 5:15977244-15977266 AGAGTTTTGGAGATGGATGAAGG + Intergenic
988093969 5:26578834-26578856 TGAATATTTCAGCTGGAGGAAGG + Intergenic
988260440 5:28880679-28880701 AGAATTTATCATATGTAGGAGGG - Intergenic
988366446 5:30306467-30306489 ATAATGTTCCCGATGGAGGATGG - Intergenic
990757119 5:59085912-59085934 AGAACTTTTCAAATGGAGGTTGG + Intronic
994312060 5:98284889-98284911 AGTATTTTCCATATGAATGATGG + Intergenic
995336736 5:111008253-111008275 AGAATTTCCTAGAAGAAGGAAGG - Intergenic
995483064 5:112612036-112612058 AGAATTTTGCTAACGGAGGAAGG + Intergenic
995969443 5:117950098-117950120 AGGATTTTCATTATGGAGGAAGG + Intergenic
996688341 5:126309968-126309990 AGAATGTTCATGAGGGAGGATGG - Intergenic
997162345 5:131622306-131622328 AGAATTCTCCAAAGGGAAGAAGG + Intronic
997214194 5:132096772-132096794 AGAAGTATCCAGAAGGAAGAGGG + Intergenic
997894460 5:137703779-137703801 AGATATTTCCAGGTGGAGGAGGG - Intronic
998288682 5:140890669-140890691 TGCATTTCCCAGAAGGAGGAAGG - Intronic
998911923 5:146969267-146969289 AGTGGGTTCCAGATGGAGGAAGG + Intronic
999650148 5:153757423-153757445 ATAATTATCCAGGTAGAGGAAGG + Intronic
999904348 5:156123065-156123087 AGTATTTTCCAGGTGGAAGCTGG + Intronic
1000930252 5:167242945-167242967 AGAATCTTTCAGAAGGAGTAGGG + Intergenic
1001629071 5:173161102-173161124 AAAATAATCCAGATGGGGGATGG - Intronic
1001875227 5:175194607-175194629 ATAAGTTTCCATAAGGAGGATGG + Intergenic
1004470506 6:15924769-15924791 AGTATTTTCCAGATGGCACAGGG + Intergenic
1005568050 6:27116078-27116100 AGAATTTTCCAAAGTGAGGTAGG - Intergenic
1007600041 6:43075963-43075985 AGAATTCTCCAGGTGGGGGCAGG - Intergenic
1008855108 6:56075036-56075058 AGAATTTTCAAGAGTGAAGATGG - Intronic
1009545491 6:65014560-65014582 AGAGTTTTCTAGAAGGATGAGGG + Intronic
1010106292 6:72172879-72172901 AGAAATTTCGAGCAGGAGGATGG - Intronic
1011394312 6:86890610-86890632 AGACTTTTCTAAATGGAGCATGG + Intergenic
1012021348 6:93924918-93924940 ATAATTTTACAGGTAGAGGATGG - Intergenic
1012324045 6:97891966-97891988 AGAATTTTCTGAATAGAGGAAGG - Intergenic
1012532045 6:100249940-100249962 AGTATTTTCCAGTTGGAGAAAGG - Intergenic
1013158885 6:107522328-107522350 AGAATTTTCTAGATGCAGAATGG + Intronic
1013500825 6:110749653-110749675 AAAATTTTCCAGAGCCAGGAGGG - Intronic
1015379117 6:132546712-132546734 ATTATTTTCCAGAAGGAGGCAGG + Intergenic
1015577968 6:134692819-134692841 AGAACTTGCCATATGGGGGATGG + Intergenic
1016093385 6:140006520-140006542 AGAATTTTTCAGATGGAATCAGG + Intergenic
1016665404 6:146633594-146633616 AGAATGCTCCAGATACAGGAAGG - Intronic
1016876701 6:148872785-148872807 TGTGTTTTGCAGATGGAGGAAGG - Intronic
1017963791 6:159246376-159246398 AGAATATTCCAGAAGCAAGATGG + Intronic
1018957513 6:168420035-168420057 AGAAGTTTCCAGGTGGATAAGGG - Intergenic
1019131914 6:169883159-169883181 AAATCTTTGCAGATGGAGGAAGG + Intergenic
1019695193 7:2441970-2441992 AGAATTTTGGAGATGGATGGTGG - Intergenic
1020020996 7:4868574-4868596 ACAAGTTTGCAGCTGGAGGAAGG - Intronic
1020454360 7:8354328-8354350 AAAATTCTTCAGAGGGAGGATGG + Intergenic
1021208749 7:17817493-17817515 AGAATCTTCCAGTTTGGGGATGG - Intronic
1022003155 7:26244938-26244960 AGAATTGTCCTGAGGGGGGATGG - Intergenic
1022692258 7:32668424-32668446 ACAATCTTCCAGAGAGAGGAAGG + Intergenic
1022795989 7:33731722-33731744 GGATTTTTCTAGAAGGAGGAGGG - Intergenic
1022905672 7:34853127-34853149 AGAATTTTCCAAATGAAGCTAGG - Intronic
1022919882 7:35002663-35002685 ACAATCTTCCAGAGAGAGGAAGG + Intronic
1023019792 7:36001175-36001197 TGAATTTGCCAGGGGGAGGAGGG - Intergenic
1023109843 7:36798745-36798767 ACATTTTTCCAGACGAAGGAAGG + Intergenic
1024202263 7:47119463-47119485 AGAATGTTCCAGGGGGAGAAGGG + Intergenic
1024404690 7:48964715-48964737 AGATTATGGCAGATGGAGGATGG - Intergenic
1024714283 7:52057495-52057517 ATACTTTTGCAGATGGGGGAAGG - Intergenic
1024823106 7:53357119-53357141 AGAATTTTCCACATAGAGAGTGG - Intergenic
1027592102 7:80130629-80130651 ATAATTGTCCTGATGGAAGATGG + Intergenic
1028525630 7:91782659-91782681 GAAATTTTCCAGGTGGAAGATGG - Intronic
1029436388 7:100566298-100566320 AGAATGTTCCAGACCCAGGAGGG - Exonic
1030438348 7:109553298-109553320 AGAATAAACCAAATGGAGGAAGG + Intergenic
1031077180 7:117224228-117224250 AGAATTTGCAAGAGGAAGGAGGG - Intronic
1031315462 7:120252953-120252975 AGAAGTTGCCAGATAGAGAAAGG + Intergenic
1032203109 7:129837338-129837360 AGAAGTTTCCAGAAAGATGAGGG + Intronic
1032357411 7:131223611-131223633 AGCATTTTAGAGATGGAGAATGG - Intronic
1032647052 7:133836396-133836418 AGAATTGGCCAGAAGGAGAAGGG - Intronic
1032809923 7:135402533-135402555 AGAATTTTCATGATGGAGTCTGG - Intronic
1032890025 7:136184077-136184099 AGAGTTTTGAAGATGGAGGAAGG + Intergenic
1035284660 7:157798635-157798657 AGAATTATTAAGATGAAGGATGG - Intronic
1036276848 8:7360287-7360309 ATAATTTTGCAGCTGGAGCAAGG - Exonic
1036344481 8:7950056-7950078 ATAATTTTGCAGCTGGAGCAAGG + Exonic
1036839823 8:12110823-12110845 ATAATTTTGCAGCTGGAGCAAGG + Exonic
1036861613 8:12357067-12357089 ATAATTTTGCAGCTGGAGCAAGG + Intergenic
1037288871 8:17329931-17329953 AGATGTTTTCAGATGTAGGAAGG + Intronic
1037302791 8:17470314-17470336 AGAATTTTGCAAATGGAAGAAGG + Intergenic
1040477086 8:47788267-47788289 GCAAGTCTCCAGATGGAGGAGGG + Intronic
1041138491 8:54788112-54788134 ATAATTTTTCAGATGAATGAAGG + Intergenic
1041731058 8:61063397-61063419 GGTATTTTCCAGCTGGAGGGTGG + Intronic
1042352737 8:67794193-67794215 ACACCTTGCCAGATGGAGGAGGG - Intergenic
1042465015 8:69119061-69119083 AAAATTTTCCAAATGGAGAACGG - Intergenic
1042597683 8:70466984-70467006 AGAAGCTTCCAGGTAGAGGATGG - Intergenic
1043670280 8:82876093-82876115 AAAGTTATCCAGATGTAGGATGG + Intergenic
1043961311 8:86421901-86421923 AAAATTTTGCAGATGGGGAAGGG + Intronic
1044732074 8:95237049-95237071 AGAGTTTTCCCCATGGAGTAAGG - Intergenic
1045384247 8:101655990-101656012 AGCCTTGTCCATATGGAGGAAGG - Intronic
1045435802 8:102162532-102162554 AGTATCTTCCAGAAGTAGGAGGG + Intergenic
1046036113 8:108843498-108843520 GGAACATTCCAGATGGAGGAAGG + Intergenic
1046625022 8:116567615-116567637 AGAGTATTCCAGATGGACAAGGG - Intergenic
1047831274 8:128633047-128633069 TGAAGTTTCCAGATTGAGCATGG + Intergenic
1047937155 8:129793631-129793653 AGAACTTCCCAGATCTAGGAAGG - Intergenic
1047955624 8:129973290-129973312 AGAATTGGCCAGAGGCAGGAAGG + Intronic
1048791956 8:138112463-138112485 AGAGTTTTCCAGATAGAGGATGG - Intergenic
1048995661 8:139792315-139792337 AGAATTATCCAGATGGCAGCAGG + Intronic
1049274478 8:141712953-141712975 AGAGCTTTTCAGAGGGAGGATGG + Intergenic
1049345897 8:142138446-142138468 AGAAATTTCTAGAATGAGGATGG - Intergenic
1049899895 9:149428-149450 AGGCTTTTACAGATGGAGTAGGG - Intronic
1049956418 9:697141-697163 AGAACTTTTCAGATGGAAGGAGG - Intronic
1050784037 9:9376390-9376412 ATAATTTGACTGATGGAGGAAGG - Intronic
1051027345 9:12629017-12629039 AGAATTTTAATGATGGTGGAAGG - Intergenic
1051159869 9:14195257-14195279 AGAGCTTTGCAGATGGATGAAGG - Intronic
1051748873 9:20321038-20321060 AGAAAATTCCAGCTGGAGGTGGG - Intergenic
1051959517 9:22741327-22741349 AGAATTTTCAAACTGGAGGTGGG + Intergenic
1052937697 9:34106751-34106773 AGAGAGTTCCAGATGGAAGATGG - Intronic
1052984722 9:34478398-34478420 AGAAGTTTCAAGAAGGAGGGAGG + Intronic
1053036384 9:34830349-34830371 AGAAATTTCCAGAGGGAAGGGGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053751592 9:41262547-41262569 AGAATTTTCCCAATGTAGCAAGG - Intergenic
1054257116 9:62826876-62826898 AGAATTTTCCCAATGTAGCAAGG - Intergenic
1054334200 9:63788849-63788871 AGAATTTTCCCAATGTAGCAAGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055312508 9:74997598-74997620 AAAATTTTGCAGATGGGGAATGG - Intronic
1055788510 9:79896959-79896981 AGAATTGTCCACATGGAGATAGG - Intergenic
1060266315 9:122113491-122113513 GGAGTTTGCCAGATAGAGGAGGG + Intergenic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1060815513 9:126633076-126633098 AGAGTTTTCCAGAAGAAGAAAGG - Intronic
1061077203 9:128348828-128348850 ACCATTTTCCAGATGGAAAAAGG - Intronic
1061423325 9:130483955-130483977 GGAATGTTCCAGATGGTGGGTGG - Intronic
1061423330 9:130483968-130483990 GGAACATTCCAGATGGAGAATGG + Intronic
1061562967 9:131418280-131418302 ACAAGTTTCCAGAAGGAAGAGGG - Intronic
1061824835 9:133251798-133251820 GGAATCTTCCAGGTGGAGGTGGG - Intronic
1061963403 9:133999273-133999295 AGTATTTTCTATGTGGAGGATGG - Intergenic
1203523442 Un_GL000213v1:65659-65681 TGAATATCCCAGATGGAGGCTGG + Intergenic
1185871419 X:3667905-3667927 AGAATTTTGCAGGAGGAGTAGGG - Intronic
1186433627 X:9525048-9525070 AGAATATTCCAGAGGGATGATGG + Intronic
1187669195 X:21651637-21651659 AGAATTTCCCAGGTGGAAGGTGG - Intronic
1187972998 X:24677136-24677158 AGAGTGTTCTAGAAGGAGGATGG - Intergenic
1187999994 X:24971880-24971902 AGGATTTTAAAGATGGAGGGGGG + Intronic
1188034915 X:25306709-25306731 AGAATTTTCCATGTAGGGGATGG + Intergenic
1188295800 X:28446530-28446552 ACATTTTTCCGGATGAAGGAAGG - Intergenic
1190873328 X:54443033-54443055 AGAATAGTCCAGATGAAAGAGGG + Intronic
1192054786 X:67761912-67761934 ATAATTTTCCAGATGAAAAATGG - Intergenic
1195576736 X:106460102-106460124 ACAAATTACCACATGGAGGAGGG + Intergenic
1195842237 X:109186818-109186840 AGAAGTTTATAGATGGAGAAGGG + Intergenic
1195905545 X:109840691-109840713 ATAATTTGCCTGATGGGGGAGGG - Intergenic
1196192874 X:112812825-112812847 AGAATTTTGGAGATGGAGGCGGG - Intronic
1196731448 X:118944892-118944914 AGAATTCTAGAGATGGAGGGTGG + Intergenic
1198752571 X:139950331-139950353 AGAATTTTTCATATTGAGGCTGG + Intergenic
1198883143 X:141303256-141303278 AGACTTTTCTAGGGGGAGGAGGG + Intergenic
1199351029 X:146800756-146800778 AGAAGTTTCCAGATGGGACACGG + Intergenic
1200327286 X:155254612-155254634 AATATTCTCCAGATGGTGGAGGG + Intergenic
1200329506 X:155281735-155281757 AGAATATTCCAGGTGTATGAGGG - Intronic
1200792692 Y:7313787-7313809 AGAATTTTGCAGGAGGAGTAGGG + Intergenic
1201177340 Y:11316837-11316859 AGAATTTCACAGATGGACAAGGG - Intergenic
1201316479 Y:12652211-12652233 AGCATTTTCCTGATGGCTGATGG + Intergenic
1201632666 Y:16086283-16086305 AAAGTTTTGGAGATGGAGGATGG + Intergenic
1202595372 Y:26533899-26533921 AGAATTATCCAGATTAATGAAGG + Intergenic