ID: 1127900272

View in Genome Browser
Species Human (GRCh38)
Location 15:63335964-63335986
Sequence CTGTGTCTTTGGGAAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 411}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127900260_1127900272 30 Left 1127900260 15:63335911-63335933 CCCCTTTGGGACTGCCTCCTCAT 0: 1
1: 0
2: 2
3: 31
4: 248
Right 1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG 0: 1
1: 0
2: 2
3: 40
4: 411
1127900261_1127900272 29 Left 1127900261 15:63335912-63335934 CCCTTTGGGACTGCCTCCTCATT 0: 1
1: 1
2: 0
3: 8
4: 183
Right 1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG 0: 1
1: 0
2: 2
3: 40
4: 411
1127900266_1127900272 13 Left 1127900266 15:63335928-63335950 CCTCATTGCTCCTTGGGAAGCAG 0: 1
1: 0
2: 1
3: 18
4: 215
Right 1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG 0: 1
1: 0
2: 2
3: 40
4: 411
1127900268_1127900272 -10 Left 1127900268 15:63335951-63335973 CCGCACTTGCTGCCTGTGTCTTT 0: 1
1: 0
2: 1
3: 35
4: 428
Right 1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG 0: 1
1: 0
2: 2
3: 40
4: 411
1127900265_1127900272 16 Left 1127900265 15:63335925-63335947 CCTCCTCATTGCTCCTTGGGAAG 0: 1
1: 0
2: 2
3: 17
4: 206
Right 1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG 0: 1
1: 0
2: 2
3: 40
4: 411
1127900262_1127900272 28 Left 1127900262 15:63335913-63335935 CCTTTGGGACTGCCTCCTCATTG 0: 1
1: 0
2: 4
3: 11
4: 144
Right 1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG 0: 1
1: 0
2: 2
3: 40
4: 411
1127900267_1127900272 3 Left 1127900267 15:63335938-63335960 CCTTGGGAAGCAGCCGCACTTGC 0: 1
1: 0
2: 1
3: 25
4: 130
Right 1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG 0: 1
1: 0
2: 2
3: 40
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127900272 Original CRISPR CTGTGTCTTTGGGAAGTGAA AGG Intronic
901737298 1:11320483-11320505 CTGGGTCTTTGGGGAGTGGAGGG - Intergenic
901768325 1:11517826-11517848 AGGGTTCTTTGGGAAGTGAATGG - Intronic
902403566 1:16171360-16171382 CTGAGGCATGGGGAAGTGAAGGG + Intergenic
902514813 1:16984416-16984438 CTGTTTCTTTGGGCAGGGGAGGG + Intergenic
903391985 1:22971161-22971183 CTGAGTCCATGGGCAGTGAATGG + Intergenic
904121414 1:28200642-28200664 CTAGCTCTTTGGAAAGTGAAAGG + Exonic
904702280 1:32364942-32364964 CTTTGCCTTTGGGATGAGAAAGG - Intergenic
905352496 1:37357302-37357324 CTGAGTCCTTGGAAAGTGATGGG - Intergenic
905359764 1:37411219-37411241 CTGTGTTTTTGGGAAATGAATGG - Intergenic
906718108 1:47985374-47985396 CTGAGTCAATGGGAAGTAAAGGG + Intronic
907739916 1:57155197-57155219 CTGTGTATATGGCAAGAGAAAGG + Intronic
907848958 1:58235860-58235882 CTCTCTCTTTGGGATGTCAATGG - Intronic
908591536 1:65641444-65641466 CTGTGACTTTGGGAACATAAAGG - Exonic
908598935 1:65718540-65718562 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
908869795 1:68596300-68596322 TTGTGTCTTTGGGAATAGGAAGG - Intergenic
909099313 1:71331574-71331596 CTGTGAATCTGTGAAGTGAAAGG + Intergenic
909278453 1:73719231-73719253 CTGTTTCCTTGGGAAATAAAGGG - Intergenic
910151529 1:84153068-84153090 CTGTGTCTTAGGGAATAGGAAGG + Intronic
910218816 1:84868640-84868662 TGGGGACTTTGGGAAGTGAATGG + Intronic
910547406 1:88433430-88433452 CAGTGTCTTTGGAAAGGGAAGGG + Intergenic
910658593 1:89644661-89644683 CTCTGTGGTTGGAAAGTGAAGGG + Intronic
910716338 1:90235696-90235718 CTATGTCTGTGGAAAGTGGAGGG - Intergenic
910858370 1:91719100-91719122 GTGAGTCTTTGGGAATTGGAAGG - Intronic
911946964 1:104123449-104123471 CTGTGGACTTGGGAAATGAAGGG - Intergenic
912434426 1:109650500-109650522 CTGGGTCTTTGTGCATTGAATGG - Intergenic
912540865 1:110414250-110414272 CAGTGTCGTGGGGAAGTTAATGG - Intergenic
914841102 1:151249388-151249410 CTGGGTCTTAGGGAAAGGAATGG + Intronic
915121033 1:153629630-153629652 CTGTGTGTTGGGGGAGAGAAAGG - Intronic
916280634 1:163047513-163047535 CTATGTCTTGGGGGTGTGAAAGG - Intergenic
917036736 1:170755952-170755974 CTGTGTCTTTCGGATCTTAAGGG - Intergenic
918578752 1:186099317-186099339 CTGTGTGTCTGGGAGGTGCAGGG + Intronic
918596791 1:186303560-186303582 TTGTATCTTTGGGAAGGGCAGGG + Intronic
918666170 1:187154223-187154245 CTGTGCCTTTGGAAAGGGGAGGG - Intergenic
919833538 1:201558373-201558395 CATTCTCTTTGGGAATTGAATGG + Intergenic
919987660 1:202687058-202687080 CTGTGAGTTTGTGAAGGGAAAGG + Intronic
923850207 1:237786101-237786123 CTCTGTCTTTGGGAGCTGCAAGG + Intronic
924127323 1:240868527-240868549 CTCCGTCTGTGGGAAGTGAGGGG - Intronic
1062786703 10:271029-271051 CTGTGTCTTTGGTATCTGATGGG + Intergenic
1064321358 10:14308282-14308304 AAATGACTTTGGGAAGTGAAGGG + Intronic
1066485337 10:35837773-35837795 CTCTGTGTTTAGAAAGTGAAGGG + Intergenic
1066671205 10:37842115-37842137 CTGTGTCTATGGGAGGTATATGG + Intronic
1066694970 10:38069244-38069266 CTCTGTCATTGGGCAGTGAGTGG - Intergenic
1066997540 10:42577935-42577957 CTGTGTCATTAGGCAGTGAGTGG + Intronic
1067306032 10:45064935-45064957 CTTTGTGTTTAGAAAGTGAAGGG + Intergenic
1068620661 10:59177296-59177318 CTGGGTCTCTGGGCACTGAAGGG + Intronic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1073272817 10:102280636-102280658 CTGTTTATTTTGGAAGTGACTGG - Intronic
1073969054 10:109026153-109026175 CAGGGCCTCTGGGAAGTGAATGG + Intergenic
1074037722 10:109757547-109757569 CTCTGTCTTTCCAAAGTGAAGGG - Intergenic
1074210705 10:111331561-111331583 CTGTGTCTCTGGGAATAGCAAGG - Intergenic
1074297945 10:112208515-112208537 AAGTGTCTTGGGGAAGTGAATGG + Intronic
1075514766 10:123100151-123100173 CTCTGGCTGTGGGAAGAGAAGGG - Intergenic
1075857291 10:125640662-125640684 CTGTGTGTTTGGGAAGTGTCAGG + Intronic
1076180090 10:128400319-128400341 GTGTGTTCTTGGGAAGTGATAGG - Intergenic
1076526147 10:131113407-131113429 CTGTGTCTGAGGGGAGGGAAGGG + Intronic
1076568245 10:131413305-131413327 CTGTGTCCACGGGAACTGAAGGG + Intergenic
1077138086 11:1011499-1011521 CTGTGTGGTCAGGAAGTGAAGGG + Exonic
1077694706 11:4383765-4383787 ATGCGTCTCTGGGAAGGGAAGGG - Intergenic
1078614312 11:12850857-12850879 CTGTGGCTTGGGGAAGTGGCAGG + Intronic
1078653928 11:13220718-13220740 CTGTGACTTGGGGAGGAGAAGGG - Intergenic
1078821341 11:14886114-14886136 CTGTGACTTTAGGCACTGAATGG - Intronic
1079020164 11:16903766-16903788 TTATGTCTTTTGGAATTGAATGG - Intronic
1079051015 11:17159658-17159680 CAGTCTCTTTGGGAAGCTAAAGG + Intronic
1079311787 11:19373047-19373069 CTGTGTCTGTGGGAATGGTATGG - Intronic
1079823165 11:25157587-25157609 CTGTGTGTTTTAGAAGTGAAAGG + Intergenic
1081371629 11:42311436-42311458 GGGTGTCTTTGGGCAGTGCAGGG + Intergenic
1083255375 11:61492086-61492108 GTGTGTCTTTGGGCAGGGAGAGG - Intergenic
1083731381 11:64654255-64654277 CTGGGGCTTTGGGAGGTGTATGG - Intronic
1085023212 11:73221877-73221899 GTGGGTCTTTGGGAAATGAGTGG + Intronic
1085362341 11:75901543-75901565 GTGTTTCTTAGTGAAGTGAATGG + Intronic
1085440469 11:76557896-76557918 GTGTTTCTTTGGGAAATTAAAGG - Intergenic
1085722027 11:78921026-78921048 CTGGGTCTCAGGGAAGTGAAGGG + Intronic
1086068817 11:82776243-82776265 CTCTGCCTTTGGGAAGAAAAGGG + Intergenic
1086864756 11:91966924-91966946 CTGTGTTTTTGTGAGGTGAAGGG + Intergenic
1087226043 11:95600455-95600477 ATCTGTCTCTGGGAACTGAAAGG + Intergenic
1087377620 11:97364930-97364952 CTGTCTCCTTGGGGAATGAAGGG - Intergenic
1088009873 11:104986728-104986750 CTCTGCCTGTGGGAAGGGAAGGG + Intergenic
1088091235 11:106042211-106042233 CTGTGTCTTTGAGAAGAAAAAGG - Intergenic
1088190847 11:107226504-107226526 GTGTGTGTTTTGGAAGTGAGAGG - Intergenic
1088409634 11:109520174-109520196 CTGGGCCTTTGGGAGGTGACTGG - Intergenic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089778812 11:120858497-120858519 CAGTGTGTTTGGGAAGTTCAGGG + Intronic
1089933155 11:122334759-122334781 CTGTGTCTTTTGTAAGTTAATGG - Intergenic
1090427167 11:126616027-126616049 CTGTGTCTATGTGAAGTGAACGG - Intronic
1090827600 11:130398736-130398758 CTGGGTCTTTGGGAAGGGAGGGG + Intergenic
1091711730 12:2745823-2745845 CAGTGGCTGTGGGAAGGGAAGGG - Intergenic
1091763539 12:3103650-3103672 CTGTGACTTTGGGAAGTGGCTGG + Intronic
1092045489 12:5429749-5429771 CTGTGTCTTTGTGGAGAGAGGGG - Intergenic
1092183729 12:6463406-6463428 CCCTGTCTTTGGCAAGTGCACGG + Intronic
1093025267 12:14239994-14240016 CTGTGGCTGTGGGAAGAGAATGG + Intergenic
1093991510 12:25593568-25593590 CTGTGTCTTTGGGAAGGCCTAGG - Intronic
1094303550 12:28993218-28993240 ATGAATCTTTGAGAAGTGAAGGG + Intergenic
1094337928 12:29381379-29381401 CTGTTTCTATGGGAAGGGAGGGG + Intergenic
1095244509 12:39903494-39903516 CTGTGTTTTTGGGAAGAGTGAGG + Intronic
1096770888 12:53935222-53935244 CTGTGTCTTTTTGAAGTCGAGGG - Intergenic
1097470254 12:59981671-59981693 CTGTGTCATTGCATAGTGAAAGG - Intergenic
1097703787 12:62846892-62846914 GTGTGTCTTGGGGAGGTTAATGG + Intronic
1097947764 12:65390942-65390964 CTTTGTCTTTGGCAAAAGAATGG + Intronic
1098093938 12:66934532-66934554 TTGTGTCTTTGGCATGTGAAGGG - Intergenic
1098744755 12:74221579-74221601 CTGTGTCTTTGAGATTTAAATGG + Intergenic
1099495371 12:83339935-83339957 CTCTGCCTTTGGTAAGTGGAGGG + Intergenic
1100834021 12:98548164-98548186 TTGTGTATTTGGGAAACGAAGGG + Intronic
1101226727 12:102694795-102694817 CTCTGCCTTTGGAAAGTGTAGGG + Intergenic
1102318008 12:111905389-111905411 CTCTGCCTTTGGAAAGGGAAAGG + Intergenic
1103338991 12:120211183-120211205 CTGTTTCTGTGGGAGGAGAAGGG - Exonic
1104725877 12:131075421-131075443 CTGTGGCTTTGGGAAGACAGAGG + Intronic
1105478904 13:20755235-20755257 CTGAGTCTGGGGGAAGTCAATGG + Intronic
1105619862 13:22056285-22056307 ATGTGTCTTTGGGGAGACAAAGG + Intergenic
1106625625 13:31418159-31418181 CAGGGTCTCTGGAAAGTGAAGGG + Intergenic
1106699558 13:32214610-32214632 GTGTTTATTTGGTAAGTGAATGG + Intronic
1107028662 13:35829084-35829106 ATGTGGCTTTGGGAAGTGAGTGG - Intronic
1107291319 13:38857539-38857561 ATGTGTCTTGGGGTTGTGAAGGG - Intronic
1107293321 13:38882086-38882108 CCTTGGCTTTGGGAGGTGAATGG - Exonic
1107673342 13:42769505-42769527 GTGGGTCTTTGGGAGGTGATTGG - Intergenic
1108680090 13:52772555-52772577 TAGTTTATTTGGGAAGTGAAGGG - Intergenic
1109364805 13:61340481-61340503 CTGTGACTTTGGCTTGTGAAAGG - Intergenic
1109522690 13:63533812-63533834 CTCTGCCTTTGGAAAGAGAAGGG - Intergenic
1110154361 13:72295671-72295693 CTGTGCCTTTAGGAATTAAATGG - Intergenic
1111256108 13:85670674-85670696 CTGTGTCCCTGGGAAGAGGATGG + Intergenic
1113795790 13:113057213-113057235 CTGTGTGTTTGGGTACTGAGTGG + Intronic
1113795992 13:113058790-113058812 CTGTGTATTTGGGCACTGAGTGG + Intronic
1114715334 14:24818339-24818361 CTGTGCCTTTTAGAAGGGAAAGG - Intronic
1115654599 14:35431221-35431243 CTAGCTCTTTGGAAAGTGAAAGG - Intergenic
1116405889 14:44566057-44566079 CCTTATCTTTGGGAAGTGTATGG - Intergenic
1117302286 14:54441400-54441422 CTGTGGCCGGGGGAAGTGAATGG - Exonic
1117998003 14:61496311-61496333 TTGAGGCTCTGGGAAGTGAAAGG + Intronic
1119104374 14:71910266-71910288 TTCTGTCTTTGGGAAGCAAAGGG - Intergenic
1121062127 14:90922154-90922176 CAGTGTCTCTGGAAAGTTAAAGG + Intronic
1121680751 14:95791004-95791026 CAGAGTCTGTAGGAAGTGAACGG - Intergenic
1121970036 14:98347605-98347627 ATTTGGCTTTGGGAACTGAATGG - Intergenic
1123435611 15:20251903-20251925 CTGTGACTTTGGGGAGTGGGCGG - Intergenic
1124081329 15:26501040-26501062 CTCTGCCTTTGGAAAGGGAAGGG - Intergenic
1125396020 15:39248811-39248833 CTAAGACTTTGGGAAGAGAAAGG + Intergenic
1126438496 15:48661762-48661784 CTGATTCTCTTGGAAGTGAAGGG - Intergenic
1127035246 15:54908712-54908734 CTGTGCCTTTGGAAAGAGGAGGG + Intergenic
1127882380 15:63169717-63169739 TTGTGTCATAGGGAAGTGGATGG - Intergenic
1127900272 15:63335964-63335986 CTGTGTCTTTGGGAAGTGAAAGG + Intronic
1128899984 15:71411802-71411824 CTGTGTGTCTGGGCAGTGCAAGG + Exonic
1131057252 15:89382855-89382877 CTATGTATTTGGAAACTGAAGGG + Intergenic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1132305014 15:100804800-100804822 CTGTGGCTTTGGGGCCTGAAGGG + Intergenic
1132838785 16:1968213-1968235 CTGAGTCTTGGGGAACTGGAAGG - Intronic
1133871308 16:9689078-9689100 CTGTGGCTGAGGGAAGAGAATGG - Intergenic
1135428189 16:22357998-22358020 CTGAATCTTGGAGAAGTGAAGGG - Intronic
1136364523 16:29803541-29803563 CTGTGACTGTGCGATGTGAAAGG - Exonic
1138630979 16:58293893-58293915 ATGTGTGTTTGGGAAGAGGATGG - Intronic
1138799026 16:60003126-60003148 CTGTCTCTTAAGGGAGTGAAAGG - Intergenic
1139164268 16:64547461-64547483 CAGTGGCTTTGCGAAGAGAAGGG - Intergenic
1140026680 16:71297261-71297283 CTGGGTGTTTGAGAAGAGAATGG + Intergenic
1141575239 16:84959252-84959274 CAGTGTGTTTGGGGGGTGAATGG + Intergenic
1141759593 16:86019175-86019197 CTGTGTCTTTGCGTGGTGGAAGG + Intergenic
1142989160 17:3717900-3717922 CCCTGGGTTTGGGAAGTGAAAGG + Intronic
1144118565 17:12126627-12126649 GTGGATCTTTGGGAAGTGATGGG - Intronic
1144572164 17:16407159-16407181 CTGTGACTTGGGGAAGGGAGTGG + Intergenic
1146171809 17:30640274-30640296 CTGCTTCTGTGGGATGTGAATGG + Intergenic
1146248922 17:31319701-31319723 CTGTGTCTTTCTGAAGGCAAAGG + Intronic
1146345264 17:32056299-32056321 CTGCTTCTGTGGGATGTGAATGG + Intergenic
1149427634 17:56570296-56570318 CTGTGGCTTTGGGCTGTGAGAGG - Intergenic
1149527738 17:57369864-57369886 CTGTGTCCCTGGGAAAGGAAGGG + Intronic
1150562805 17:66309367-66309389 TTGTATCTTGGGGAAGGGAAGGG + Intronic
1150599756 17:66640653-66640675 CGGTGTGTTTGTGAAGTGAACGG - Intronic
1150856540 17:68758558-68758580 CTGTGTGCTTAGGAAGGGAAGGG + Intergenic
1151185889 17:72363649-72363671 CTGTTTCTGTGGGGAGGGAAGGG - Intergenic
1151973689 17:77472041-77472063 GTGGCTCTTTAGGAAGTGAATGG + Intronic
1153486571 18:5604817-5604839 CTGTGGCTTTGGGAAATTAGGGG - Intronic
1153943466 18:9996856-9996878 GTGTGTCTTTGGGAAGAGATGGG - Intergenic
1154063272 18:11083469-11083491 CTGTGGCTTGGGGAAATGGAGGG + Intronic
1155110699 18:22711279-22711301 CTGTGACTTGGGAAAGGGAAGGG - Intergenic
1155388960 18:25312869-25312891 CTTTGTCTTTGGTAACTGCATGG + Intronic
1156370619 18:36468667-36468689 TTGTGGCTTTGAGATGTGAAGGG + Intronic
1156382266 18:36574024-36574046 CTGAGGCTCTGAGAAGTGAAGGG - Intronic
1159502235 18:69288526-69288548 CTGGGTATTTGGGAGGAGAAGGG + Intergenic
1160925081 19:1540415-1540437 CTCTGTTTCTGGGAAGTGACAGG + Intergenic
1160990399 19:1858018-1858040 CTTTGGCTTTGGGAAGTCAGGGG - Intronic
1161007437 19:1943629-1943651 CTGTGTCTTTTGGAACTGGTGGG + Intronic
1161570038 19:5025488-5025510 CTCTGGCTGTGGGAAGTGGATGG - Intronic
1162045026 19:7993410-7993432 CTGTGTCTTTGGGAATAAACAGG - Intronic
1165209765 19:34224771-34224793 CTGTATATTTGGTAAATGAATGG - Intronic
1166197724 19:41218020-41218042 CTGTGTGTTTGGCACGTGGAGGG - Intergenic
1166516709 19:43452610-43452632 CAGTGTCATTGGAATGTGAAAGG + Intergenic
1168125736 19:54281575-54281597 CTGAGGCTTTGGGACGTGAGAGG + Intergenic
925047081 2:780685-780707 CGGGGCCCTTGGGAAGTGAAGGG + Intergenic
925291133 2:2749450-2749472 CTGAGTGCTTGGGAAGTGACTGG + Intergenic
925713022 2:6759786-6759808 GTGTGTCTGTGGGGTGTGAAGGG + Intergenic
926144407 2:10387950-10387972 CTGTGTGTTCGGCAGGTGAATGG + Intronic
926790356 2:16565086-16565108 TTGTGTGTTTGAGAAGAGAATGG + Intronic
927060569 2:19415595-19415617 TTGTGTGTGTGTGAAGTGAATGG + Intergenic
927741515 2:25573501-25573523 CTGACTCTTGGGGCAGTGAAAGG - Intronic
928084616 2:28338025-28338047 CTTTGTCTTTATGAAGTCAAAGG + Intronic
928700220 2:33891450-33891472 CTATGTCTTTAGGATATGAATGG - Intergenic
928753986 2:34502047-34502069 CTGTTTCTCTGGGAAAAGAATGG + Intergenic
931061810 2:58537800-58537822 ATGTGATTTTGGGAAGTGACTGG - Intergenic
931262212 2:60630255-60630277 CCTTGTCTTTGGGAAGGGAGAGG + Intergenic
931295877 2:60925029-60925051 CAATGTCTTTGGGAAATAAAAGG - Exonic
931412301 2:62044756-62044778 CTGTTTCTTTGGTAGGTGAAGGG - Intronic
931785295 2:65612533-65612555 GTGTGTATTTGGGAATGGAAGGG + Intergenic
932013310 2:67999762-67999784 TGGGGTCTTTGGGAAGTGAATGG - Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934660879 2:96143082-96143104 CTTGGGGTTTGGGAAGTGAATGG - Intergenic
934847219 2:97669608-97669630 CTGTGTCTGTGGACAGTGACGGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936242520 2:110800296-110800318 CTGTGTCTTTGGCCTGTAAATGG + Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937666819 2:124497229-124497251 AGGTGTCTTTGGGTAGTGAAAGG + Intronic
937782112 2:125850419-125850441 CTGTACCATTAGGAAGTGAAGGG - Intergenic
938405833 2:131032650-131032672 CTGTGGCTTTGGGAGGACAAAGG - Intronic
939443146 2:142275664-142275686 CTGTGCCTTTGGAAAGGGGAAGG - Intergenic
939715290 2:145576330-145576352 ATGTGACTTTGAAAAGTGAATGG + Intergenic
940411599 2:153370634-153370656 CTTTGGCTTTGGGAAGAGCAGGG - Intergenic
940560396 2:155288065-155288087 CTCTGTCTTTGGAAAGGGGAAGG + Intergenic
940906009 2:159170602-159170624 CTGTGTTTGTGGGAAGGGATTGG + Exonic
941320434 2:164047959-164047981 CTTTGACTTTGGGAACTGAAAGG - Intergenic
941513594 2:166444454-166444476 CTGTATATTTGGGAAGGGAGGGG + Intronic
942058513 2:172206923-172206945 TGGGGTCTTTGGGAAGTGAATGG - Intergenic
942086497 2:172449058-172449080 TTGTGTGCCTGGGAAGTGAAAGG + Intronic
942549950 2:177104765-177104787 CTGGCACTTTGGGAAGTGAGAGG - Intergenic
942754571 2:179324874-179324896 CTTTGCCTTTGGGAACAGAAGGG + Intergenic
943056493 2:182988096-182988118 CTGTGTCTTGGAGAGGTTAAAGG - Intronic
943118898 2:183709967-183709989 CTCTGCCTTTGGAAAGGGAAGGG - Intergenic
944340512 2:198591396-198591418 CTGAGTTTTTGGGCAGTAAATGG + Intergenic
944568635 2:201019377-201019399 CTGTGTTTTTTGTAAGCGAATGG + Intronic
944925189 2:204456970-204456992 CTGTCTCTTGGGGAAGAAAAGGG - Intergenic
945074071 2:206020117-206020139 CTGTCTCTTTGTGAAGAAAAGGG - Intronic
947061761 2:226174641-226174663 CTTTGTTTTTGAAAAGTGAATGG + Intergenic
947193517 2:227537081-227537103 CTCTTTCTTAGTGAAGTGAATGG + Intronic
947436900 2:230080623-230080645 CTGTGTTCTTGGGCAGGGAAGGG - Intergenic
948158244 2:235801770-235801792 CTGTGTCTTTGTTAAGGGAGTGG + Intronic
1169194356 20:3675223-3675245 GTGTGTCTTAGGGAAGGGACAGG + Intronic
1169692015 20:8342745-8342767 CTCTTTCTTTGGGAAGTAATAGG - Intronic
1170428462 20:16257941-16257963 GTGTGTGTTTGGGATGGGAAAGG - Intergenic
1170428486 20:16258068-16258090 GTGTGTGTTTGGGAAGTGGAAGG - Intergenic
1170428585 20:16258487-16258509 GTGTGTATTTGGGATGTGGAAGG - Intergenic
1170428622 20:16258615-16258637 TTGTGTATTTGGGATGGGAAAGG - Intergenic
1170428642 20:16258693-16258715 GTGTGTCTTTGGGATGGGAAGGG - Intergenic
1170428651 20:16258744-16258766 GTGTGTGTTTGGGATGGGAAGGG - Intergenic
1170428713 20:16258973-16258995 GTGTGTGTTTGGGATGGGAAGGG - Intergenic
1170812440 20:19685085-19685107 CTTTGTCTCTGGAAAGAGAAAGG - Exonic
1171091518 20:22289932-22289954 ATGTGTATTTGTTAAGTGAATGG + Intergenic
1173114614 20:40228862-40228884 CTGTGTATTTGGGGAAGGAATGG + Intergenic
1174184979 20:48699980-48700002 CTGGGGGTTTGGGAGGTGAATGG - Intronic
1174421612 20:50402654-50402676 CTATGTCTTTGTAAAGTGCATGG - Intergenic
1174438516 20:50529685-50529707 CTGGATCTTTGTGAAATGAATGG + Intronic
1174955100 20:55089172-55089194 CTGTGACTTTGGGAATTTGAGGG - Intergenic
1175072261 20:56344395-56344417 CTGAGGCTTGGGGAAGTTAAGGG - Intergenic
1175885629 20:62288786-62288808 CTGAGGCTTTGGCAGGTGAAGGG + Intronic
1176028985 20:63001631-63001653 CTGTCTCTTTAAGAAATGAAAGG + Intergenic
1178530793 21:33373808-33373830 CTATCTCTTTGGAAAATGAAGGG + Intergenic
1179251041 21:39671701-39671723 CTATGTCTCTGGGATATGAAAGG + Exonic
1181460755 22:23084708-23084730 CTGGGCCTTGGGGTAGTGAAGGG - Intronic
1181462785 22:23095232-23095254 CTCTGTGTTTGGCAGGTGAAGGG + Exonic
1184741030 22:46429176-46429198 CTGGGTGTTTGGGAAGTGTGGGG - Intronic
1184854474 22:47138908-47138930 CGGGGTCTTTGGGAAGTGATTGG - Intronic
1185111750 22:48904053-48904075 CTGGGCCTTTGGGAGGTGACAGG - Intergenic
949188851 3:1226532-1226554 CTGTGTCTTTGAGGAGGAAAAGG - Intronic
950193645 3:10994137-10994159 CTGTGTCTTTGGGAACTTTGGGG + Intronic
950500319 3:13359557-13359579 CCATTTCTTTGGGACGTGAAGGG - Intronic
951102370 3:18703660-18703682 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
951149172 3:19266992-19267014 CTGTTTGTATGGGAAGTGACCGG + Intronic
951204426 3:19910360-19910382 CTCTGTCTTTGGGAGGGGGAGGG + Intronic
951681194 3:25296357-25296379 CTATGTCCATGGGAAATGAAAGG + Intronic
951990326 3:28669510-28669532 CTGTGTCTTTCTGTAGTTAAGGG + Intergenic
952203080 3:31151373-31151395 CTCTGTCTTTGGAAAGGGGAGGG - Intergenic
952415374 3:33085518-33085540 CTGTGTCTTTGGGTATTGCTAGG - Intronic
953408395 3:42672159-42672181 CAGTGTCTTTGCAAGGTGAAAGG - Intergenic
953439712 3:42906914-42906936 CTGGGTCTGTGAGTAGTGAATGG + Intronic
953961009 3:47265672-47265694 CTGTGTCTTTGGGGAGGGACAGG - Intronic
954291238 3:49651087-49651109 TAGGGTCTCTGGGAAGTGAATGG - Intronic
955058652 3:55477523-55477545 CTGGGTCGATGGGAAGTGGATGG - Intronic
955402409 3:58602098-58602120 CTGTGGCTTAGGGCAGGGAAGGG + Intronic
956843503 3:73161074-73161096 CTGGGTCTATGGGAAATGGAGGG + Intergenic
957362615 3:79178701-79178723 GTGTGTCTTTGGAGAATGAAAGG - Intronic
959496859 3:107061676-107061698 CAGAGCCTTTGGGAAGTGATTGG + Intergenic
959726785 3:109552346-109552368 CTGTGTCTTCTGTATGTGAATGG - Intergenic
959798075 3:110456876-110456898 CTCTGTCTTTGGAAAGGGGAAGG - Intergenic
960747539 3:120907250-120907272 CGATGTCTTTGCGAAATGAATGG - Intergenic
961882398 3:130071300-130071322 CTGTGTCTTTCGGAAGACAGAGG - Intergenic
962429804 3:135308545-135308567 CTGTGTGTCTGGGATGAGAATGG - Intergenic
962453847 3:135547200-135547222 CTGTGGCTCTGGCAAGGGAAGGG - Intergenic
962573615 3:136735883-136735905 CTAGCTCTTTGGAAAGTGAAAGG + Intronic
962698953 3:137978674-137978696 CTCTGCCTTTGGAAAGGGAAGGG - Intergenic
962994423 3:140611408-140611430 CCCTGTCTTTGGAAGGTGAATGG - Intergenic
963009569 3:140756453-140756475 CTGTGTCTTTGGTGTGTGACAGG + Intergenic
964884934 3:161471288-161471310 TTGTGCCTTTGGGAAGTCAAAGG + Intergenic
964903776 3:161693212-161693234 TTGTCTCTTTGGGAAGTATAAGG - Intergenic
965041021 3:163507117-163507139 ATGAGTCTTTGGGAAGACAAAGG + Intergenic
965093073 3:164186138-164186160 GTGTGTGCTTGGGAAGTGATTGG + Intergenic
965118273 3:164519835-164519857 CTTTGCCTTTGGAAAGCGAAGGG - Intergenic
965419882 3:168445236-168445258 CTGTGTCCTTGGGAAAATAATGG + Intergenic
965505447 3:169510220-169510242 CTCTGTGATTGGGATGTGAAGGG + Intronic
966974052 3:185069742-185069764 CTGTGTGTGTGGGAAGTCAGAGG + Intergenic
967245423 3:187481946-187481968 CTGTGTGTTGTGGAAGTGAGAGG + Intergenic
967376695 3:188811703-188811725 CTGAGGCTTAGGGAAGGGAAGGG + Intronic
967693429 3:192503909-192503931 CCATGTCTTTGCAAAGTGAACGG - Intronic
967884104 3:194321799-194321821 GGGTGTGTTTGGGAAGTGACTGG + Intergenic
968650570 4:1758781-1758803 CAGTGGCTTTGGGACGTGCAGGG - Intergenic
969449704 4:7266036-7266058 CTGAGTCTTGTGGAAGTGCAGGG - Intronic
969557278 4:7920663-7920685 CAGTTTCTTTGGTAAGAGAAAGG - Intronic
969703031 4:8778056-8778078 CAGTGTGATTGGAAAGTGAATGG + Intergenic
969759113 4:9169819-9169841 CAGTGGCTTTGGGAGGTGCAGGG - Intergenic
969828447 4:9776637-9776659 CTGTGTCTTTGTACAGTCAAAGG + Intronic
969920209 4:10531241-10531263 CTTTGTCTTTGGGCACTGAAGGG + Intronic
969963672 4:10972671-10972693 CTGGGTCTGTGGGAAGGCAATGG - Intergenic
970886680 4:20994413-20994435 CTTTGTCTTTGAGAAGGAAAGGG + Intronic
973968041 4:56183786-56183808 CTGTGCCATGTGGAAGTGAAAGG + Intronic
974058623 4:57009577-57009599 CTGTGACATTGGGAAGGGAGGGG + Intronic
974718423 4:65702490-65702512 CTGTGTCTGAGAGAAGTGCAGGG + Intergenic
975166394 4:71182614-71182636 CTGCCTCCTTGGGAATTGAATGG - Intergenic
975207982 4:71666079-71666101 GTGTGTGTTTGGGAAGGGACAGG + Intergenic
975252762 4:72198463-72198485 CTCTGCCTTTGGAAAGAGAAGGG + Intergenic
976254143 4:83083224-83083246 CTCTGCATTTGGGAAGGGAAAGG - Intergenic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
980113599 4:128658329-128658351 GTGTGTGTTGGGGAAGTCAAGGG + Intergenic
980622467 4:135325975-135325997 CTATAGGTTTGGGAAGTGAAGGG + Intergenic
981526555 4:145712148-145712170 TTGTGTCTTAGGGAAGTGGGGGG - Intronic
982683319 4:158458903-158458925 CTCTGTCTTTGGAAAGTGGAGGG - Intronic
984719791 4:182958976-182958998 CACTGTCTTAGGGAAGAGAAGGG + Intergenic
984895272 4:184533529-184533551 CAGTGTCCTTGGGAAGTGGCCGG + Intergenic
986756376 5:10840130-10840152 CTCTGCCTTTGGAAAGTGGAGGG + Intergenic
986784881 5:11105089-11105111 CAGTGACTTTGGGAAGGGACAGG - Intronic
986864126 5:11965136-11965158 CTGTGTTTTTAGGAAAAGAAGGG + Intergenic
986989047 5:13530419-13530441 GTTTCTCTTTGGGAATTGAATGG + Intergenic
987591336 5:19931536-19931558 CTGTGTCTCTGAGAAGTTAAAGG - Intronic
988222174 5:28361923-28361945 CTGTGTGTTTGATGAGTGAAGGG + Intergenic
988906904 5:35799560-35799582 CGGTCTCTGTGGGGAGTGAAAGG - Intronic
989422925 5:41260984-41261006 CAATGTCTTTGTGAAGTCAATGG - Intronic
989504781 5:42215236-42215258 CTCTGCCTTTGGAAAGTGGAGGG - Intergenic
991195215 5:63924165-63924187 CTGTGTCCTTGGGAAGTAACTGG + Intergenic
991642768 5:68771111-68771133 CTGTGACTTTGGGAAAGAAAAGG + Intergenic
993105080 5:83591274-83591296 CTGTGAATTTCTGAAGTGAATGG + Intergenic
994132821 5:96250078-96250100 ATTTATGTTTGGGAAGTGAAGGG - Intergenic
995271754 5:110227891-110227913 CTCTGTCTTGGGGAGGTGTAAGG - Intergenic
997759829 5:136434305-136434327 ATGTGTCCTTTGGAAGTGATTGG - Intergenic
997969687 5:138391077-138391099 CTTTGACTTTTGGAAGTGGAAGG + Exonic
998084338 5:139304601-139304623 CTTTCTTTTTTGGAAGTGAAGGG + Intronic
998900053 5:146843616-146843638 CTGAGGGTTTGAGAAGTGAAGGG - Intronic
999037568 5:148370035-148370057 CTGCATCTTGGGGAAGTCAAAGG + Intergenic
999284178 5:150384201-150384223 CTGTGCCATTGGAAAGTGAGAGG - Intronic
999309569 5:150543247-150543269 CTGAGTCTTGGGGAGGAGAAGGG + Intronic
1000925174 5:167185205-167185227 CTGAATCTTTGGGGAGAGAAGGG + Intergenic
1001205362 5:169757117-169757139 CTGAGTCTTTAGGGAGAGAATGG + Intronic
1001254428 5:170172471-170172493 CTGAGGCTTGGAGAAGTGAAGGG - Intergenic
1002049847 5:176564486-176564508 CCTTGTCTTTGGGCATTGAAAGG + Intronic
1002365005 5:178703021-178703043 GTGTGTCTTTGGCATGGGAAAGG - Intergenic
1002804883 6:563381-563403 CTGTGTAAATGGGAAGGGAATGG - Intronic
1003088218 6:3078460-3078482 CTGTGTCTTAGGAATGTGATTGG + Intronic
1004282733 6:14294659-14294681 CTGTGCCTGTGGGAAGTAGAGGG - Intergenic
1005031426 6:21512539-21512561 CTGTGGCTCAGGGAGGTGAAAGG - Intergenic
1005343888 6:24870482-24870504 CTGCATCTTTGAGAAGTCAATGG - Intronic
1005404399 6:25470729-25470751 CTGTGTCTTTACTAAGTGGAAGG + Intronic
1005437401 6:25829441-25829463 CAGTATCATAGGGAAGTGAATGG + Intronic
1006738298 6:36290825-36290847 CTGAGTCTGTGGGCAGGGAAGGG - Intronic
1007418417 6:41705525-41705547 CTGTGTCGTTGGGAAGAGGGTGG - Intronic
1009380556 6:63023535-63023557 CTGAGTCTTTGGGAAACCAATGG + Intergenic
1009687748 6:66986229-66986251 CTCTGCCTTTGGGAAGGGGAGGG - Intergenic
1013973982 6:116055881-116055903 TTATGTCTTTGAGAAGTGTATGG + Intronic
1014483026 6:121962092-121962114 ATGTTTCTGTGGGAATTGAATGG + Intergenic
1014681248 6:124433143-124433165 CTGTGTCTTCTGAGAGTGAATGG - Intronic
1014708399 6:124776543-124776565 GTATGTGTTTGGGAGGTGAAAGG + Intronic
1014865194 6:126520994-126521016 CTCTGCCTTTGGAAAGTGGATGG - Intergenic
1015581959 6:134735024-134735046 CTGTTTATTTGGGAAAGGAAAGG - Intergenic
1016154052 6:140781213-140781235 CTCTGTCTTTGGAAAGGGAAGGG + Intergenic
1016438204 6:144059200-144059222 CTGTGGCTTTGGGGAGTGCAAGG - Intronic
1016753894 6:147662214-147662236 CTGTGTCATTGAGAAGTATAAGG - Intronic
1018115340 6:160578321-160578343 CAGTGTCTTTAGGAAGGGCACGG - Intronic
1018127157 6:160692665-160692687 CTGTGTCTTTGTTAGGTAAAGGG - Intergenic
1018242383 6:161790509-161790531 CGGGGTCTTTAGGAAGTGAATGG + Intronic
1018261072 6:161971192-161971214 CTGTGTATCTGGGAAGTAAGTGG + Intronic
1019310358 7:357448-357470 CTGTGACTGTGGGAAGCAAATGG + Intergenic
1019316180 7:387992-388014 CAGGGTGTTTTGGAAGTGAACGG - Intergenic
1021663165 7:22942403-22942425 CTGTGGCTTCAGGAAGGGAAGGG + Exonic
1022244536 7:28545818-28545840 CTGTGTGTGTGTGAAGTGAATGG + Intronic
1022508209 7:30919988-30920010 CTGAGTCCTTGGGAAGGGGAGGG - Intronic
1023909162 7:44541489-44541511 CGGTCGCTTTGGGAAGTGAGTGG - Intergenic
1023929210 7:44694783-44694805 CAGTGTTTTGGGGAAGGGAAGGG + Intronic
1024410897 7:49039631-49039653 CTATGCCTTTGGAAAGGGAAAGG + Intergenic
1025635533 7:63316886-63316908 CCGTGTCTTGGGGGAGTCAACGG - Intergenic
1025647162 7:63431284-63431306 CCGTGTCTTGGGGGAGTCAACGG + Intergenic
1026129842 7:67611155-67611177 TTCTGTCTTTGGGAACTGCAAGG + Intergenic
1026430686 7:70344164-70344186 CTGGGTTTTTGTGCAGTGAATGG + Intronic
1026590338 7:71689186-71689208 CTGTGTCTCGGGGAATAGAAAGG - Intronic
1028696779 7:93723125-93723147 GTGTGACTTTAGGAATTGAAAGG - Intronic
1030198989 7:106882945-106882967 CTATGTCTTTGTTGAGTGAAGGG - Intronic
1031992540 7:128207619-128207641 TTGTGACTTTGGGAGGTGGAGGG + Intergenic
1032851964 7:135802799-135802821 CTGTGATTTTGGGCAATGAATGG - Intergenic
1033517468 7:142122449-142122471 CTGTATCTTTGGGTATAGAATGG - Intronic
1033974467 7:147082913-147082935 GTGTGTCTGTGAGAACTGAAAGG - Intronic
1034385530 7:150737734-150737756 CAGAGACTTTGGGAATTGAAAGG + Intronic
1034573095 7:151972991-151973013 CTGTGTCTTTTCCAAGTGCATGG - Intronic
1035109189 7:156466262-156466284 CTGGATGTTTGGGAAGAGAATGG + Intergenic
1035232607 7:157475336-157475358 CTGTGTCTGTGGGGAGAGACTGG + Intergenic
1035901038 8:3458982-3459004 CTGGGCCTTGGGGAAGGGAAGGG + Intronic
1037034180 8:14144889-14144911 GTTTGTCTTTGGAAAGGGAAGGG + Intronic
1039189254 8:34953414-34953436 CTGTGTCTTGGGGAAGGGATGGG - Intergenic
1041797920 8:61765932-61765954 CAGTGTCTTTGGGCATGGAAAGG + Intergenic
1042878058 8:73457892-73457914 CTGGGTCTTGTGGAGGTGAATGG + Intronic
1043565948 8:81547906-81547928 CTGAGGCTTAGAGAAGTGAAAGG + Intergenic
1043627045 8:82274093-82274115 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1044275521 8:90295253-90295275 CTGTGTCTTAGGGATGTGTTAGG + Intergenic
1044355454 8:91217434-91217456 TTGTGTCTTTTGGGAGTAAAGGG + Intronic
1044468899 8:92541998-92542020 CTGTGTCTATAGGGACTGAAAGG - Intergenic
1044981089 8:97717518-97717540 CTAGCTCTTTGGAAAGTGAAAGG - Intronic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1047120702 8:121901220-121901242 ATGTGTGCTTGGGAAATGAAAGG - Intergenic
1047937931 8:129800106-129800128 CTCTGTCTATGGAAAGAGAAGGG - Intergenic
1048024719 8:130575599-130575621 CTGTGGCTTTGGCAACTGCAAGG + Intergenic
1048230687 8:132637704-132637726 CTGTGTGTTTTGGATGAGAAAGG + Intronic
1048623042 8:136155659-136155681 CTGTGTCTTCTGGCAGAGAATGG - Intergenic
1049315924 8:141967505-141967527 CTAGCTCTTTGGAAAGTGAAAGG + Intergenic
1050807101 9:9694705-9694727 CTCTTCCTTTGGTAAGTGAAGGG - Intronic
1050867168 9:10516745-10516767 CTGTGTCTTTTGTAAGATAAGGG + Intronic
1053104567 9:35398836-35398858 GTGTGTGTTTGGGGAGGGAAAGG + Intronic
1054805014 9:69389241-69389263 CTGTGTCTTTGGGCATTAAATGG + Intronic
1055768706 9:79692806-79692828 CTGTGCCTTTAAGAAGTGATTGG - Intronic
1057216028 9:93229341-93229363 CTGTGTGTTTGTGAAAAGAATGG - Intronic
1058193117 9:101942256-101942278 ATATGTCTTTGGGACATGAAGGG - Intergenic
1059926742 9:119217293-119217315 TTGTGTCTTTGGGAACTGTGGGG - Intronic
1060449579 9:123724078-123724100 CAGTGTCTTTGAGAAGGGAAGGG - Intronic
1060535415 9:124382753-124382775 ATGTGATTTTGGGAAGTAAAGGG - Intronic
1060697877 9:125724767-125724789 CTGAGGCTTAGGGAAGTGAAGGG + Intergenic
1060846225 9:126839584-126839606 CTTTGTGTTTGGGAACAGAACGG + Intergenic
1061799953 9:133108445-133108467 CTGTGTCTTTGGAAAGGCACAGG - Intronic
1062139254 9:134946502-134946524 GTGTGTCTGTCTGAAGTGAATGG - Intergenic
1062139281 9:134947009-134947031 CTGTGTCTGTCTGAAGTGAATGG - Intergenic
1186334122 X:8568245-8568267 ATGTGTCGATGTGAAGTGAAGGG + Exonic
1187196233 X:17087467-17087489 CGGTGTCTTTGGGAAGTCTTAGG + Intronic
1187321650 X:18244272-18244294 TTGTGTCTTTGTTAAGTTAAAGG - Intronic
1187491049 X:19751719-19751741 CAGTGCTTTTGGGAAGGGAATGG - Intronic
1188089756 X:25949874-25949896 TTGTCTCTTTGTGTAGTGAATGG - Intergenic
1188881891 X:35499634-35499656 CTCTGTCCTTGGGCAGTGGATGG - Intergenic
1189344768 X:40232599-40232621 CTGAGTCTTTGGGAGGGGAGAGG + Intergenic
1190477164 X:50839861-50839883 ATGTGTCTTTGGGAAGACAGAGG + Intergenic
1191059279 X:56277887-56277909 CTCTGGCTGTGGAAAGTGAAGGG - Intronic
1191170854 X:57445728-57445750 CTGTGGCTTTGGGAAAGGAGTGG - Intronic
1191693534 X:63964935-63964957 CAATGTCTCTGGGGAGTGAAAGG + Intergenic
1192672932 X:73165726-73165748 CTGTGTCAGTGGGCTGTGAAAGG - Intergenic
1193078725 X:77383058-77383080 CTTTGTCTTTGGAAAGGGGAAGG + Intergenic
1193664645 X:84300490-84300512 CTGTGCCTTTGGAAAGGGGAGGG + Intergenic
1193673604 X:84419443-84419465 CTTTGTCTTTGGAAAGAAAATGG + Intronic
1193980839 X:88180454-88180476 CTCTGCATTTGGAAAGTGAAGGG - Intergenic
1194112691 X:89854468-89854490 CTCTGCCTTTGGAAAGAGAAAGG + Intergenic
1194389233 X:93295226-93295248 CTCTGTCTTTGGAAAGGGAAGGG + Intergenic
1195543754 X:106092011-106092033 TTGTGACTTTGAGAAGTGCAAGG + Intergenic
1196399495 X:115299528-115299550 CTCTGCCTTTGGAAAGGGAAGGG - Intronic
1196760502 X:119196802-119196824 TGGGGTCTTTGGGAGGTGAATGG - Intergenic
1197449490 X:126594287-126594309 CTCTGCCTTTGGGAAGGGGAGGG - Intergenic
1197548391 X:127856504-127856526 CTCTGTCCTTGGCTAGTGAATGG - Intergenic
1198791786 X:140354349-140354371 CTGTGTCTGTGGGGAGTGGGGGG - Intergenic
1200465344 Y:3509279-3509301 CTCTGCCTTTGGAAAGAGAAAGG + Intergenic
1201675703 Y:16581332-16581354 CTGTGGCTTTATGAATTGAAGGG + Intergenic