ID: 1127900586

View in Genome Browser
Species Human (GRCh38)
Location 15:63338229-63338251
Sequence TTGTGCTTATGCAAGCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127900583_1127900586 16 Left 1127900583 15:63338190-63338212 CCAAGCTATTAAGTTTTGTTCAA 0: 1
1: 0
2: 0
3: 20
4: 240
Right 1127900586 15:63338229-63338251 TTGTGCTTATGCAAGCTCCAAGG 0: 1
1: 0
2: 0
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127900586 Original CRISPR TTGTGCTTATGCAAGCTCCA AGG Intronic
902576042 1:17378268-17378290 ATGTGCTCATGTAAGCTCTAAGG + Intronic
903764385 1:25724473-25724495 TTGTCCTTTTGCCACCTCCATGG - Intronic
914852382 1:151324646-151324668 ATCTGCTTATACCAGCTCCATGG - Intronic
916659248 1:166906075-166906097 TTGCGCTTATTCAACCTGCATGG + Intergenic
918244626 1:182648140-182648162 TTGTGGATGTGCAGGCTCCACGG - Exonic
920014419 1:202894957-202894979 TTGTGTTTTTGCAAACTCCTAGG - Intronic
920394446 1:205633883-205633905 TTCTGTTTGTGCAAACTCCATGG + Intergenic
921889139 1:220336349-220336371 TGGTGCTTCTTCAACCTCCAAGG + Intergenic
922039987 1:221887213-221887235 TTGTGCCTCTGCCAGGTCCATGG - Intergenic
1065705942 10:28471692-28471714 CTGTGCTTATGTAAAGTCCAGGG + Intergenic
1067808352 10:49408555-49408577 GTGCTCTCATGCAAGCTCCACGG + Intergenic
1068212731 10:53942390-53942412 ATGTGCTTATGCATGTACCATGG - Intronic
1068213157 10:53948672-53948694 TTGTGCTTCCACAATCTCCATGG - Intronic
1072454726 10:95565721-95565743 TTATGCTACTGCCAGCTCCAGGG - Intergenic
1075332799 10:121585225-121585247 TTGGGCTTTTGCAAGTCCCATGG - Intronic
1078373767 11:10775378-10775400 TTGTGCTTGAGAAAGCTGCAAGG - Intronic
1078810072 11:14751128-14751150 TGGTGATTATGCAAGCTGCCTGG + Intronic
1079545497 11:21627761-21627783 GTGTGCTCACTCAAGCTCCATGG - Intergenic
1079565596 11:21878377-21878399 TGATGCTTATTCAAGATCCAAGG - Intergenic
1080305068 11:30826926-30826948 TGGTGCTCAGGCAAGCTGCAGGG - Intergenic
1080763486 11:35275016-35275038 TTCTGATGATGCAATCTCCAGGG - Intronic
1080786310 11:35478232-35478254 TTGGGCTTTGGCCAGCTCCAGGG + Intronic
1085250649 11:75141430-75141452 CTGTGCATATGCAGGCGCCAGGG + Intronic
1088699231 11:112397304-112397326 TTCTGCTAATGCAAGCTTTAGGG - Intergenic
1088994361 11:114983760-114983782 TTGTGATTATTCAAGGTGCAAGG - Intergenic
1094869763 12:34588227-34588249 ATGTGCTTGTGGAATCTCCAAGG - Intergenic
1096405391 12:51340322-51340344 GTTTGCTCCTGCAAGCTCCATGG + Intronic
1097285610 12:57874868-57874890 TTGTGGTTATGCAAGTGCAAAGG + Intergenic
1097984368 12:65768148-65768170 TTTTGCCCATGCAAGGTCCATGG - Intergenic
1102096535 12:110245814-110245836 TTGTCCTTATGAAAGTTCCTCGG + Intergenic
1103838353 12:123842171-123842193 TTGTGTTTTTGCAAGCTCTCAGG + Intronic
1106309539 13:28542251-28542273 TTGTGCTTTAGCAAGCTCCCCGG + Intergenic
1109961666 13:69639385-69639407 TTCTGATTATGCAAGGCCCAAGG + Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1111686866 13:91513008-91513030 TTGTTATTATTTAAGCTCCAGGG + Intronic
1112033161 13:95475271-95475293 CTGTGATTATGGAAGCTCCCTGG + Intronic
1112853345 13:103734199-103734221 TTGTGCTTATTCAAGGTGCAAGG - Intergenic
1113593685 13:111517549-111517571 TTGTGCTGATGCAAACCACATGG + Intergenic
1114705739 14:24725200-24725222 TTGTGCATATGGAAGCTCCTAGG + Intergenic
1120999837 14:90443665-90443687 TTCTGCTTAAGCAGTCTCCAGGG - Intergenic
1122965421 14:105121990-105122012 TTGGACTTCTGCAACCTCCAAGG + Intergenic
1124806352 15:32887344-32887366 TTGGAGTTATACAAGCTCCAAGG + Intronic
1126223883 15:46246743-46246765 CTGACCTTATGCAAGCTGCAAGG - Intergenic
1127900586 15:63338229-63338251 TTGTGCTTATGCAAGCTCCAAGG + Intronic
1131501188 15:92968200-92968222 TTTTGCTGATTCTAGCTCCATGG + Intronic
1139156839 16:64453699-64453721 TTGTGCTTATTGTACCTCCAAGG - Intergenic
1140956384 16:79870337-79870359 TTCTGATGATGCAAGCACCATGG + Intergenic
1143891678 17:10107081-10107103 TGGTCCTTCTGGAAGCTCCAAGG - Intronic
1147886561 17:43688234-43688256 CAGTGCTTCTGCAGGCTCCAGGG + Intergenic
1153069819 18:1092269-1092291 TAGGGCTTAGACAAGCTCCATGG + Intergenic
1160720199 19:593878-593900 TTGGCCTTATGCAACCCCCAGGG + Intronic
1162235315 19:9304415-9304437 TTGTGCTTATGCAGTCTCCTGGG - Intronic
926643999 2:15268920-15268942 TTGTGCTTGTGCTACTTCCAGGG - Intronic
933665075 2:84958247-84958269 TTGTGCTGATTCAAGCTCTTTGG + Intergenic
934462137 2:94218052-94218074 TTATGCTTAGTAAAGCTCCATGG + Intergenic
934721443 2:96579788-96579810 GTGTGCTTATGTAGGCTGCAGGG + Intergenic
940485200 2:154288773-154288795 TTGTGATTTTGCAAGGTACAGGG + Intronic
943317425 2:186407557-186407579 TAGTCCTTACTCAAGCTCCAAGG - Intergenic
943974765 2:194459936-194459958 TTGTATTTTTGCAAGCTCGAAGG - Intergenic
945813907 2:214580476-214580498 TTGTGTTTCTTAAAGCTCCATGG + Intergenic
946596553 2:221311589-221311611 TTGTGATTATATAAGCTTCAGGG - Intergenic
1168953174 20:1816653-1816675 TGGGGCTTATCCAAGCTCCGTGG + Intergenic
1175850844 20:62091666-62091688 TTGTCCTTATGCAAACATCATGG - Intergenic
1179120300 21:38538782-38538804 TGGTTCTTGTTCAAGCTCCATGG + Intronic
1181116634 22:20635786-20635808 TGGTGCTTTTGCAGGCCCCATGG - Intergenic
1182013434 22:27019758-27019780 TTTTCCTTCTGCAAACTCCAAGG - Intergenic
1182304106 22:29356179-29356201 CTGGGCTTCTGCCAGCTCCAAGG + Intronic
949942844 3:9167886-9167908 TTCTGCTTCTGCATGCACCATGG - Intronic
950773393 3:15330279-15330301 TTTTCATTATGGAAGCTCCATGG - Intronic
950873067 3:16245834-16245856 AAGTGTTTCTGCAAGCTCCAGGG + Intergenic
953776823 3:45825935-45825957 TTGTACTTATGCATTCCCCATGG - Exonic
955910864 3:63859031-63859053 TGGCTCTTATGTAAGCTCCATGG + Intronic
958986591 3:100786591-100786613 TTTTACTTATGCAACTTCCAAGG + Intronic
960330771 3:116357848-116357870 TTTTCCTTATGTAAGCCCCAGGG - Intronic
961453892 3:127014974-127014996 CTGTGCCTAGGCCAGCTCCAGGG + Intronic
965819588 3:172672045-172672067 TTCTACTCCTGCAAGCTCCACGG + Intronic
966110646 3:176397145-176397167 TTGCTCTTATGGAATCTCCAGGG - Intergenic
971695430 4:29896236-29896258 TTGAGTCTATGCAAGTTCCAAGG - Intergenic
981141772 4:141277665-141277687 TTGGTCTTATGCTAGCTCTAGGG - Intergenic
982087925 4:151855046-151855068 TTGTTGTTATACAAGCTCTAAGG - Intergenic
986135649 5:4975141-4975163 CTGTGGATATGCAAGCTCCTGGG - Intergenic
987805603 5:22761445-22761467 TTGTGATTATGAAAACTCCTGGG - Intronic
987940431 5:24528623-24528645 TGGTGCTTTTGCAATATCCAAGG - Intronic
990414876 5:55576492-55576514 TTGTTCTTATGCAAGTTCTGGGG + Intergenic
991455362 5:66797764-66797786 TTTTGGTTAGGCAAGCTTCAAGG + Intronic
991536943 5:67679647-67679669 TGGACCTTATGCATGCTCCAGGG + Intergenic
991648124 5:68821871-68821893 TTGCTATTATGAAAGCTCCAAGG + Intergenic
1001731544 5:173964234-173964256 TTTTGCTTATTGAACCTCCAGGG + Intergenic
1011658554 6:89574426-89574448 TAGTGCTTATGGAAACTCTAAGG - Intronic
1015139417 6:129912818-129912840 TTGTGCTTATGAACGTTACAAGG - Intergenic
1015690941 6:135922068-135922090 TTGACCTTATGCAATCTCTAAGG - Intronic
1018635722 6:165857558-165857580 GTGGGCTTATGCAACCTCAAAGG - Intronic
1019944643 7:4317258-4317280 TGGTGCTTCTGCAATCTCCTGGG - Intergenic
1020633112 7:10664435-10664457 TTGTGCTTATATCAGCTCCATGG - Intergenic
1022873475 7:34503880-34503902 TTGTGGTTCTGCAGGCTGCATGG + Intergenic
1022969898 7:35507385-35507407 GTTTGCTTCTGAAAGCTCCAGGG + Intergenic
1031657870 7:124380433-124380455 TGATGCTTATTCAAGGTCCAAGG - Intergenic
1031753901 7:125613212-125613234 TTATGCTTACTCAAGGTCCAAGG - Intergenic
1034386005 7:150741852-150741874 TGGTGTTTAGGCCAGCTCCATGG - Intronic
1039667300 8:39547736-39547758 TTGTGCTGATGAAAGCACTATGG + Intergenic
1041487164 8:58392087-58392109 TTGGGCCTCTGAAAGCTCCATGG + Intergenic
1045374274 8:101555882-101555904 TGGTACTTAGGCAAGCTCAAAGG + Intronic
1046034433 8:108823397-108823419 TTGTGCATAGTCAGGCTCCATGG - Intergenic
1050768135 9:9162155-9162177 TTTTTCTTATGCATGCACCACGG + Intronic
1051111683 9:13645707-13645729 ATGTGCCTATGCAAGCTAGATGG - Intergenic
1054712630 9:68526374-68526396 TGGTGCTTATGCAAGCTGAAGGG - Intronic
1059334320 9:113559241-113559263 CTGTGCTTGTGCCAGCTCCAGGG - Intronic
1059371562 9:113843831-113843853 TTATGGTTCTGCAAGCTTCAAGG + Intergenic
1187781081 X:22825696-22825718 TTGTGCTTAGCCAGGCACCATGG - Intergenic
1191985980 X:66981964-66981986 TTTTGATTTTGCAAGCTCCTAGG - Intergenic
1192144498 X:68672542-68672564 CTGAGCTTGTGAAAGCTCCATGG + Intronic
1194804581 X:98311628-98311650 TTGTGAATATGTAGGCTCCATGG + Intergenic
1196220282 X:113105840-113105862 TTGTGAGTATGGAAGCTCCTAGG + Intergenic
1201349517 Y:13024008-13024030 TTGAGCTGATTCAAGCTCAAAGG + Intergenic