ID: 1127901257

View in Genome Browser
Species Human (GRCh38)
Location 15:63342614-63342636
Sequence AAAAGGGAGGAGGGTATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 2, 2: 11, 3: 41, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127901246_1127901257 25 Left 1127901246 15:63342566-63342588 CCTAAGGTCTGTGTTGATGTTAA 0: 6
1: 4
2: 14
3: 22
4: 178
Right 1127901257 15:63342614-63342636 AAAAGGGAGGAGGGTATAATGGG 0: 1
1: 2
2: 11
3: 41
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127901257 Original CRISPR AAAAGGGAGGAGGGTATAAT GGG Intronic
900434291 1:2620936-2620958 CAATGGGAAGAGGGTATAATGGG - Intronic
902097837 1:13961093-13961115 AAAAGGGAGGTGGGAAAAAGGGG - Intergenic
902978576 1:20107307-20107329 AAAACGAAGGTGGGTATGATTGG - Intergenic
903680635 1:25094199-25094221 AAAAGGGAGGAGGAAATACTTGG + Intergenic
905010569 1:34744249-34744271 AAAAGGGAAGAGGCCATAAAAGG + Intronic
905181320 1:36168770-36168792 ACAAGGCAGGAGGGTATAATGGG + Intronic
905266163 1:36755657-36755679 AAAAGGGATGAGGGAATAAAGGG - Intergenic
907634122 1:56116458-56116480 AAAGAGGAGGAGAGTATGATTGG + Intergenic
907841472 1:58162009-58162031 AGAAGGGAGGAGGTAACAATAGG + Intronic
907971220 1:59383544-59383566 AAAAGGGAGGACTGTATAAGGGG - Intronic
908505833 1:64799075-64799097 AGAAGGGAGAAGGGGATGATAGG - Intronic
909759737 1:79272010-79272032 AAGGGGGAGAAGGGTATGATGGG + Intergenic
909943454 1:81636508-81636530 AAAAGGGAGGAAACTCTAATGGG + Intronic
910086719 1:83411619-83411641 AAAAAGGAGGAAGGTGAAATGGG + Intergenic
911011410 1:93284891-93284913 AAAAGGGAGCAAGGAATAACTGG + Intergenic
911474124 1:98355464-98355486 AAAAGGGAGGAAATTATAAGTGG - Intergenic
912897198 1:113604817-113604839 AGAAGGGAGGAGGGTCGGATGGG + Intronic
913074914 1:115333949-115333971 AGAGGGTAGGAGGGTATTATAGG - Intronic
913281079 1:117185576-117185598 AAAAGAGAGGAGGATATAATGGG - Intronic
913432772 1:118813629-118813651 AGAAGGGAGGAGGGGGTAAATGG - Intergenic
914833292 1:151186632-151186654 AAGAGGGAGGAAGGAATCATGGG + Intronic
914843386 1:151266273-151266295 AAAGAGGAGCAGGGTAGAATTGG - Intronic
915863948 1:159477982-159478004 AAAAGGGAGGAAGCGAGAATAGG - Intergenic
917010993 1:170470682-170470704 AAAAGTGAGGAGGGAAGAAGGGG + Intergenic
917134335 1:171774725-171774747 AACAGGAAGGAGGGGAAAATAGG + Intergenic
917168872 1:172146537-172146559 AAAAGGGAGGTGAGTCTTATGGG - Intronic
917475480 1:175365747-175365769 AAAAGAGAGGTGGGTAGAAAAGG - Intronic
919041562 1:192394903-192394925 AATAGGGAGTAGGATAAAATGGG + Intergenic
920025090 1:202988366-202988388 AAAAGGAAGGAGGGTTGAAAAGG - Intergenic
920902498 1:210125209-210125231 AAAAGGGGGGAGGGTGGGATGGG - Intronic
921778181 1:219127167-219127189 AACAGAGGGGAGGGTATTATTGG - Intergenic
923657481 1:235930689-235930711 CAAAGGGAGGAGGGTAAATGGGG + Intergenic
924267235 1:242295280-242295302 AAAAGGGAGGAGAGGAGAAGAGG - Intronic
1065245612 10:23753995-23754017 AACAGGGAGGAGGGGACATTGGG - Intronic
1065481187 10:26195471-26195493 CAATGGGAGGATAGTATAATTGG - Intronic
1066018897 10:31276809-31276831 AAAAGGGAGGAGGAGGTGATAGG + Intergenic
1066083123 10:31952108-31952130 AAAAGGAAGGAAAGTATACTTGG + Intergenic
1066363256 10:34751596-34751618 AAAAGAGAGAAAGGTTTAATTGG - Intronic
1066688327 10:38002231-38002253 AAAAGGGGGGAGGGTGGAAAGGG + Intergenic
1066717587 10:38303226-38303248 AAAAGGGAGGAGAGGAGAAGAGG + Intergenic
1068174796 10:53444455-53444477 AAAAGGGAGGAGGGAAAAACAGG + Intergenic
1068761489 10:60715564-60715586 GACAGGCAGGAGGGTATATTTGG + Intronic
1068840784 10:61611655-61611677 AAAAGGGACGGGGGGAAAATTGG + Intergenic
1068858342 10:61820735-61820757 AAAAGGGAGGAGGGAAAGTTTGG - Intergenic
1069160287 10:65084286-65084308 AGAATGGAGGAGGGCATGATTGG + Intergenic
1069493205 10:68879282-68879304 AAATGAGAGGAGGGAAAAATGGG - Intronic
1069793238 10:71036606-71036628 AGAAGGGAGGAGGGTATTCCTGG + Intergenic
1070509484 10:77147489-77147511 GAAAGGGATGAGGGAAGAATGGG - Intronic
1072095208 10:92171561-92171583 CAAAGGAAGGGGGGTAGAATAGG + Intronic
1072285979 10:93915593-93915615 AAAAGGGAGGAGGTTGAATTTGG - Intronic
1072369325 10:94747782-94747804 AAAAGGGAGGAGGGCAAATCAGG + Intronic
1073308126 10:102519173-102519195 CAATGGCAGGAGGGTAAAATGGG + Intronic
1073541621 10:104319860-104319882 CAGAGGGAGGAGGGTATAATGGG - Intronic
1073659478 10:105458508-105458530 AAAAGGGAGAAGGGTTAACTAGG - Intergenic
1075229645 10:120664528-120664550 AGAATGGAGGGAGGTATAATTGG + Intergenic
1075581149 10:123619549-123619571 AAAAGGGAGGAGGGGAGAAGGGG + Intergenic
1077346626 11:2061113-2061135 AAAATGGAGAAGGGTATAAGGGG - Intergenic
1077381485 11:2242134-2242156 AAAAGTGAGGAGGGAAGAAATGG + Intergenic
1078267082 11:9763288-9763310 AAAGGGGAGGTGGGTATGGTGGG + Intergenic
1078332963 11:10441034-10441056 AAGAAGGAGGAGGGTGGAATGGG + Intronic
1079411696 11:20193662-20193684 AAAAGGGAGATGGGGTTAATAGG - Intergenic
1079482805 11:20899643-20899665 AATAATGAGTAGGGTATAATAGG + Intronic
1079891074 11:26053918-26053940 CAAAAGGAGGAGAGTATAAGAGG + Intergenic
1081472374 11:43387459-43387481 AAAAGTGTGGAGGGAATAATTGG + Intronic
1082231476 11:49773258-49773280 AAAAGGGAAGAGGGTAGGAAGGG - Intergenic
1082763512 11:57148604-57148626 AAAATGGAGGAGGGAAAAGTGGG + Intergenic
1084742698 11:71149898-71149920 AAAAGGGAGGAAGGTAAGAAGGG + Intronic
1084789087 11:71462177-71462199 AAAAGGGAGGAGGGTAAATGAGG - Intronic
1085251370 11:75146019-75146041 AAAAGGGAGGAGGATAAACGAGG - Intronic
1086272021 11:85079351-85079373 CAAGAGGAGGAGGATATAATGGG + Intronic
1086272495 11:85083858-85083880 TAAGGGGAGGAAGGTATAATGGG + Intronic
1086487923 11:87328202-87328224 AAGAGAGAGAAGGATATAATGGG - Intergenic
1087737430 11:101850783-101850805 AAAAGGGTGGAGGGGCAAATGGG + Intronic
1088395585 11:109364418-109364440 AAAAGGTAGGATGGTGTAAGAGG - Intergenic
1089699150 11:120234061-120234083 AGAAGGGAAGAGGGTAAAAGCGG + Intergenic
1090289837 11:125533164-125533186 GAAAGGGAGGGGAGTATACTAGG + Intergenic
1091154429 11:133360619-133360641 AGAAGGGAGGAGGGAAGAAGGGG + Intronic
1091488142 12:909237-909259 AAAAGGGAGGAGGGCAGGGTAGG - Exonic
1092041538 12:5389468-5389490 GAAAGGGAGGAGGCTTTAAAGGG - Intergenic
1093300325 12:17445607-17445629 ATAAGGTAGGAGGGGAAAATAGG + Intergenic
1093552556 12:20432295-20432317 AAAAGTGAAGAGGGTGAAATGGG + Intronic
1095942296 12:47735230-47735252 CAAAGGGAGGAGGGGCTCATGGG - Intronic
1096057658 12:48668203-48668225 AAAAGGTGGGAAGGTAGAATAGG - Intronic
1097928751 12:65160787-65160809 AAAACGAAGGAAGGTAAAATGGG - Intergenic
1098646817 12:72912333-72912355 AAAGTGGAAGAGGGGATAATGGG - Intergenic
1098666189 12:73166104-73166126 AAAAGGAATGAGGATATAACAGG + Intergenic
1098750716 12:74291083-74291105 AAAAGGGAAGGGTGTATAATTGG + Intergenic
1099570473 12:84311065-84311087 AAAAGAGAAGATAGTATAATAGG + Intergenic
1100925308 12:99539351-99539373 ATAAGGGAGGAGGAAATATTGGG + Intronic
1101406906 12:104436788-104436810 AAAAGGAAGGAAAGTATACTTGG + Intergenic
1102676911 12:114665392-114665414 AAAAGAGAGGAGGGTTTTGTGGG - Intergenic
1103468757 12:121162956-121162978 AAAAGGGGTGAGGGTAAAAGAGG + Intronic
1103953812 12:124566108-124566130 AGAGGGGAGGAGGGGATAAGGGG - Intronic
1104914011 12:132255179-132255201 CAAAGGGAGGAGAGTCTAAGGGG - Intronic
1105031729 12:132888662-132888684 CAAAGGGAGGACAGTATAATGGG - Intronic
1105683445 13:22752805-22752827 AAAAGGGGGGGGGGTATCTTGGG - Intergenic
1107213288 13:37884978-37885000 AAAAGGACAGAGGGTACAATGGG + Intergenic
1107794319 13:44034384-44034406 AAAAGGGAAGAGGGTAAAAGAGG + Intergenic
1107947020 13:45428163-45428185 AAATTGGAGAAGGGTATAAATGG - Intergenic
1108231362 13:48345850-48345872 TAAAGGGAGAAGGGTAAAAGAGG + Intronic
1109010188 13:56930638-56930660 AGAAGGGAGGAGGGGTTAAGTGG + Intergenic
1109442876 13:62398049-62398071 CAAAGGAAGGAGGGTATAATGGG - Intergenic
1110883264 13:80599841-80599863 AAATGGGTAGTGGGTATAATGGG + Intergenic
1113097830 13:106684658-106684680 AAAAGAGAAGAGGGTATTTTTGG + Intergenic
1113183408 13:107658272-107658294 AAGAGAGAGGAGAGAATAATTGG - Intronic
1114241809 14:20874931-20874953 AAAAGGCAGGAGGGGAGAACTGG - Intergenic
1114754501 14:25244355-25244377 GAAAGTGAGGAGGGGAAAATGGG + Intergenic
1114868533 14:26628110-26628132 AAAGGGAAGGAGGGTCAAATAGG + Intergenic
1115060075 14:29176868-29176890 CAAAGGGAGGCGTATATAATGGG - Intergenic
1115917837 14:38336896-38336918 AACACGGAGGAGGGTATAATGGG - Intergenic
1116348696 14:43830484-43830506 AAAATGGAGGAGGGTGTGAAAGG + Intergenic
1118380427 14:65213544-65213566 CACAGGGAGGAGGGTATAATGGG + Intergenic
1119448734 14:74689418-74689440 AAAAGGAAGGAGGATATTCTAGG - Intronic
1121426192 14:93853849-93853871 AGAAGGGAAGAAGGGATAATGGG + Intergenic
1121686918 14:95842563-95842585 AAAAGGAAGGAGGGAAGAATTGG - Intergenic
1121870801 14:97405016-97405038 ACATGGGAGGAGGCTAGAATGGG - Intergenic
1122166047 14:99824768-99824790 AAAAGGGTGGAGGGTAGGAGGGG - Intronic
1122360843 14:101162052-101162074 CAAAGGGAGAAGAGTATAATGGG + Intergenic
1124866115 15:33492990-33493012 CAGAGGGAGGAGGGTGTAAGTGG + Intronic
1124888490 15:33709857-33709879 AAAAGGTAGGTGGTTATAATGGG + Intronic
1127901257 15:63342614-63342636 AAAAGGGAGGAGGGTATAATGGG + Intronic
1131767635 15:95697337-95697359 AAGAAGGTGGAGGGTATAATGGG - Intergenic
1132997914 16:2832905-2832927 CAAAGGGAGGAGGGGATTACAGG + Intronic
1133520111 16:6549078-6549100 AAAAGGGAGGAGGGAAGAGGAGG + Intronic
1133568627 16:7019890-7019912 AAAAGAGAGCAGGGTTTAGTTGG - Intronic
1135394728 16:22122479-22122501 AAATGGAAGGAAGGAATAATAGG + Intronic
1137935371 16:52630163-52630185 AGAGGGGAGGAGGGAACAATAGG + Intergenic
1138163714 16:54780056-54780078 AAGAGGGAGGAGGAAAGAATAGG - Intergenic
1138215478 16:55201438-55201460 AAAAGGGAGGAAGGGAGGATAGG - Intergenic
1138393741 16:56688992-56689014 CAAAGGGAGGTGGGTATCACTGG - Intronic
1139019372 16:62728395-62728417 AAAAGGGTGGTGGGAAGAATGGG + Intergenic
1139255888 16:65542231-65542253 ATAAGGGAGGAAGGTAAGATGGG + Intergenic
1140270631 16:73463536-73463558 AAACGGCAGGAGGGTATAAAGGG - Intergenic
1140855717 16:78975943-78975965 AAAAGGCAGGAGGGTATCAGGGG - Intronic
1141263178 16:82472175-82472197 GAAAAGGATGAGGGTATTATGGG - Intergenic
1141359342 16:83380861-83380883 AAAAGAGAAGAGTGTATATTAGG + Intronic
1144010166 17:11140175-11140197 AAACTGGAGGAGGGAATAAAGGG + Intergenic
1144150347 17:12437076-12437098 CAAAGGGATGAGGGTAGATTAGG - Intergenic
1144536991 17:16100085-16100107 AAAAAGGAGTGGGGTTTAATTGG + Intronic
1146407584 17:32552522-32552544 AAAAGGAAGGAGGGCAAAAAAGG - Intronic
1146602255 17:34227963-34227985 GAAAGAGAGAAGGGCATAATGGG - Intergenic
1146829401 17:36055137-36055159 TATAGTGAGGAGGGAATAATGGG + Intergenic
1147302830 17:39543508-39543530 TGAAGGGAGGAGGGCATCATTGG + Intronic
1147923569 17:43933210-43933232 AGAAGGGAGGGAGGTAGAATGGG - Intergenic
1149013290 17:51880195-51880217 TAAAGGGAGGAGGGAACTATGGG - Intronic
1149100569 17:52901533-52901555 AAATGGGAGAAGAGTATCATGGG - Intergenic
1150159444 17:62883298-62883320 AAAAATGAGGAGGGTACAACAGG + Intergenic
1153852126 18:9104713-9104735 AAAAGGGGGGAGGGTGGAAGGGG - Intronic
1154962767 18:21326837-21326859 AAAAAGGAGGAGGGAACAACAGG - Intronic
1155125601 18:22872337-22872359 ATAAGGGAGGAGTGTGCAATTGG + Intronic
1155238094 18:23841576-23841598 AAAAGGGACAAGGGTATAATAGG + Intronic
1156498636 18:37542993-37543015 AAAATGGAGGTGGGTGTGATGGG - Intronic
1156644594 18:39145880-39145902 AAAAAGGGAGAGGGTATACTAGG + Intergenic
1156875416 18:42004666-42004688 AGAAGGGAAGAGGATATACTAGG + Intronic
1159677701 18:71306226-71306248 CCAAGGGAGGAGAGTATAATGGG + Intergenic
1160543737 18:79639294-79639316 CAGAGGGAGGAGGGTAGAATGGG - Intergenic
1161847278 19:6718998-6719020 AAAAGGGAGGGGCTTATAAGGGG + Intronic
1162426265 19:10598213-10598235 AAAAGGGAAGAGTGGATAAGGGG - Intergenic
1162432191 19:10635755-10635777 AAAAGGAAGTAGGGAAAAATGGG - Intronic
1162604074 19:11693824-11693846 AAAAGGGAGGCAAATATAATGGG + Intergenic
1163198472 19:15743424-15743446 AAAAAGGAGGTTGGTAAAATAGG + Intergenic
1164188736 19:22896345-22896367 AAAAGGGAGGAGGGTGGGAGGGG - Intergenic
1164483593 19:28635428-28635450 AAAAGGAAGGAGGGTGGAAGGGG + Intergenic
1166011338 19:39944906-39944928 AAAAAGGAAGAGGGTACAGTGGG + Intergenic
1167004423 19:46766465-46766487 AAAAGAGAAAAGGGTAGAATAGG + Intronic
1167501387 19:49850806-49850828 AGAGGGGAGGACGGAATAATGGG - Intronic
1168405345 19:56107674-56107696 AAAAGGGAGGGGGGTCTAGGGGG + Intronic
1168481897 19:56727142-56727164 TCAAGGGAGGAGTGGATAATGGG - Intergenic
1168675601 19:58275799-58275821 AAAAGGAAAGAGGAAATAATAGG + Intronic
925807100 2:7661219-7661241 AAAGGGGAGCAGGGAAAAATAGG + Intergenic
927352039 2:22126860-22126882 AAAAGGAAGGAAGGTACACTTGG - Intergenic
929413448 2:41723115-41723137 TAGAGGGAGGAGTGTAGAATTGG + Intergenic
931177587 2:59869617-59869639 AAAAAGGAGGAGAGTATACAAGG - Intergenic
931653427 2:64489048-64489070 AAAAGGGAGGGGTATCTAATAGG - Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
931785001 2:65610625-65610647 AGAAGGCAGGAGGGTATCTTGGG + Intergenic
931912248 2:66913212-66913234 TAAAGGCAGGTGGGTATAACTGG - Intergenic
932140133 2:69268902-69268924 AAAAGGTAGGAAGGTAGAAGGGG - Intergenic
932744290 2:74319208-74319230 AAAAGGTAGGAGGGTAGGAAGGG + Intronic
932781534 2:74561589-74561611 AGAAGGGAGAAGGGAATAAAAGG - Intronic
933402976 2:81822213-81822235 AGAAGGGAGGAGGGCAAAAAAGG - Intergenic
933675782 2:85056291-85056313 AAATGGGGGGTGGGGATAATGGG - Exonic
935112971 2:100108642-100108664 AAAAGGAGGGAGGGTAGAAAGGG + Intronic
936481195 2:112886366-112886388 AAAAGGGAGAAGGGTATACTGGG - Intergenic
937745277 2:125404806-125404828 AGCAGGGAGCAGGGTATGATGGG - Intergenic
938263451 2:129910833-129910855 CAAAGGAAGGAGGGTATATGTGG - Intergenic
938693180 2:133811280-133811302 AAAAGAAAGGAGGTTAAAATGGG + Intergenic
938826818 2:135013848-135013870 AAGAGAGAGGAGGGAATCATTGG - Intronic
939166533 2:138646758-138646780 AATTGGGAGGAGGGTAAATTTGG + Intergenic
939195023 2:138961235-138961257 AAAAGGAAGGAAAGTATACTTGG + Intergenic
939338027 2:140856073-140856095 GAAAGAGAGGTGGGTATATTTGG - Intronic
939662849 2:144911783-144911805 AAAAGGTGGGAGGGTAGAAGGGG - Intergenic
939902832 2:147870725-147870747 AAAAGGGAAGAAGGAAAAATGGG - Intronic
940448346 2:153805645-153805667 AAAAGCGAGGTGGGGATTATAGG + Intergenic
941234747 2:162957119-162957141 AAGCTGGAGGAGGGTATAGTAGG - Intergenic
941584781 2:167343994-167344016 AAAAGGGAGAAGGGAGTATTGGG + Intergenic
941663041 2:168215245-168215267 AAATGGGGGGAGAGTATGATTGG - Intronic
942443198 2:176057529-176057551 ATATGGGAGGAGGGGATAAAGGG - Intergenic
942643885 2:178090460-178090482 AAAAGGCAGGCGGGTAGAAATGG - Intronic
943040320 2:182796737-182796759 GAAAGGGAGGGGGGCATAAAAGG + Intergenic
943657247 2:190522602-190522624 AAAAGGGAGGAGGGCATAATGGG - Intronic
944084972 2:195835412-195835434 AAAAGGTAGGGGGATATAACAGG + Intronic
945800046 2:214417606-214417628 AGGAGGGAGATGGGTATAATTGG + Intronic
946560445 2:220906436-220906458 AACAGTCAGGAGGGTATGATGGG + Intergenic
947831803 2:233146661-233146683 ACAAGGGAGGAGTGTCTCATTGG + Intronic
1169129307 20:3156546-3156568 AAAGGGGAGAAAGGTATACTTGG - Intronic
1169650700 20:7864067-7864089 AAAAGGGAGGAGGGAAAAAGGGG + Intergenic
1169898149 20:10526088-10526110 TGAAGGAAGGAGGGTATGATGGG - Intronic
1171494435 20:25545578-25545600 TAAAGGGAGGAGGGCATAATGGG - Intronic
1172823288 20:37758046-37758068 AAAAGAGAGGAGGGAAGAAAGGG - Intronic
1173185427 20:40836618-40836640 AAAAGTGAGAAGGGGATGATGGG - Intergenic
1173945198 20:46944745-46944767 AAAAGGGAGAAGAGTGTAAAAGG + Intronic
1175743716 20:61438537-61438559 AAATGGCATGTGGGTATAATTGG + Intronic
1177215234 21:18119513-18119535 ACAAAGGAAGAGGGTACAATTGG + Intronic
1177442710 21:21148044-21148066 AAATGGGAGGAAGGTAGGATTGG - Intronic
1178036491 21:28589157-28589179 AGGAGAGAGGAGGGTTTAATTGG + Intergenic
1178085167 21:29105035-29105057 AAAAGGGAAGAAGGTCTCATTGG + Intronic
1178274653 21:31226140-31226162 GAAAGGGAGGAGGGGAGAGTGGG - Intronic
1179171840 21:38979131-38979153 AAAAGAGAAGAGAGTCTAATGGG - Intergenic
1180320991 22:11321299-11321321 AAAGGGCAGGAGTGGATAATAGG - Intergenic
1180334052 22:11559446-11559468 AAAGGGCAGGAGTGGATAATAGG + Intergenic
1184159879 22:42691897-42691919 AAAAAGGAGGAGGGAAAAACAGG + Intergenic
949741786 3:7242962-7242984 AAAAAGGAGAAAGCTATAATAGG - Intronic
951207174 3:19936914-19936936 AAAAGTGAGAAGGATATACTAGG + Intronic
952973547 3:38673162-38673184 AAAAGGGAGGAGGCTGCAGTGGG - Intergenic
953576385 3:44116186-44116208 AAAAGGGAGGAGGGTAGGGAAGG - Intergenic
954017224 3:47704120-47704142 AAAAGGAAGGAGAGTACACTTGG + Intronic
957135286 3:76280046-76280068 AAAAGGAATGGGGATATAATAGG - Intronic
957305651 3:78455626-78455648 AGAAGGGAAGAGGGAAAAATGGG - Intergenic
957690525 3:83559930-83559952 AAAAGGGAGAAGGGCAAAAAGGG + Intergenic
958039736 3:88212425-88212447 AAATGGGAGGAGGGGATAGTAGG + Intergenic
958439863 3:94143132-94143154 AGAAAGGAAGAGGATATAATAGG + Intergenic
959779316 3:110209308-110209330 AAAAGGGAGGATATTATAAGAGG + Intergenic
960146242 3:114206831-114206853 GAATGGGAGAAGGGAATAATGGG - Intergenic
961021522 3:123511526-123511548 AAAAGGGAATAGAGAATAATAGG + Intronic
962378645 3:134879116-134879138 AAAGGGGAGGAGGGTTTCCTGGG - Intronic
963415044 3:144984333-144984355 AAAAGGGAGGAGGGTGAGAGGGG - Intergenic
964384668 3:156134939-156134961 AAGAGGCAGGATGGTATATTTGG + Intronic
965129548 3:164679128-164679150 AAAAGGGATGAGAATATATTTGG + Intergenic
965287636 3:166837650-166837672 AAACATGAGGAGAGTATAATGGG + Intergenic
966265055 3:178030373-178030395 AAAATGGATGAGGTTATAAATGG + Intergenic
967441490 3:189514231-189514253 AAAAGGGGGGAGTGTTTAATTGG + Intergenic
967520519 3:190427034-190427056 AAACTGGATGAGGGTTTAATGGG - Intergenic
970537664 4:17045691-17045713 ACAAGGGAGGAAGGTATTACTGG + Intergenic
970607798 4:17696861-17696883 AAAAGGGTGGAGGGCAGAGTTGG + Intronic
971086245 4:23278948-23278970 AAAAGGGAGGAGGATGAAAGGGG + Intergenic
972003443 4:34068035-34068057 AAAAGGAAGGAAGGTATACTTGG - Intergenic
972293429 4:37713642-37713664 CAAAGGGAGGTGAGTATAATGGG + Intergenic
973738964 4:53901531-53901553 AAAAGGAAGGAGGGAGTAAGAGG + Intronic
973902803 4:55495087-55495109 AAAAGAATGGAGGGCATAATGGG - Intronic
974699887 4:65427627-65427649 AAAAGGGAAGAGGGAAAAATAGG + Intronic
976559478 4:86485128-86485150 AAAAGGGAGGTGGGGGTAACAGG - Intronic
976632186 4:87250305-87250327 AGAAGGGAGGAGGCTTTAATAGG - Intergenic
976720720 4:88166377-88166399 AAAAGGGAGGAGGAGAGAAAGGG - Intronic
977256222 4:94743165-94743187 AAAAGGGAGGAGGAAATTACAGG + Intergenic
977575998 4:98674660-98674682 AAAGGAGAGGAGGGTATTTTAGG - Intergenic
978198971 4:106002701-106002723 GGAAGGGAGGATGCTATAATTGG + Intronic
981361580 4:143852039-143852061 AAGAGGGGGGAGGGTAGAAGAGG - Intergenic
981809289 4:148755212-148755234 GAAAGGGAGGAGGGGAGAAGAGG - Intergenic
982718230 4:158831174-158831196 AAGAGGGAGGAGGTCATCATTGG + Intronic
984583000 4:181532236-181532258 TAAATGGAGGAGGGCAAAATTGG + Intergenic
987955988 5:24740656-24740678 AAAAGGGAGAATTGTTTAATGGG - Intergenic
988737716 5:34039336-34039358 AAAAGGAAGGCAGGTATACTTGG - Intronic
989334954 5:40305152-40305174 AAAAGGGAAGCAGGAATAATTGG + Intergenic
989568854 5:42926636-42926658 AAAAGAGAGGAGAATATTATGGG + Intergenic
990014622 5:51044628-51044650 GAAAGAGAGGAGGGTAGATTGGG + Intergenic
990052926 5:51530462-51530484 AAAAGTGAGTAGGGCATAGTTGG - Intergenic
991525969 5:67558039-67558061 AAAACTGAGTAGGGTATAGTGGG - Intergenic
991618341 5:68519299-68519321 AGGAGGGAGGAGGGTATGATAGG - Intergenic
992459784 5:76949797-76949819 GATTGGGAGGAGGGTAAAATGGG + Intergenic
992745873 5:79819770-79819792 ATAAGGGAAGAGGGGAGAATGGG + Intergenic
993176580 5:84494395-84494417 AAAGGGGAGGAGGGAAGAAAGGG - Intergenic
993730884 5:91421351-91421373 AAAAGGAAGGAGGGTAGGACGGG - Intergenic
993955615 5:94228889-94228911 AAATGGGAGGAGAGTATTAAAGG + Intronic
995157965 5:108938249-108938271 AAAAGGAAGGAGATTATAATAGG + Intronic
995540251 5:113178793-113178815 AGAAGGCAGGAGGGTAGGATAGG - Intronic
997121397 5:131176717-131176739 AAAAGGGAGGAGGATAGGAAGGG - Intronic
998980904 5:147701167-147701189 GAAAGGGAAGAGGGTATCCTGGG + Intronic
1000341179 5:160278460-160278482 AGAGGGGAGGAGGGAAGAATAGG + Intronic
1000470707 5:161637699-161637721 AAAAGGGGAGAGTGTAAAATAGG - Intronic
1001924085 5:175623568-175623590 AAATGAGAGGAGGGTTTTATGGG - Intergenic
1003732338 6:8839364-8839386 AAATGGGATTAGAGTATAATGGG - Intergenic
1005688480 6:28278897-28278919 AAAAGGGAGGGATGAATAATAGG - Intronic
1005820679 6:29596094-29596116 CAGAGGAAGGAGGGTATCATTGG - Intronic
1006080667 6:31564172-31564194 AAAATGGAGGAGGGAAGAAGAGG + Intergenic
1006150617 6:31985235-31985257 AAAAGGGAGGGGGGCATGTTGGG - Intronic
1006156918 6:32017973-32017995 AAAAGGGAGGGGGGCATGTTGGG - Intronic
1006938197 6:37733032-37733054 CAAAGGGAGGAAGGTATTAGTGG - Intergenic
1007000817 6:38310775-38310797 CAAAGCTAGAAGGGTATAATTGG - Intronic
1007514534 6:42400727-42400749 AAAAAGGAGGCAGGTGTAATGGG + Intronic
1007782722 6:44263654-44263676 AAGTGGGAGGAGGGGATACTGGG - Intronic
1007835682 6:44671869-44671891 CAAAGGGAGCAGGGTATGGTGGG - Intergenic
1008819847 6:55618159-55618181 GGAAGGGAGGATGTTATAATTGG + Intergenic
1008912613 6:56751843-56751865 AGAAGAGAGGAGGGTAGAATAGG + Intronic
1008937760 6:57010593-57010615 AAAGGGGATCAGGGTATAAGTGG + Intronic
1009830781 6:68929957-68929979 AAAAGGGGGGAGGAATTAATTGG + Intronic
1010386380 6:75284902-75284924 AAAGGGGAGGAGGATAGAAGCGG + Exonic
1012420334 6:99057699-99057721 GAAAGGGAGGAAGGTATTCTGGG - Intergenic
1012878017 6:104752714-104752736 AAAATGTAGGAGGAAATAATAGG - Intronic
1014147085 6:118010847-118010869 AAAAGGAAGGAGGTTATTCTGGG - Intronic
1014767699 6:125425574-125425596 TAAAGGGTGGAGGGTTTAAAAGG - Intergenic
1015241742 6:131031935-131031957 CAAAGTGAAGAGGGTATAAAAGG + Intronic
1016049251 6:139513328-139513350 GAAAGGTAGGAGTGTATTATAGG - Intergenic
1016521486 6:144951557-144951579 CAAAGGGAAGAGGGTATAACAGG - Intergenic
1016965643 6:149716875-149716897 AAAAGGTAGGACATTATAATTGG - Intronic
1017347773 6:153404951-153404973 AAAAGGGAAGACAGCATAATGGG + Intergenic
1017956837 6:159185663-159185685 AAAAAGGAGGAAGGTACAAAAGG + Intronic
1018195869 6:161355939-161355961 GAAAGGGAGGAGGGCAGACTGGG + Intronic
1019950068 7:4364965-4364987 CAGTGGGAGGAGGGTATAATGGG - Intergenic
1020341876 7:7120137-7120159 AAAAAGAATGAGGGAATAATTGG - Intergenic
1020458494 7:8401674-8401696 AAATGGGAGGAGGGGATGAAAGG - Intergenic
1020586429 7:10075974-10075996 GAAAGGTTGGAGGGAATAATTGG + Intergenic
1020675883 7:11184683-11184705 AAGAGGGAGGAAAGTATATTTGG - Intergenic
1022301523 7:29106641-29106663 AACAGGGAAGAGGGTAGAATTGG + Intronic
1022473347 7:30694919-30694941 AAAAGGGAGAGGGGGAGAATGGG + Intronic
1022642507 7:32201641-32201663 AAAAGGGAGGTGGAAATAAAGGG + Intronic
1022866228 7:34423974-34423996 AAAAGGGAGGATCGGAAAATGGG - Intergenic
1023182884 7:37503607-37503629 AAAAGGGAAGAGGGTAGTAATGG - Intergenic
1024305477 7:47925626-47925648 CAATGGGAGGAGGGTATCGTGGG - Intronic
1024823238 7:53358795-53358817 AAAAGGCAGGTGAGTATACTGGG + Intergenic
1026409922 7:70109748-70109770 GAAAGGGAGGAGGTTATTATGGG + Intronic
1026508454 7:71006941-71006963 AAAGAGGAGGAAGGTATAACCGG - Intergenic
1026651786 7:72222256-72222278 AAAAGGAAAGAAGGTTTAATTGG + Intronic
1027303595 7:76868100-76868122 AAAAAGGAGGAAGGTGAAATGGG + Intergenic
1027700190 7:81460071-81460093 AAAAGGAAGGAAGGTAGAAGTGG - Intergenic
1027869850 7:83693488-83693510 CAAAGGAAGGAGGGTATAATGGG + Intergenic
1028441476 7:90867614-90867636 AATAAGGAGGAGGGGAAAATAGG + Intronic
1028615023 7:92756242-92756264 AAAAGGGGGAAAGGTGTAATGGG + Intronic
1028878218 7:95847898-95847920 GTAAGGCAGGAGAGTATAATGGG - Intronic
1030871375 7:114760080-114760102 AAAAGGGATGAGGGTGTACTGGG - Intergenic
1032700169 7:134372353-134372375 AGAAGGGAGTGGGGAATAATTGG + Intergenic
1033226010 7:139563055-139563077 AAAAGGGAGGAGAGCAGAAACGG + Exonic
1034744782 7:153514106-153514128 AAAAGGATGATGGGTATAATGGG + Intergenic
1037250988 8:16894055-16894077 AGAAGGGAGGAGGGTGGAATGGG - Intergenic
1039499556 8:38005763-38005785 AAAAGAAAAGAGGGTTTAATTGG - Intergenic
1041015241 8:53586502-53586524 GATAGGGAGGAGGCTATATTAGG - Intergenic
1041436967 8:57852656-57852678 AAAAAGGAGGCAGGAATAATTGG + Intergenic
1041805403 8:61843842-61843864 AATAGGGAGGGAGGTTTAATAGG + Intergenic
1042207172 8:66340969-66340991 CAGAGGGAGGAAGGTATATTGGG - Intergenic
1044396576 8:91720416-91720438 CAAAGGGAGGAGGGTAGAATGGG + Intergenic
1044803183 8:95977974-95977996 GAAAGGGAGGAGGGAAAAAGAGG + Intergenic
1045441255 8:102214272-102214294 AAAATGGAAGAGGGGTTAATAGG + Intronic
1046842577 8:118876255-118876277 ATTAGGGGTGAGGGTATAATAGG - Intergenic
1047210848 8:122839112-122839134 AAAAGTAATGAGGGTATAGTGGG - Intronic
1047359618 8:124156163-124156185 TAGAGGGAGGAGGGTAGGATGGG - Intergenic
1047506993 8:125487922-125487944 AAAAGGGAGGAAGGTAGAAATGG + Intergenic
1047515730 8:125553145-125553167 AAAAGGTAGGAGGGTAGAAGGGG - Intergenic
1047942148 8:129836552-129836574 AGGAGGGAGGAGGGTCTATTTGG + Intergenic
1048546691 8:135394202-135394224 AAAGGGGAGGAGGGGAGAAGAGG + Intergenic
1048621299 8:136135479-136135501 ACAAGGGAGAAGGCTTTAATCGG - Intergenic
1051261110 9:15265641-15265663 AAAAGGGAGGAGGGGAAAAAGGG + Intronic
1051562556 9:18458075-18458097 AAAAAGGAGTAGGGTATGAATGG - Intergenic
1052511201 9:29423061-29423083 AATGGGGAGGAGGCTTTAATTGG + Intergenic
1054771871 9:69090689-69090711 AGAAAGGAGGAAGGTAGAATAGG + Intronic
1056162169 9:83907541-83907563 AAATGGGAGAAGGTTAGAATGGG - Intronic
1056358170 9:85823940-85823962 AAATGGGAGAAGGTTAGAATGGG + Intergenic
1057504418 9:95620781-95620803 TGAAGGGAGGAGGGTATCAAAGG + Intergenic
1059805599 9:117796860-117796882 ACAGGGGAAGAGGGTAAAATAGG + Intergenic
1060705726 9:125798474-125798496 AAATGGGAGGTGGGGATAAGAGG - Intronic
1062491438 9:136807045-136807067 AACCGGGAGGAGGATATGATCGG + Exonic
1188215849 X:27476094-27476116 GATAGGGAGGCGGGTATAAAGGG + Intergenic
1190133667 X:47774260-47774282 CACAGGGAGGAGGGAAAAATTGG - Intergenic
1190360311 X:49643142-49643164 AAAAGGGAGGAGGGCATAATGGG - Intergenic
1190948878 X:55122907-55122929 AAAAGGGAGAGGGGTTTAACGGG + Intronic
1191712237 X:64162418-64162440 AGTAGGGAGGAGGGGAGAATGGG - Intergenic
1191764510 X:64682584-64682606 AAAAAGGAGGATGGAATAGTGGG + Intergenic
1194160143 X:90438970-90438992 AAAAGGAAGGAAAGTATACTTGG + Intergenic
1195536842 X:106018155-106018177 AAAAGAGAGGAGGGAGTAAAAGG - Intergenic
1195588594 X:106597499-106597521 AAAAGGTAGGAGACTATAAATGG - Intergenic
1196178334 X:112664587-112664609 AAAAGGGAGGATGGAGTACTGGG - Intronic
1196667846 X:118334998-118335020 AAGAGGGATGAGGGTAAAAAGGG - Intergenic
1196789631 X:119452184-119452206 ACAAAGGAAGAGGGTAGAATTGG - Intronic
1197452454 X:126636761-126636783 AAAAGGAAGTAAAGTATAATTGG - Intergenic
1198552528 X:137759686-137759708 AAAAGGGAGGAGGGTGAAAGTGG + Intergenic
1198558014 X:137816644-137816666 GAAAGTGAGGAGGGGACAATGGG - Intergenic
1199076163 X:143529546-143529568 AAAAGGGAGGAGGGAAGTGTGGG - Intergenic
1200506436 Y:4015922-4015944 AAAAGGAAGGAAAGTATACTTGG + Intergenic
1200945650 Y:8833477-8833499 AAACAGGAGGAGTGTAGAATTGG - Intergenic