ID: 1127902914

View in Genome Browser
Species Human (GRCh38)
Location 15:63354470-63354492
Sequence CTCCCCAAGGGGAGATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 574}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127902914_1127902924 1 Left 1127902914 15:63354470-63354492 CCCCCAAATCTCCCCTTGGGGAG 0: 1
1: 0
2: 0
3: 25
4: 574
Right 1127902924 15:63354494-63354516 CAGGAGGATCAGTTGAGCCCAGG 0: 99
1: 6571
2: 23390
3: 93697
4: 208146
1127902914_1127902928 20 Left 1127902914 15:63354470-63354492 CCCCCAAATCTCCCCTTGGGGAG 0: 1
1: 0
2: 0
3: 25
4: 574
Right 1127902928 15:63354513-63354535 CAGGAGTTTGAGACAAGCCTGGG 0: 544
1: 21733
2: 41632
3: 58462
4: 49708
1127902914_1127902927 19 Left 1127902914 15:63354470-63354492 CCCCCAAATCTCCCCTTGGGGAG 0: 1
1: 0
2: 0
3: 25
4: 574
Right 1127902927 15:63354512-63354534 CCAGGAGTTTGAGACAAGCCTGG 0: 528
1: 21950
2: 88727
3: 158062
4: 187495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127902914 Original CRISPR CTCCCCAAGGGGAGATTTGG GGG (reversed) Intronic
900755388 1:4430872-4430894 GTCCCCAAAGGAGGATTTGGGGG - Intergenic
900910511 1:5594037-5594059 CTCCCTAAGGGCAGTTTTAGGGG - Intergenic
902392218 1:16113256-16113278 GTGCCCAGGGGGAGACTTGGGGG + Intergenic
903951732 1:26999579-26999601 CTCCATAAGGGGAGAAGTGGAGG + Intronic
906102519 1:43272454-43272476 CTATCCCAGGGGAGATTCGGGGG + Intronic
909545284 1:76839810-76839832 ATCCCAGTGGGGAGATTTGGTGG - Intergenic
910033173 1:82756928-82756950 GCCCCCAAGAGGACATTTGGTGG + Intergenic
910651813 1:89576367-89576389 CTCCTCCTGGGGAGATTTGGGGG + Intronic
911549674 1:99264139-99264161 CTCCCCAGGAGGAGACTAGGTGG + Exonic
912940058 1:114036923-114036945 CACCCCAAGGGAAGAATCGGGGG - Intergenic
913722837 1:121617333-121617355 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913723024 1:121620003-121620025 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913723186 1:121622136-121622158 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913723340 1:121624005-121624027 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913723507 1:121626139-121626161 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913723659 1:121628002-121628024 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913723861 1:121630545-121630567 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913724018 1:121632414-121632436 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913724185 1:121634280-121634302 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913724352 1:121636149-121636171 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913724514 1:121638018-121638040 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913724682 1:121639887-121639909 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913724844 1:121641756-121641778 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913725007 1:121643625-121643647 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913725169 1:121645493-121645515 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913725335 1:121647359-121647381 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913725498 1:121649224-121649246 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913725667 1:121651090-121651112 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913725833 1:121652956-121652978 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913725995 1:121654820-121654842 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913726162 1:121656686-121656708 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913726328 1:121658552-121658574 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913726489 1:121660418-121660440 ATCTGCAAGGGGACATTTGGGGG - Intergenic
913726654 1:121662283-121662305 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913726819 1:121664148-121664170 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913726984 1:121666013-121666035 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913727150 1:121667879-121667901 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913727321 1:121669745-121669767 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913727486 1:121671611-121671633 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913727649 1:121673477-121673499 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913727818 1:121675342-121675364 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913727986 1:121677208-121677230 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913728157 1:121679074-121679096 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913728321 1:121680940-121680962 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913728484 1:121682806-121682828 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913728961 1:121688402-121688424 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913729108 1:121690267-121690289 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913729256 1:121692132-121692154 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913729557 1:121695861-121695883 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913729713 1:121697727-121697749 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913729869 1:121699593-121699615 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913730026 1:121701459-121701481 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913730182 1:121703325-121703347 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913730337 1:121705191-121705213 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913730492 1:121707057-121707079 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913730643 1:121708923-121708945 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913730796 1:121710789-121710811 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913730951 1:121712655-121712677 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913731106 1:121714521-121714543 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913731255 1:121716387-121716409 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913731560 1:121720118-121720140 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913731864 1:121723849-121723871 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913732021 1:121725715-121725737 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913732324 1:121729446-121729468 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913732479 1:121731311-121731333 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913732624 1:121733176-121733198 ATCTGCAAGGGGACATTTGGTGG - Intergenic
913732999 1:121737209-121737231 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913733144 1:121739073-121739095 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913733349 1:121741785-121741807 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913735293 1:121776496-121776518 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913735584 1:121779750-121779772 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913735835 1:121782766-121782788 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913736011 1:121784631-121784653 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913736173 1:121786495-121786517 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913736479 1:121790229-121790251 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913736635 1:121792098-121792120 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913736817 1:121794286-121794308 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913736993 1:121796152-121796174 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913737103 1:121797426-121797448 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913737268 1:121799292-121799314 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913737353 1:121800262-121800284 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913737519 1:121802127-121802149 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913737682 1:121803991-121804013 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913737833 1:121805683-121805705 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913738046 1:121808207-121808229 ATCTGCAAGGGGACATTTGGGGG - Intergenic
913738211 1:121810073-121810095 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913738430 1:121812773-121812795 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913738641 1:121815168-121815190 ATCGGCAAGGGGACATTTGGAGG + Intergenic
913738772 1:121816722-121816744 ATCGGCAAGGGGACATTTGGAGG + Intergenic
913739100 1:121820454-121820476 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913739268 1:121822318-121822340 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913739518 1:121825437-121825459 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913739552 1:121825779-121825801 GCCCCCAAGTGGACATTTGGAGG - Intergenic
913739715 1:121828223-121828245 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913739943 1:121831263-121831285 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913740105 1:121833392-121833414 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913740139 1:121833734-121833756 GCCCCCAAGTGGACATTTGGAGG - Intergenic
913740257 1:121835257-121835279 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913740429 1:121837394-121837416 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913740579 1:121839257-121839279 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913740780 1:121841799-121841821 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913740938 1:121843668-121843690 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913741105 1:121845533-121845555 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913741268 1:121847576-121847598 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913741433 1:121849445-121849467 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913741604 1:121851313-121851335 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913742597 1:121864589-121864611 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913742757 1:121866723-121866745 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913742927 1:121869127-121869149 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913743180 1:121871970-121871992 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913743468 1:121874940-121874962 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913743629 1:121876797-121876819 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913743797 1:121878663-121878685 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913743948 1:121880528-121880550 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913744569 1:121887995-121888017 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913744736 1:121889861-121889883 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913744892 1:121891677-121891699 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913745097 1:121894289-121894311 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913745252 1:121896155-121896177 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913745407 1:121898021-121898043 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913745478 1:121898857-121898879 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913745628 1:121900714-121900736 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913745817 1:121903191-121903213 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913745974 1:121905057-121905079 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913746129 1:121906923-121906945 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913746282 1:121908787-121908809 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913746435 1:121910653-121910675 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913746612 1:121912865-121912887 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913746766 1:121914502-121914524 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913746935 1:121916368-121916390 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913747099 1:121918415-121918437 ATCTGCAAGGGGACATTTGGGGG - Intergenic
913747265 1:121920281-121920303 ATCTGCAAGGGGACATTTGGGGG - Intergenic
913747430 1:121922147-121922169 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913747731 1:121925510-121925532 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913747903 1:121927432-121927454 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913748071 1:121929284-121929306 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913748223 1:121931101-121931123 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913748374 1:121932966-121932988 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913748618 1:121935902-121935924 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913748763 1:121937767-121937789 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913748919 1:121939632-121939654 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913749449 1:121945932-121945954 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913749693 1:121948950-121948972 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913749817 1:121950589-121950611 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913749970 1:121952454-121952476 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913750112 1:121954216-121954238 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913750466 1:121959176-121959198 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913750620 1:121961042-121961064 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913750773 1:121962908-121962930 ATCTGCAAGGGGACATTTGGAGG - Intergenic
913750907 1:121964576-121964598 ATCGGCAAGGGGACATTTGGAGG - Intergenic
913751328 1:121970861-121970883 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913751506 1:121972815-121972837 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913751938 1:122027909-122027931 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913752095 1:122029776-122029798 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913752248 1:122031641-122031663 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913752404 1:122033509-122033531 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913752567 1:122035375-122035397 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913752734 1:122037242-122037264 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913752897 1:122039111-122039133 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913753064 1:122040977-122040999 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913753228 1:122042843-122042865 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913753389 1:122044708-122044730 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913753729 1:122048781-122048803 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913753888 1:122050646-122050668 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913754050 1:122052515-122052537 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913754208 1:122054382-122054404 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913754373 1:122056250-122056272 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913754525 1:122058198-122058220 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913754680 1:122060064-122060086 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913754840 1:122061930-122061952 ATCTCCAAGGGGACATTTGGAGG + Intergenic
913754962 1:122063454-122063476 GCCCCCAAGTGGACATTTGGAGG + Intergenic
913754996 1:122063796-122063818 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913755153 1:122065662-122065684 ATCGGCAAGGGGACATTTGGAGG + Intergenic
913755325 1:122067531-122067553 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913755489 1:122069396-122069418 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913755658 1:122071261-122071283 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913755811 1:122073126-122073148 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913755964 1:122074992-122075014 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913756127 1:122076859-122076881 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913756284 1:122078724-122078746 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913756451 1:122080590-122080612 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913756608 1:122082456-122082478 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913756766 1:122084325-122084347 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913756936 1:122086361-122086383 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913757103 1:122088227-122088249 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913757267 1:122090093-122090115 ATCGGCAAGGGGACATTTGGAGG + Intergenic
913757426 1:122091959-122091981 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913757585 1:122093825-122093847 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913757751 1:122095694-122095716 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913757916 1:122097560-122097582 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913758067 1:122099426-122099448 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913758237 1:122101295-122101317 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913758435 1:122103700-122103722 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913758599 1:122105566-122105588 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913758756 1:122107435-122107457 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913758922 1:122109301-122109323 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913759117 1:122111424-122111446 ATCTGCAAGGGGACATTTGGGGG + Intergenic
913759271 1:122113291-122113313 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913759428 1:122115156-122115178 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913759578 1:122117022-122117044 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913759732 1:122118891-122118913 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913759891 1:122120757-122120779 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913760054 1:122122624-122122646 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913760222 1:122124492-122124514 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913760437 1:122126693-122126715 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913760595 1:122128562-122128584 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913760757 1:122130427-122130449 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913760923 1:122132292-122132314 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913761080 1:122134156-122134178 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913761244 1:122136021-122136043 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913761405 1:122137889-122137911 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913761571 1:122139755-122139777 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913761733 1:122141624-122141646 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913761889 1:122143492-122143514 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913762047 1:122145356-122145378 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913762212 1:122147221-122147243 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913762380 1:122149087-122149109 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913762546 1:122150952-122150974 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913762708 1:122152818-122152840 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913762861 1:122154684-122154706 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913763014 1:122156550-122156572 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913763178 1:122158415-122158437 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913763348 1:122160281-122160303 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913763505 1:122162148-122162170 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913763664 1:122164013-122164035 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913763827 1:122165878-122165900 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913763986 1:122167744-122167766 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913764153 1:122169614-122169636 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913764309 1:122171482-122171504 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913764465 1:122173347-122173369 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913764654 1:122175419-122175441 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913764805 1:122177285-122177307 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913764962 1:122179151-122179173 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913765121 1:122181018-122181040 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913765291 1:122182884-122182906 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913765552 1:122186108-122186130 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913765708 1:122187972-122187994 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913765875 1:122189839-122189861 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913766042 1:122191874-122191896 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913766203 1:122193741-122193763 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913766372 1:122195607-122195629 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913766532 1:122197472-122197494 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913766696 1:122199338-122199360 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913766852 1:122201204-122201226 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913767022 1:122203073-122203095 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913767174 1:122204942-122204964 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913767341 1:122206812-122206834 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913767494 1:122208678-122208700 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913767657 1:122210544-122210566 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913767816 1:122212410-122212432 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913767972 1:122214276-122214298 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913768139 1:122216145-122216167 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913768305 1:122218013-122218035 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913768468 1:122219879-122219901 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913768789 1:122223615-122223637 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913768905 1:122225073-122225095 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913769048 1:122226939-122226961 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913769185 1:122228807-122228829 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913769369 1:122231182-122231204 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913769505 1:122233048-122233070 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913769770 1:122236783-122236805 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913769915 1:122238732-122238754 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913770053 1:122240597-122240619 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913770191 1:122242464-122242486 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913770335 1:122244330-122244352 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913770474 1:122246196-122246218 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913770613 1:122248062-122248084 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913770753 1:122249928-122249950 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913770897 1:122251794-122251816 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913771036 1:122253662-122253684 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913771177 1:122255528-122255550 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913771315 1:122257394-122257416 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913771455 1:122259259-122259281 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913771777 1:122263665-122263687 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913771916 1:122265531-122265553 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913772054 1:122267397-122267419 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913772194 1:122269262-122269284 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913772329 1:122271127-122271149 ATCTGCAAGGGGATATTTGGAGG + Intergenic
913772468 1:122272994-122273016 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913772610 1:122274860-122274882 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913772750 1:122276726-122276748 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913773027 1:122280459-122280481 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913773303 1:122284190-122284212 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913773585 1:122287922-122287944 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913773726 1:122289788-122289810 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913773864 1:122291654-122291676 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913774280 1:122297252-122297274 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913774420 1:122299118-122299140 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913774702 1:122302850-122302872 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913774841 1:122304716-122304738 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913775117 1:122308448-122308470 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913775256 1:122310314-122310336 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913775395 1:122312180-122312202 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913775534 1:122314046-122314068 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913775671 1:122315912-122315934 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913775811 1:122317778-122317800 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913775950 1:122319646-122319668 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913776094 1:122321512-122321534 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913776234 1:122323378-122323400 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913776376 1:122325247-122325269 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913776518 1:122327112-122327134 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913776800 1:122330843-122330865 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913776940 1:122332709-122332731 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913777078 1:122334576-122334598 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913777216 1:122336441-122336463 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913777359 1:122338307-122338329 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913777635 1:122342025-122342047 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913777774 1:122343894-122343916 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913777912 1:122345760-122345782 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913778056 1:122347626-122347648 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913778197 1:122349488-122349510 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913778338 1:122351354-122351376 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913778478 1:122353219-122353241 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913778892 1:122358816-122358838 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913779318 1:122364415-122364437 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913779457 1:122366281-122366303 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913779587 1:122368147-122368169 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913779731 1:122370013-122370035 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913779874 1:122371879-122371901 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913780150 1:122375611-122375633 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913780291 1:122377477-122377499 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913780430 1:122379343-122379365 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913780569 1:122381208-122381230 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913780709 1:122383076-122383098 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913780849 1:122384941-122384963 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913780987 1:122386807-122386829 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913781143 1:122388679-122388701 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913781281 1:122390545-122390567 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913781417 1:122392411-122392433 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913781691 1:122396143-122396165 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913781837 1:122398009-122398031 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913781975 1:122399875-122399897 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913782253 1:122403606-122403628 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913782397 1:122405473-122405495 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913782539 1:122407339-122407361 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913782678 1:122409205-122409227 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913782817 1:122411072-122411094 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913782959 1:122412939-122412961 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913783102 1:122414805-122414827 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913783246 1:122416674-122416696 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913783378 1:122418539-122418561 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913783516 1:122420405-122420427 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913783655 1:122422272-122422294 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913783792 1:122424137-122424159 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913783931 1:122426003-122426025 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913784070 1:122427869-122427891 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913784194 1:122429398-122429420 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913784330 1:122431262-122431284 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913784608 1:122434995-122435017 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913784745 1:122436860-122436882 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913784885 1:122438726-122438748 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913785020 1:122440592-122440614 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913785303 1:122444324-122444346 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913785442 1:122446190-122446212 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913785586 1:122448058-122448080 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913785883 1:122451961-122451983 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913786022 1:122453826-122453848 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913786162 1:122455693-122455715 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913786295 1:122457558-122457580 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913786580 1:122461290-122461312 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913786731 1:122463353-122463375 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913786869 1:122465219-122465241 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913787006 1:122467086-122467108 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913787140 1:122468951-122468973 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913787281 1:122470816-122470838 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913787560 1:122474545-122474567 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913787698 1:122476412-122476434 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913787834 1:122478279-122478301 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913788112 1:122482010-122482032 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913788253 1:122483876-122483898 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913788396 1:122485741-122485763 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913788532 1:122487608-122487630 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913788671 1:122489474-122489496 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913788815 1:122491339-122491361 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913788949 1:122493205-122493227 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913789223 1:122496964-122496986 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913789363 1:122498830-122498852 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913789507 1:122500697-122500719 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913789647 1:122502563-122502585 ATCTGCAAGGGGACATTTGGAGG + Intergenic
913927182 1:124908669-124908691 ATCTCCAAGTGGACATTTGGAGG + Intergenic
913930718 1:124961355-124961377 ATCCGCAAGTGGATATTTGGAGG - Intergenic
918119660 1:181527369-181527391 ATCCCCAATGTGATATTTGGAGG - Intronic
1063174042 10:3535699-3535721 CAGCCCATGGGGACATTTGGAGG - Intergenic
1066151353 10:32622739-32622761 TTCCCCCAGGGGACATTTAGCGG - Intronic
1066260309 10:33723521-33723543 CTCCCCAAGCTGGGGTTTGGGGG - Intergenic
1066824635 10:39552495-39552517 GTCTGCAAGGGGATATTTGGAGG + Intergenic
1068438425 10:57019943-57019965 CACCCCAAGGGAAGAATCGGGGG + Intergenic
1068497073 10:57796178-57796200 CACCCCAAGGGAAGAATTAGGGG + Intergenic
1076296034 10:129385590-129385612 CTCCCCAACTTGAGACTTGGAGG + Intergenic
1077284364 11:1759196-1759218 CTCCCCAGGGTGGGATTTGGAGG + Intronic
1077351990 11:2097295-2097317 CTTCCCGAGGGGAGATCGGGGGG - Intergenic
1077599549 11:3564595-3564617 CTCCCCTAGGGGAGAGATGGAGG + Intergenic
1079970506 11:27030481-27030503 CTCTCCAAGGGGTGATTTATGGG - Intergenic
1080437204 11:32256048-32256070 CTCCAGTGGGGGAGATTTGGTGG - Intergenic
1081680319 11:44998021-44998043 CTCCCAAAGGGCAGATTGGAAGG - Intergenic
1082154533 11:48789796-48789818 ATCTGCAAGGGGATATTTGGAGG - Intergenic
1082323473 11:51107008-51107030 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1082335965 11:51287955-51287977 ATCTCCAAGTGGACATTTGGAGG + Intergenic
1082346881 11:51446927-51446949 ATCTGCAAGTGGAGATTTGGAGG + Intergenic
1082350172 11:51494352-51494374 ATCCGCAAGTGGATATTTGGAGG + Intergenic
1082373250 11:51830160-51830182 ATCCGCAAGTGGACATTTGGAGG + Intergenic
1082388332 11:52049607-52049629 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1082397099 11:52177268-52177290 ATCTCCAAGTGGACATTTGGAGG + Intergenic
1082401162 11:52235916-52235938 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1082408251 11:52338580-52338602 GTCTGCAAGGGGACATTTGGAGG + Intergenic
1082411109 11:52379586-52379608 ATCCGCAAGTGGACATTTGGAGG + Intergenic
1082414813 11:52433142-52433164 ATCCGCAAGTGGACATTTGGAGG + Intergenic
1082424866 11:52578510-52578532 CTCTGCAAGTGGACATTTGGAGG + Intergenic
1082425860 11:52592956-52592978 ATCCGCAAGTGGACATTTGGAGG + Intergenic
1082429250 11:52642260-52642282 ATCCGCAAGTGGACATTTGGAGG + Intergenic
1082468742 11:53213469-53213491 GTCTGCAAGGGGACATTTGGAGG + Intergenic
1082498985 11:53649379-53649401 ATCTGCAAGTGGAGATTTGGAGG + Intergenic
1082503648 11:53717061-53717083 ATCTGCAAGTGGAGATTTGGAGG + Intergenic
1082511684 11:53833543-53833565 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1082511986 11:53837794-53837816 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1082535318 11:54175504-54175526 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1082535728 11:54181457-54181479 ATCTCCAAGTGGACATTTGGAGG + Intergenic
1082547819 11:54355216-54355238 ATCCGCAAGTGGACATTTGGAGG + Intergenic
1082809637 11:57471622-57471644 GCCCCAAAGGGGAGCTTTGGAGG + Intronic
1083600156 11:63942153-63942175 CACCTCATGGGGAGAGTTGGAGG + Intronic
1084255453 11:67939203-67939225 CTCCCCTAGGGGAGAGATGGAGG + Intergenic
1085998819 11:81954437-81954459 ATCCCCAAGCGGATATGTGGTGG + Intergenic
1086876311 11:92100035-92100057 CTCACTATTGGGAGATTTGGTGG + Intergenic
1087305689 11:96487045-96487067 CTCCCCAAGGGAAGCTGTGAGGG + Intronic
1087468392 11:98540104-98540126 CTCCCCAAGGGGAAATATCGTGG + Intergenic
1092247347 12:6871135-6871157 CTCCCCAAGGGGAGGGGTGGTGG + Exonic
1092331129 12:7589047-7589069 CTCCCCAAGGAGCTATCTGGGGG - Intergenic
1092552378 12:9517233-9517255 TTCCCCAAGGGTAGTTTAGGGGG - Intergenic
1094519741 12:31173378-31173400 TTCCCCAAGGGTAGTTTAGGGGG + Intergenic
1095070442 12:37837243-37837265 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1096830735 12:54311982-54312004 CTCCCCAAGGCCTGATTTTGTGG + Intronic
1099092729 12:78333858-78333880 CTCCCCACGGGGAGTTATGCTGG - Intergenic
1100536693 12:95518206-95518228 CTCCCCAACAGGAGCTCTGGAGG + Exonic
1101929937 12:109005744-109005766 CTCCCCAAGGAGAGATCAAGGGG + Intronic
1104184046 12:126411024-126411046 TTCCCCAAGGGGAGCTTTGATGG - Intergenic
1105465427 13:20635392-20635414 ATCCCCAAGGGGAGGGATGGAGG + Intronic
1108419835 13:50237416-50237438 CTCCCTGAGGGGAGGTTTGAAGG + Intronic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1110059691 13:71026077-71026099 CTCCTCAAGCTGAGGTTTGGTGG + Intergenic
1114492709 14:23113431-23113453 CTCCCCAAGGGGAGAGGGTGTGG - Intergenic
1116006522 14:39297462-39297484 CTCCCAAATGGGAAATGTGGAGG - Intronic
1117834384 14:59787215-59787237 CCCCCCTAGGGGAGCTATGGAGG + Intronic
1121815096 14:96923205-96923227 CACCCCAAGGGGAGAATCAGGGG + Intronic
1122293266 14:100690965-100690987 CTGCCCAAGAGGAGACTTGGGGG - Intergenic
1124078612 15:26470277-26470299 CACCCCAAGGGAAGAATCGGGGG + Intergenic
1127902914 15:63354470-63354492 CTCCCCAAGGGGAGATTTGGGGG - Intronic
1127992721 15:64132724-64132746 CTCCCTAATGGGAGATATGTTGG - Intronic
1128771886 15:70289123-70289145 CTCTCCATGGTCAGATTTGGAGG - Intergenic
1130026720 15:80276801-80276823 CTCAGGAAGGGGGGATTTGGGGG + Intergenic
1130214858 15:81958696-81958718 GTCTCCAAGGGGTGGTTTGGAGG - Intergenic
1131661639 15:94523781-94523803 CACCCCAAGGGAAGATTCAGGGG - Intergenic
1131857780 15:96617077-96617099 CTCACCACATGGAGATTTGGTGG + Intergenic
1133372649 16:5256968-5256990 CTCCCCCAGGAGAGAGATGGAGG - Intergenic
1136916790 16:34211382-34211404 ATCTGCAAGGGGATATTTGGAGG - Intergenic
1137615431 16:49843664-49843686 CTCCCCAAGGAGAGAAATGAAGG + Intronic
1138029040 16:53544989-53545011 CTCCCCAAGGTGAGAAGGGGCGG - Intergenic
1140046593 16:71443659-71443681 CTCCCCAAGGTGTGGTCTGGGGG + Intergenic
1140233852 16:73140911-73140933 CTCCCCAAGGCATCATTTGGAGG + Intronic
1141720865 16:85754552-85754574 ATCCCCAAGGGGAGACGGGGGGG - Intergenic
1143986613 17:10920000-10920022 CTCCCCAAGAGGAGATTCAGTGG + Intergenic
1144954662 17:19013052-19013074 CTCCCCAAAGGGGGAAATGGAGG - Intronic
1145059611 17:19724449-19724471 CTCGCCAAGGGGAGGATTCGGGG + Intergenic
1145422783 17:22854421-22854443 ATCCGCAAGTGGATATTTGGAGG + Intergenic
1145436838 17:23048326-23048348 ATCTGCAAGTGGAGATTTGGAGG + Intergenic
1145572207 17:25010124-25010146 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1145576467 17:25072198-25072220 ATCTCCAAGTGGACATTTGGAGG + Intergenic
1145627253 17:25811646-25811668 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1145635485 17:25930815-25930837 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1145636920 17:25951522-25951544 CTCTGCAAGTGGATATTTGGAGG + Intergenic
1145678463 17:26555353-26555375 ATCTGCAAGGGGACATTTGGAGG + Intergenic
1145682575 17:26614730-26614752 CTCTGCAAGTGGATATTTGGAGG + Intergenic
1145685823 17:26662305-26662327 ATCTCCAAGTGGATATTTGGAGG + Intergenic
1145686120 17:26666385-26666407 ATCTCCAAGTGGACATTTGGAGG + Intergenic
1145707216 17:26882765-26882787 CTCTGCAAGTGGATATTTGGAGG - Intergenic
1146820594 17:35981182-35981204 CTTACAAAGGGGAGAATTGGAGG + Intronic
1146831090 17:36070146-36070168 CTCCCCAAGGAGAGATGGGATGG + Intronic
1147133601 17:38422758-38422780 CTCCCCAAGGGGTGTTCAGGTGG + Intergenic
1149909373 17:60553009-60553031 CTCCCCAAAGGGAAATCAGGTGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150852336 17:68715338-68715360 CTTCCCAAGGTGATATCTGGGGG - Intergenic
1151357661 17:73570116-73570138 CTCCCCAAGAGGGGCTCTGGGGG - Intronic
1152294872 17:79461131-79461153 CTCCCCAAGGGGGTTGTTGGGGG + Intronic
1153933041 18:9895775-9895797 CTCCCAAATGGGAGATATGGGGG + Intergenic
1154018339 18:10639618-10639640 CTCCAGAAAGGGACATTTGGGGG - Intergenic
1154186534 18:12189972-12189994 CTCCAGAAAGGGACATTTGGGGG + Intergenic
1154946211 18:21163849-21163871 CTCCACAAGGCCAGATGTGGTGG - Intergenic
1157517706 18:48322375-48322397 CTCTTCCAGGGGACATTTGGTGG - Intronic
1159940285 18:74401656-74401678 CTGCTTAAGAGGAGATTTGGAGG + Intergenic
1160423891 18:78767512-78767534 CTCTCCAGGTGGAGATATGGGGG - Intergenic
1160423920 18:78767618-78767640 CTCTCCAGGTGGAGATATGGGGG - Intergenic
1160921177 19:1521555-1521577 TTGCCCCAGGGGAGTTTTGGGGG - Intergenic
1161033816 19:2072927-2072949 CTCCCCAACGGGAGACATGTAGG + Exonic
1163256167 19:16157307-16157329 CTCTCCAAGAGGGGATTTTGGGG - Exonic
1166647570 19:44543499-44543521 GGCACCAAGGGGAGATTTTGTGG - Intergenic
1166976752 19:46609427-46609449 CTCCCCAAGGGGATCTGGGGAGG - Exonic
1167097049 19:47380078-47380100 CTCCACATGGGCACATTTGGGGG + Intronic
1167403248 19:49286944-49286966 CTCCCCAAAAGGAGACTGGGGGG - Intergenic
1168485680 19:56760128-56760150 CTCCCAGAGGGGGGATTTGAGGG - Intergenic
925751927 2:7096764-7096786 CACCCCAAGGGGAGAATCAGGGG - Intergenic
926686406 2:15701750-15701772 CACCCCAAGGGAAGATTCAGGGG - Intronic
927264763 2:21133021-21133043 TTCCCCAAGGGAACATCTGGGGG - Intronic
927349678 2:22094473-22094495 AGCCCCAAGGGGAGCTCTGGTGG + Intergenic
929085959 2:38167646-38167668 CTACCCAAAGGCAAATTTGGGGG - Intergenic
930993370 2:57686167-57686189 TGCCCCAAGAGGAGCTTTGGTGG - Intergenic
934951085 2:98576267-98576289 CTCCCCATGGGGAGATTTCAGGG - Intronic
936289910 2:111215338-111215360 CTGCCTAAGGGGAGTGTTGGGGG + Intergenic
936427898 2:112435399-112435421 CTGCCCAAGGGGAGAGTCTGAGG - Intergenic
936837772 2:116728345-116728367 CACCCCAAGGGAAGATTCAGGGG + Intergenic
936933602 2:117815541-117815563 CTCCCCGAGGGAAAGTTTGGAGG + Intronic
937761401 2:125607829-125607851 CTCCACAAGGTGGGGTTTGGAGG + Intergenic
937896648 2:126981214-126981236 CTCCCCAAGGGGAGAGTCTGAGG - Intergenic
943905136 2:193489852-193489874 CACCCCAAGGGAAGAATTAGGGG + Intergenic
1168754788 20:308873-308895 CGCCCCAAGGGGAGGGGTGGTGG - Intergenic
1169462657 20:5809694-5809716 CACCACCAGGGGACATTTGGTGG + Intronic
1170010393 20:11716304-11716326 GACCACAAGGGGAGCTTTGGAGG - Intergenic
1171385003 20:24764068-24764090 CTCACCAAGGGCAGACTGGGTGG + Intergenic
1174542899 20:51303831-51303853 CACCCCAAGGGGGAATGTGGTGG + Intergenic
1176240795 20:64074989-64075011 CTCCCCTGGGGGAGATGGGGTGG + Intronic
1176241224 20:64076808-64076830 CTCCCCTGGGGGAGATGGGGTGG - Intronic
1176374352 21:6079812-6079834 CTGCCCAAGGGGAGAGTCTGAGG + Intergenic
1178398016 21:32259631-32259653 CATCCCAAGAGGAGACTTGGAGG - Intergenic
1179749124 21:43458433-43458455 CTGCCCAAGGGGAGAGTCTGAGG - Intergenic
1180395857 22:12336718-12336740 ATCTGCAAGGGGATATTTGGAGG - Intergenic
1180403891 22:12528046-12528068 ATCTGCAAGGGGATATTTGGAGG + Intergenic
1181727482 22:24821510-24821532 CTCCCCAGGGGGACATTCAGGGG - Intronic
1184477139 22:44728021-44728043 CTCCCCTAGGCCAGATCTGGTGG - Intronic
950751077 3:15128557-15128579 CTCCCCTAGGGGAGAGATGGAGG - Intergenic
953033338 3:39191829-39191851 AGCCCCCAGGGCAGATTTGGGGG - Intronic
953150303 3:40318540-40318562 CCTCCAAAGGGTAGATTTGGAGG - Intergenic
953745732 3:45572588-45572610 CACCCCAAGGGAAGAGTTGGGGG + Intronic
954236582 3:49261819-49261841 CTACCCAGGGGCAGATGTGGTGG + Intergenic
956788311 3:72661037-72661059 CCACCCAAGGGGAGATGTAGAGG + Intergenic
957070366 3:75563229-75563251 CTCCCCTAGGGGAGAGATGGAGG + Intergenic
958209612 3:90454395-90454417 ATCTCCAAGTGGACATTTGGAGG - Intergenic
958408301 3:93777576-93777598 ATCCGTAAGGGGATATTTGGAGG - Intergenic
958878356 3:99640803-99640825 ATGCAGAAGGGGAGATTTGGGGG - Intronic
961283719 3:125783298-125783320 CTCCCCTACGGGAGAGATGGAGG - Intergenic
962403069 3:135078129-135078151 CTGCTCAAGGGTAGATTTGATGG + Intronic
965648526 3:170909206-170909228 CTCACCAAGGGGTGAATGGGGGG - Intergenic
966888727 3:184391015-184391037 CTCCCCGAGGTGGGATTTGTGGG + Intronic
969013985 4:4090911-4090933 CTCCCCTAGGGGAGAGGTGGAGG + Intergenic
969053987 4:4390394-4390416 CTCCCCAAGGCTGGCTTTGGGGG + Intronic
969739998 4:9017523-9017545 CTCCCCTAGGGGAGAGATGGAGG - Intergenic
969799161 4:9549027-9549049 CTCCCCCGGGGGAGAGATGGAGG - Intergenic
970563323 4:17305104-17305126 CTCCAAAAGGGGAGAGGTGGGGG - Intergenic
975752626 4:77539492-77539514 CACCCCAAGGGAAGAATTAGAGG - Intronic
975875894 4:78836495-78836517 CTCCCCAAGGGGTGTTTTTAAGG - Intronic
978739979 4:112125585-112125607 CTGCCTAAGGGTAGAGTTGGTGG - Intergenic
980592444 4:134908193-134908215 CTGCTCAAGGGGAGAGATGGAGG - Intergenic
981928774 4:150167986-150168008 CACCCCAAGGGAAGAACTGGGGG + Intronic
982269125 4:153568928-153568950 CTCCCCTAGGGTAGACTTTGGGG + Intronic
982818568 4:159917925-159917947 TTCCCCAAAGGAAGATCTGGTGG + Intergenic
983316822 4:166143107-166143129 CTGTCCAAGGTGAGATCTGGAGG + Intergenic
983967353 4:173829210-173829232 GTCACCAAGAGCAGATTTGGTGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
985807851 5:2060275-2060297 CTCCCCAAGGTCTGATCTGGAGG + Intergenic
999251831 5:150187134-150187156 CTCCGCCAGGGCAGCTTTGGAGG + Intergenic
1005820401 6:29593744-29593766 CACCCCAAGGGAAGATTCAGGGG + Intronic
1006764974 6:36497115-36497137 CTACACAAGGGGACATTTAGAGG - Intronic
1009253965 6:61351933-61351955 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1009253996 6:61352276-61352298 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1009258651 6:61453754-61453776 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1009258682 6:61454097-61454119 ATCTGCAAGGGGATATTTGGGGG + Intergenic
1010946854 6:81984821-81984843 CTCAGCAAGGTGAAATTTGGTGG + Intergenic
1015445209 6:133296160-133296182 CTCCTCAAGTGGGGACTTGGTGG + Intronic
1025313962 7:57993369-57993391 ATCTGCAAGGGGACATTTGGAGG - Intergenic
1026489282 7:70848770-70848792 ATCCCCAAGCGGATATATGGTGG + Intergenic
1026500078 7:70936574-70936596 CTCCCAAGGGGGAGAGTTGAAGG - Intergenic
1026626871 7:72001507-72001529 CACCCCAAGGGGAGAATAAGGGG + Intronic
1028667332 7:93362202-93362224 CTTCCCAAGGAGAGATGTTGTGG + Intergenic
1029072639 7:97912528-97912550 CTCCCCTAGGGGAGAGATGGAGG + Intergenic
1034022336 7:147658586-147658608 CCCTGCAGGGGGAGATTTGGCGG - Intronic
1034071861 7:148193880-148193902 CTCCACATGGGGAGAGTGGGAGG - Intronic
1036245029 8:7108768-7108790 CTCCCCTAGGGGAGAGATGGAGG - Intergenic
1036255715 8:7205033-7205055 CTCCCCCAGGGGAGAGATGGAGG + Intergenic
1036361769 8:8082466-8082488 CTCCCCCAGGGGAGAGATGGAGG - Intergenic
1036889200 8:12584560-12584582 CTCCCCCAGGGGAGAGATGGAGG + Intergenic
1036896789 8:12642698-12642720 CTCCCCTAGGGGAGAGATGGAGG + Intergenic
1038319017 8:26511817-26511839 CTCCCCACTGGGATATTTAGAGG + Intronic
1039489423 8:37936403-37936425 CTCCCAAAGGAGGGATTAGGAGG + Intronic
1041080970 8:54214525-54214547 GTCCCCCAGGGGAGATGTCGTGG - Intergenic
1042311191 8:67380739-67380761 CACCCCAAGGGAAGAATGGGGGG + Intergenic
1042747741 8:72125776-72125798 CACCCCAAGGGAAGAATTAGAGG + Intergenic
1047723107 8:127660511-127660533 CTCCCCAGGGCCAGATGTGGTGG - Intergenic
1055086067 9:72315345-72315367 TTCCCCAAGGTGAGACTGGGGGG - Intergenic
1056414341 9:86361945-86361967 ATCCCCAAGTGGATATGTGGTGG - Intergenic
1056688110 9:88783496-88783518 CTCCCAAATAGGAGATTTGCTGG + Intergenic
1056739685 9:89243685-89243707 CACCCCAAGGGAAGAATTAGGGG - Intergenic
1057306247 9:93913781-93913803 CTCCCCAGTGAGAGATTGGGTGG + Intergenic
1060229332 9:121815113-121815135 CTCCCCAAGGGTAGAAGGGGAGG + Intergenic
1060823362 9:126673805-126673827 ATCCCCACGGGGAGATTGGATGG + Intronic
1061449761 9:130661627-130661649 CTCCCCGGGAGGAGATTTCGAGG - Intergenic
1187129658 X:16490200-16490222 CACAGCAAGGGGAGATTTTGAGG - Intergenic
1190827210 X:54028586-54028608 CTCACCCAGGAGACATTTGGAGG - Intronic
1190889459 X:54555962-54555984 CTCCTCAAGGGCAGAGATGGAGG - Intronic
1193731932 X:85112500-85112522 CCGCCCAAGGGAAGAATTGGTGG - Intergenic
1193917791 X:87387457-87387479 CTCTCCATGGGAAGATTGGGAGG - Intergenic
1195641425 X:107179411-107179433 CTCCAAAAGGAGAGAGTTGGGGG - Intronic
1200763147 Y:7058233-7058255 ATCCCCAAGTGGAGGTATGGTGG - Intronic