ID: 1127908146

View in Genome Browser
Species Human (GRCh38)
Location 15:63392487-63392509
Sequence ATGCTGTCCTGGGGGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127908137_1127908146 27 Left 1127908137 15:63392437-63392459 CCCTCAGACTGAAGAGTCAATGG No data
Right 1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG No data
1127908139_1127908146 26 Left 1127908139 15:63392438-63392460 CCTCAGACTGAAGAGTCAATGGG No data
Right 1127908146 15:63392487-63392509 ATGCTGTCCTGGGGGATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127908146 Original CRISPR ATGCTGTCCTGGGGGATCTA AGG Intergenic
No off target data available for this crispr