ID: 1127913063

View in Genome Browser
Species Human (GRCh38)
Location 15:63434420-63434442
Sequence CACCGCAGGCGTCCCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127913060_1127913063 12 Left 1127913060 15:63434385-63434407 CCTACAGTCTGGTTGAGAACACG No data
Right 1127913063 15:63434420-63434442 CACCGCAGGCGTCCCTGGCCTGG No data
1127913059_1127913063 13 Left 1127913059 15:63434384-63434406 CCCTACAGTCTGGTTGAGAACAC No data
Right 1127913063 15:63434420-63434442 CACCGCAGGCGTCCCTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127913063 Original CRISPR CACCGCAGGCGTCCCTGGCC TGG Intergenic
No off target data available for this crispr