ID: 1127916414

View in Genome Browser
Species Human (GRCh38)
Location 15:63459111-63459133
Sequence CGCCCACCCGGAACACCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127916414_1127916422 -6 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916422 15:63459128-63459150 TGGGCGTGGGCTCGGCGGGCGGG 0: 3
1: 9
2: 11
3: 41
4: 374
1127916414_1127916426 9 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916426 15:63459143-63459165 CGGGCGGGCGTGGGCTTGGCAGG No data
1127916414_1127916423 -1 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916423 15:63459133-63459155 GTGGGCTCGGCGGGCGGGCGTGG No data
1127916414_1127916428 21 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916428 15:63459155-63459177 GGCTTGGCAGGCCGTGCATTGGG No data
1127916414_1127916429 26 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916429 15:63459160-63459182 GGCAGGCCGTGCATTGGGAGCGG No data
1127916414_1127916420 -10 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916420 15:63459124-63459146 CGGGTGGGCGTGGGCTCGGCGGG 0: 55
1: 502
2: 596
3: 441
4: 530
1127916414_1127916427 20 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916427 15:63459154-63459176 GGGCTTGGCAGGCCGTGCATTGG No data
1127916414_1127916425 5 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916425 15:63459139-63459161 TCGGCGGGCGGGCGTGGGCTTGG No data
1127916414_1127916421 -7 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916421 15:63459127-63459149 GTGGGCGTGGGCTCGGCGGGCGG No data
1127916414_1127916424 0 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916424 15:63459134-63459156 TGGGCTCGGCGGGCGGGCGTGGG No data
1127916414_1127916430 30 Left 1127916414 15:63459111-63459133 CCAGCGGGTGTTCCGGGTGGGCG No data
Right 1127916430 15:63459164-63459186 GGCCGTGCATTGGGAGCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127916414 Original CRISPR CGCCCACCCGGAACACCCGC TGG (reversed) Intergenic
No off target data available for this crispr