ID: 1127918536

View in Genome Browser
Species Human (GRCh38)
Location 15:63475145-63475167
Sequence TTTGCCGGAGTCGAGGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127918536_1127918544 26 Left 1127918536 15:63475145-63475167 CCAGGGGCCTCGACTCCGGCAAA No data
Right 1127918544 15:63475194-63475216 AGGTGCCAGCCCTCCCGCCCAGG No data
1127918536_1127918542 6 Left 1127918536 15:63475145-63475167 CCAGGGGCCTCGACTCCGGCAAA No data
Right 1127918542 15:63475174-63475196 CAGGGCTGCTCTAAAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127918536 Original CRISPR TTTGCCGGAGTCGAGGCCCC TGG (reversed) Intergenic
No off target data available for this crispr