ID: 1127918536 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:63475145-63475167 |
Sequence | TTTGCCGGAGTCGAGGCCCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1127918536_1127918542 | 6 | Left | 1127918536 | 15:63475145-63475167 | CCAGGGGCCTCGACTCCGGCAAA | No data | ||
Right | 1127918542 | 15:63475174-63475196 | CAGGGCTGCTCTAAAGAGCCAGG | No data | ||||
1127918536_1127918544 | 26 | Left | 1127918536 | 15:63475145-63475167 | CCAGGGGCCTCGACTCCGGCAAA | No data | ||
Right | 1127918544 | 15:63475194-63475216 | AGGTGCCAGCCCTCCCGCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1127918536 | Original CRISPR | TTTGCCGGAGTCGAGGCCCC TGG (reversed) | Intergenic | ||