ID: 1127918542

View in Genome Browser
Species Human (GRCh38)
Location 15:63475174-63475196
Sequence CAGGGCTGCTCTAAAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127918534_1127918542 10 Left 1127918534 15:63475141-63475163 CCAGCCAGGGGCCTCGACTCCGG No data
Right 1127918542 15:63475174-63475196 CAGGGCTGCTCTAAAGAGCCAGG No data
1127918536_1127918542 6 Left 1127918536 15:63475145-63475167 CCAGGGGCCTCGACTCCGGCAAA No data
Right 1127918542 15:63475174-63475196 CAGGGCTGCTCTAAAGAGCCAGG No data
1127918530_1127918542 28 Left 1127918530 15:63475123-63475145 CCAAGGAAAGATGAGCAGCCAGC No data
Right 1127918542 15:63475174-63475196 CAGGGCTGCTCTAAAGAGCCAGG No data
1127918537_1127918542 -1 Left 1127918537 15:63475152-63475174 CCTCGACTCCGGCAAAGCTAGCC No data
Right 1127918542 15:63475174-63475196 CAGGGCTGCTCTAAAGAGCCAGG No data
1127918540_1127918542 -9 Left 1127918540 15:63475160-63475182 CCGGCAAAGCTAGCCAGGGCTGC No data
Right 1127918542 15:63475174-63475196 CAGGGCTGCTCTAAAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127918542 Original CRISPR CAGGGCTGCTCTAAAGAGCC AGG Intergenic
No off target data available for this crispr