ID: 1127918544

View in Genome Browser
Species Human (GRCh38)
Location 15:63475194-63475216
Sequence AGGTGCCAGCCCTCCCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127918537_1127918544 19 Left 1127918537 15:63475152-63475174 CCTCGACTCCGGCAAAGCTAGCC No data
Right 1127918544 15:63475194-63475216 AGGTGCCAGCCCTCCCGCCCAGG No data
1127918541_1127918544 -2 Left 1127918541 15:63475173-63475195 CCAGGGCTGCTCTAAAGAGCCAG No data
Right 1127918544 15:63475194-63475216 AGGTGCCAGCCCTCCCGCCCAGG No data
1127918536_1127918544 26 Left 1127918536 15:63475145-63475167 CCAGGGGCCTCGACTCCGGCAAA No data
Right 1127918544 15:63475194-63475216 AGGTGCCAGCCCTCCCGCCCAGG No data
1127918534_1127918544 30 Left 1127918534 15:63475141-63475163 CCAGCCAGGGGCCTCGACTCCGG No data
Right 1127918544 15:63475194-63475216 AGGTGCCAGCCCTCCCGCCCAGG No data
1127918540_1127918544 11 Left 1127918540 15:63475160-63475182 CCGGCAAAGCTAGCCAGGGCTGC No data
Right 1127918544 15:63475194-63475216 AGGTGCCAGCCCTCCCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127918544 Original CRISPR AGGTGCCAGCCCTCCCGCCC AGG Intergenic
No off target data available for this crispr