ID: 1127922136

View in Genome Browser
Species Human (GRCh38)
Location 15:63502706-63502728
Sequence CGGAGGAAACAGAAGGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 266}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127922124_1127922136 17 Left 1127922124 15:63502666-63502688 CCGAACAAGGGGTTATGGATGCT 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG 0: 1
1: 0
2: 1
3: 28
4: 266
1127922122_1127922136 23 Left 1127922122 15:63502660-63502682 CCAGGGCCGAACAAGGGGTTATG 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG 0: 1
1: 0
2: 1
3: 28
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127922136 Original CRISPR CGGAGGAAACAGAAGGTTGG TGG Intergenic
900005658 1:47918-47940 TGGAGGAGATAGAAGGTTGAAGG - Intergenic
900193513 1:1361764-1361786 CGTAGGAGAAAGAAGGCTGGCGG - Intronic
900518417 1:3094207-3094229 CGGAGGAGACAGGTGGCTGGTGG + Intronic
902207572 1:14880548-14880570 GGGAGGAATCAAATGGTTGGGGG + Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
904406995 1:30297921-30297943 TGGAGAATTCAGAAGGTTGGAGG - Intergenic
904472352 1:30743758-30743780 AGGGGGAAACAGATGGTGGGTGG - Intronic
905022185 1:34825583-34825605 TGGAGGAAACAGGCGGCTGGCGG + Intronic
905178121 1:36150682-36150704 GGGAGGAAACAGAATGTCTGGGG - Intronic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
905781035 1:40709506-40709528 CGGAGGAAACAAAAGGCAGCAGG - Intronic
906942241 1:50265483-50265505 TGGAGGAAATAGCAGGTGGGAGG - Intergenic
907727667 1:57034982-57035004 TGGTGGAAACAGGTGGTTGGTGG - Intronic
910606600 1:89092104-89092126 CAGAGGAAAAAGAAAATTGGAGG + Intergenic
911808506 1:102243098-102243120 AGGAGAAAACAGAAGGGTTGGGG + Intergenic
912383910 1:109261904-109261926 TGGAGGGCACAGAGGGTTGGGGG + Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913174993 1:116265294-116265316 TGGAGGGAACAGAAAGTGGGGGG + Intergenic
913201828 1:116501068-116501090 TGGAGGAACTAGAAGGCTGGGGG - Intergenic
913310994 1:117493115-117493137 AGGAGAAAACAGAAGGATAGAGG - Intronic
915964506 1:160294562-160294584 TGGAGGCTACAGAAGGTTTGGGG - Exonic
917396665 1:174601224-174601246 CGGAGGAAAAAGTAGTTTTGTGG - Intronic
917563767 1:176188757-176188779 GGGGGGAAATAGCAGGTTGGTGG - Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
918702664 1:187624992-187625014 ACTAGGAAACTGAAGGTTGGGGG - Intergenic
919586881 1:199449989-199450011 AAGAGGAGACAGAAAGTTGGGGG + Intergenic
919850025 1:201666323-201666345 GGGAGGCAAGACAAGGTTGGGGG - Intronic
922187935 1:223292971-223292993 AGGAGGGAACAGTAGGTGGGAGG + Intronic
922663032 1:227446962-227446984 AAGAGCAAACAGAAGGCTGGGGG - Intergenic
922728167 1:227935533-227935555 TGGAGGATACAGAATGTTAGAGG - Intronic
922775632 1:228213166-228213188 GGGAGGAGACAGGAAGTTGGGGG - Intronic
922997094 1:229972926-229972948 CTGAGGACACAGTAGGTTGCAGG - Intergenic
924064191 1:240207332-240207354 CAGAGGAAACAGAGTGTTCGTGG - Exonic
924455695 1:244217328-244217350 AGGAGGAAACCGAGGGTTGCTGG - Intergenic
1062879485 10:966555-966577 CCGAGGAAGCCGAAGGCTGGTGG + Intergenic
1063490219 10:6457273-6457295 CCAAGGAAACAGAAGTTTGTTGG - Intronic
1063764232 10:9119536-9119558 CGTAGGAAACAGAAGTTGGGAGG + Intergenic
1066057200 10:31693325-31693347 AGGAGCAAAGAGAAGCTTGGTGG - Intergenic
1067491394 10:46707386-46707408 CAAAGGAAACAGGAGGGTGGAGG - Intergenic
1067603270 10:47632992-47633014 CAAAGGAAACAGGAGGGTGGAGG + Intergenic
1068332953 10:55596948-55596970 CAAAGGAAACAGGAGGGTGGAGG + Intronic
1068862708 10:61864152-61864174 CCAAGGAAAGAGAAAGTTGGAGG - Intergenic
1068864899 10:61884532-61884554 AGCAGGTAACAGAAGGTTGGTGG + Intergenic
1072069278 10:91900811-91900833 AAGGGGAAACAGAAGGTCGGAGG + Intergenic
1076802537 10:132837262-132837284 TGGAGGACACAGAAGGATGGAGG - Intronic
1081611680 11:44566602-44566624 GTGAGGAAACTGAAGTTTGGAGG - Intronic
1083385382 11:62305531-62305553 AGGAAAAAACAGAAGGTTAGAGG - Intergenic
1084359874 11:68662218-68662240 CGTAAGAAACAGAAGGTGGAGGG + Intergenic
1085080738 11:73632113-73632135 AAGAGCAAACAGAAGGTTGGAGG + Intergenic
1085931554 11:81089343-81089365 GGGAGGAAGCAGAAGGAAGGAGG - Intergenic
1086404380 11:86487522-86487544 AGGAAGAACCAGAAGGTGGGAGG + Intronic
1086420211 11:86631068-86631090 CCTGGGAAACAGGAGGTTGGAGG + Intronic
1087108195 11:94433129-94433151 TGGAGGAAACAGATGGTTTCAGG - Intronic
1088190646 11:107224566-107224588 CTGAGGAAAAAGAATGTTGCTGG + Intergenic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1089068484 11:115680172-115680194 CCGAGGAAGCAGAATTTTGGTGG + Intergenic
1091324697 11:134677481-134677503 AGGAGGGAACAGGAGGTTGGCGG - Intergenic
1091560635 12:1610293-1610315 CACAGGCAAGAGAAGGTTGGAGG - Intronic
1093741463 12:22693707-22693729 CGGGGGAAAAAGAGGGATGGGGG - Intergenic
1094818685 12:34208906-34208928 CCGAGGAACCTGAGGGTTGGAGG + Intergenic
1095233385 12:39768608-39768630 AGAAGGAAACAGCTGGTTGGTGG + Intronic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097027044 12:56064440-56064462 CTGAGGAAACAGGCGGATGGTGG + Intergenic
1097152946 12:56993164-56993186 GACAGGAAGCAGAAGGTTGGTGG + Intergenic
1099892080 12:88602193-88602215 GGGAAGAAACAGAATGTTGATGG - Intergenic
1101433118 12:104643391-104643413 ATGAGGAAGCAGAAGTTTGGAGG + Intronic
1101921874 12:108939692-108939714 AAAAGGAAACAGAATGTTGGTGG - Intronic
1102988406 12:117297286-117297308 AGCAGGGAACTGAAGGTTGGGGG + Intronic
1103153890 12:118666970-118666992 ATGAGGAAACTGAAGCTTGGTGG + Intergenic
1104151786 12:126091089-126091111 AGTAGGAAACAGGGGGTTGGGGG - Intergenic
1105378878 13:19868093-19868115 AGGAACAAAGAGAAGGTTGGGGG - Intergenic
1106440904 13:29769018-29769040 TTGAGGAAACAGAAGCTTAGAGG - Intronic
1108477874 13:50839256-50839278 AGGAGGAAACTGAGGCTTGGAGG - Intronic
1109221685 13:59646729-59646751 AGGAGGAAACAGTAGTTTTGTGG + Intergenic
1109297606 13:60553386-60553408 CGGAGGATACAACAGTTTGGAGG - Intronic
1111269357 13:85860684-85860706 CGGAAGAAACACATGGTAGGAGG - Intergenic
1111985298 13:95059925-95059947 ATGAGGAAACTGAAGCTTGGAGG + Intronic
1113055477 13:106262459-106262481 TGGAGGAAACAGCAGCTTAGAGG - Intergenic
1113339633 13:109409483-109409505 CAGGAGAAAAAGAAGGTTGGTGG + Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114265319 14:21070067-21070089 CGGAGAAGAAAGAAGGTTGCCGG + Intronic
1114416261 14:22546518-22546540 AGGAGGAAACAGAGGTTTGCCGG - Intergenic
1114482961 14:23046837-23046859 CAGAGGACCCAGAAAGTTGGTGG + Intergenic
1115115858 14:29880197-29880219 AGGAGGAAACAGTAGTTTCGAGG + Intronic
1115409204 14:33053284-33053306 AGGAGGAAAGAGATGGTTAGAGG - Intronic
1119686113 14:76632672-76632694 CTGAGGAGAGGGAAGGTTGGAGG + Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1121425796 14:93851011-93851033 AGGATGAAATAGAAGGTTGTAGG - Intergenic
1122506393 14:102234479-102234501 CGGAGGAACCAGAGGCCTGGAGG - Intronic
1124661790 15:31555732-31555754 CGGAGGAGTCAGATGGATGGTGG + Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1127303591 15:57681327-57681349 CAAAGGAAACCAAAGGTTGGAGG - Intronic
1127836264 15:62793575-62793597 CTGGGGAAAAAGAAGTTTGGAGG - Intronic
1127922136 15:63502706-63502728 CGGAGGAAACAGAAGGTTGGTGG + Intergenic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130242181 15:82204716-82204738 AGGAGGAAAGAGTAGGTGGGCGG - Intronic
1130458192 15:84136106-84136128 AGGAGGAAAGAGTAGGTGGGCGG + Intergenic
1131062450 15:89412181-89412203 CGGAGGAAACTGAGGCTTAGAGG - Intergenic
1131612277 15:93977719-93977741 AGGAGGAAGCAGTAGGTTGAAGG - Intergenic
1132447857 15:101943004-101943026 TGGAGGAGATAGAAGGTTGAAGG + Intergenic
1137247746 16:46719376-46719398 CGGAGGAAACAGAATCCTGGAGG + Intronic
1137396477 16:48119053-48119075 GGGAGGAAATTGAAGGTGGGAGG - Intronic
1137840364 16:51635842-51635864 AGGTTGAAACAGAAGGCTGGTGG + Intergenic
1139651055 16:68362249-68362271 AGGAGGAAACAGAGGCTTGGAGG - Intronic
1141517184 16:84553352-84553374 CTGGGGCAACAGAAGATTGGGGG - Intronic
1142965939 17:3581369-3581391 GGGAGGGAGCAGAAGGGTGGTGG - Intronic
1144818780 17:18056344-18056366 CTGAGTATCCAGAAGGTTGGGGG + Intronic
1148572340 17:48680225-48680247 TGGAGGAAACTGGAGCTTGGAGG - Intergenic
1150562086 17:66302824-66302846 CGGAGGCAAGAGGTGGTTGGGGG + Exonic
1151156390 17:72126313-72126335 CGGAGAGAACAAAAGGTTTGGGG - Exonic
1151941671 17:77296118-77296140 CGGAGGACACAGCAGGGAGGTGG + Intronic
1151990766 17:77572579-77572601 CTGAGGAAACAGCAGGGAGGAGG - Intergenic
1155303179 18:24452076-24452098 GGGAGGGAACAGAAGTTAGGAGG + Exonic
1155592043 18:27438513-27438535 TGGAGGAGGCAGAAGGTGGGAGG + Intergenic
1155625146 18:27826005-27826027 AGGTGGAAACTGAAGGTTGAAGG + Intergenic
1156358714 18:36364894-36364916 GGGAGAAAGCAGAAGGGTGGTGG + Intronic
1156407227 18:36794425-36794447 CGGAGGAACCAGGAGGTCAGCGG - Intronic
1160835288 19:1122070-1122092 CGGAGGGAAAAGGAGGATGGAGG - Intronic
1161170920 19:2812185-2812207 GTGAGGAAACTGGAGGTTGGAGG - Intronic
1162146006 19:8612322-8612344 GGGAGCAAACAGGAGGGTGGGGG - Intergenic
1162532849 19:11245804-11245826 CGGGAGAAAAAGAAGGTAGGAGG - Exonic
1164931342 19:32178489-32178511 CGGAGGAAGGAGAGAGTTGGTGG + Intergenic
1165095219 19:33406532-33406554 CGGAGGAAACAGCAAGGTGGTGG + Intronic
1165796021 19:38519566-38519588 AGGAAGAGTCAGAAGGTTGGTGG - Intronic
1166853822 19:45772629-45772651 AGGATGAAACAGTAAGTTGGTGG - Exonic
1168340491 19:55620618-55620640 ATGGGGAAACAGAAGCTTGGAGG + Intergenic
1168663321 19:58183898-58183920 CTGAGGAAACCGAAGTTGGGAGG - Intronic
924996673 2:367645-367667 TGGTGGAGACAGAAGGGTGGGGG + Intergenic
925600832 2:5607294-5607316 AGGAGGAAAGTGAGGGTTGGTGG + Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927889317 2:26738543-26738565 CAGAGGGAGCAGCAGGTTGGTGG + Intergenic
927914223 2:26924659-26924681 CGGAGGAAGAAGCAGGTTTGGGG + Intronic
928325369 2:30315370-30315392 CGGAGGAAAAAGAAGGTGTGAGG + Intronic
929016502 2:37502667-37502689 CACAAGAAAAAGAAGGTTGGTGG + Intergenic
929574909 2:43045373-43045395 CAAAGGAAAAAGAAAGTTGGGGG - Intergenic
930301277 2:49618968-49618990 TGGGGGAAACAGGAGGTTGGGGG + Intergenic
931066222 2:58590598-58590620 GAGAGGAGACACAAGGTTGGAGG - Intergenic
931759797 2:65406615-65406637 GGGTGGAAATGGAAGGTTGGGGG + Intronic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
935038879 2:99406317-99406339 AGGAGCACAAAGAAGGTTGGTGG - Exonic
935334764 2:102006232-102006254 AGGAGGACACAGCAGCTTGGTGG + Intronic
935847481 2:107182400-107182422 TGAAGGAAACTGAAGGTTAGTGG - Intergenic
936284044 2:111167384-111167406 TGGAACAAACAGAAGGTTGCTGG - Exonic
936496925 2:113030355-113030377 TGGGTGAAATAGAAGGTTGGGGG + Intronic
938200454 2:129368271-129368293 GTGAGGAGACACAAGGTTGGGGG - Intergenic
940661716 2:156553593-156553615 GGGAGGGAACAAAAGGTAGGGGG - Intronic
947229331 2:227869621-227869643 GGGAGGAAACAGAGGGCTGAAGG - Intergenic
947658784 2:231851057-231851079 ATGAGGAAACTGAAGGTTAGAGG + Intergenic
947744979 2:232502875-232502897 CGGAAGAGACGGGAGGTTGGGGG + Intergenic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
948471307 2:238182074-238182096 ATGAGGATACAGAAGGCTGGAGG - Exonic
948592321 2:239059415-239059437 CGGAGGAAACCCAAGTTCGGGGG + Intronic
1168872917 20:1146326-1146348 CTGAGGAAACAGTAGGTTAGAGG + Intronic
1169128639 20:3150252-3150274 GGGAGAAAGCAGAAGGTTGAGGG + Intronic
1169460815 20:5793208-5793230 CCGAGGAAAAAAAAAGTTGGAGG - Intronic
1169984696 20:11430776-11430798 GGGAGGCTACAGAAGGTTGATGG + Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175974777 20:62705222-62705244 CTGAGGGAAGAGAAGGTTGGAGG + Intergenic
1176768877 21:13051670-13051692 AGGAGAAAACAAAAGTTTGGTGG + Intergenic
1178380358 21:32102546-32102568 AGTAGGAAACAGATGGTTTGTGG - Intergenic
1180261796 21:46675258-46675280 CAGAGGGAACAGAAGGTTGGAGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181515786 22:23411473-23411495 CTGAGGGAACAGCTGGTTGGTGG - Intergenic
1181624775 22:24115831-24115853 TGGAGGAAGCAGCAGGCTGGTGG - Intronic
1181936071 22:26439826-26439848 TGGAGGAGACAGAAGGACGGAGG - Intronic
1183319449 22:37156152-37156174 CAGAGGGAACAGGAGGCTGGAGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
950564416 3:13758593-13758615 ATGAGGAAACTGAAGCTTGGAGG + Intergenic
950935236 3:16832731-16832753 AGGAGGACACAGATGCTTGGTGG - Intronic
951511531 3:23507799-23507821 AGGAGGAAAGAGATGGTTTGAGG + Intronic
952883411 3:37999023-37999045 CGCAGGAACCAGAAGCTCGGCGG + Exonic
955058866 3:55479861-55479883 AGGAGGAAACAGCAGTTTGAGGG + Intronic
955399687 3:58582639-58582661 AGGAGGAAACAGAGAGTTGAAGG - Intronic
957125087 3:76148577-76148599 GGGAGGCTCCAGAAGGTTGGTGG - Intronic
959497525 3:107068763-107068785 GTGAGGAAAAAGAAGGTAGGGGG - Intergenic
959873199 3:111351659-111351681 GGGAGGATACAGTAGGTAGGAGG + Intronic
959881322 3:111447625-111447647 GGGAGGAAACAAAAGATTGTTGG + Intronic
960636476 3:119789684-119789706 CCGAGGAAACAGAAGTTGTGAGG - Intronic
964993621 3:162845898-162845920 TTGAGGAAAGACAAGGTTGGAGG - Intergenic
967527393 3:190510589-190510611 TAGAGGAAGCAGAAGGTTTGTGG + Intergenic
968810206 4:2796348-2796370 GGGAGAAGAGAGAAGGTTGGGGG - Intronic
969397621 4:6932915-6932937 AGGATGAAACAGCATGTTGGCGG + Intronic
969976880 4:11112086-11112108 CAGAGGAAACAGATGGCTGTTGG - Intergenic
970535681 4:17027711-17027733 CTGATGAAACACAAGGTGGGTGG + Intergenic
971082591 4:23231519-23231541 CAGAAGAAACACGAGGTTGGTGG + Intergenic
971192607 4:24441675-24441697 AGGAAGAAACAGAAGGAAGGAGG + Intergenic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
973743203 4:53938129-53938151 CGGAGGAAACAGAGCCATGGGGG + Intronic
974229113 4:59086588-59086610 CTGCGGAAAGAGAAGGATGGAGG + Intergenic
978189727 4:105896798-105896820 CGGAGGAAATAGAAAGTTCGGGG + Intronic
978331545 4:107618571-107618593 AAGAGGAAACAGAAGGTGGTGGG + Intronic
979436809 4:120702986-120703008 TGGGGGAAAGAGAAGGCTGGTGG - Intronic
980004418 4:127525105-127525127 GTGAGGAAACAGAAGCTTAGAGG - Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
982077655 4:151753944-151753966 TGATGGAAACAGAAGGTAGGTGG - Intronic
983882718 4:172951393-172951415 TGAAGGAAGCAGAAGGTTGGTGG - Intronic
984865991 4:184281305-184281327 AGCAGGAAACAGCAGGGTGGGGG - Intergenic
986020867 5:3801245-3801267 AGAAAGAAACAGACGGTTGGTGG - Intergenic
986717253 5:10533382-10533404 CGGAGGAGACGGAGGGCTGGGGG - Intergenic
987396642 5:17430686-17430708 CCCAGGAACCAGAGGGTTGGGGG + Intergenic
987566160 5:19589341-19589363 CGGAGGAAATATAATCTTGGAGG - Intronic
987965328 5:24865049-24865071 TGGAGGAAACAGGAGATTGTGGG + Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989098818 5:37806005-37806027 GGGTGGAAAAAGAAGGCTGGAGG + Intergenic
991282155 5:64927492-64927514 GTGGGGAAACAGAAGTTTGGTGG - Intronic
991661482 5:68955272-68955294 AGAAAGCAACAGAAGGTTGGGGG + Intergenic
991919575 5:71642279-71642301 GGGAGGAATGAGAAGGTGGGAGG + Intronic
991967608 5:72108039-72108061 CGCAGGAGGCAGAAGGGTGGGGG + Intronic
992579911 5:78162372-78162394 CTGAGGAAAAAGAATGTTGAAGG + Intronic
994287633 5:97989584-97989606 GGGAGGAAAAAGAAGGTAGGAGG - Intergenic
995092281 5:108192534-108192556 CCTAGGAAACATAAGCTTGGTGG + Intronic
995733609 5:115273441-115273463 AGGAGGAAAGGGAAGTTTGGAGG - Intronic
996230185 5:121053697-121053719 GGGAAGAAACTGAAGGATGGAGG + Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
997701646 5:135905867-135905889 AGGAGGAAAAAGGAGATTGGAGG - Intergenic
997779924 5:136646389-136646411 GGGAGGGAAAAGAAGGGTGGAGG + Intergenic
998566892 5:143223758-143223780 AGGAAGAAACCCAAGGTTGGAGG + Exonic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1001031337 5:168265561-168265583 AGAAGGACACAGAAGGTGGGTGG + Intergenic
1001484569 5:172110600-172110622 GGCAGGAAACAGCAGGCTGGAGG + Intronic
1002682295 5:180976168-180976190 AGGAGGAAACACAAGGAAGGTGG - Intergenic
1005861677 6:29907282-29907304 AGGAGGAGACTGCAGGTTGGGGG + Intergenic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007923824 6:45635016-45635038 GGCAGGACACAGAAGGCTGGTGG + Intronic
1010928039 6:81767372-81767394 AGGAGGAAACTGAAGCTTAGAGG - Intergenic
1011390601 6:86848414-86848436 AAGAAGAAATAGAAGGTTGGAGG - Intergenic
1012961295 6:105624795-105624817 ATGAGGAAACTGAGGGTTGGAGG + Intergenic
1015437205 6:133203018-133203040 AGGAGGTAACACAAGCTTGGGGG + Intergenic
1018524052 6:164687642-164687664 AGGAAGAAAGAGAAGGATGGAGG - Intergenic
1018836554 6:167488631-167488653 CTAAGGAAACTGAAGCTTGGAGG - Intergenic
1020034939 7:4959088-4959110 CGGCGGCAGCAGCAGGTTGGAGG + Exonic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1023600814 7:41880277-41880299 GGGAGAAACCAGAAGGTCGGGGG + Intergenic
1023937806 7:44751609-44751631 CTGCGGAGACAGAAGGCTGGTGG + Intronic
1024528772 7:50373136-50373158 GGAAGGAAACAGAAGCATGGGGG - Intronic
1026153005 7:67803875-67803897 AGGAGGAGACAGAAGGTAGAAGG + Intergenic
1026864423 7:73814460-73814482 CGCAGGACACAGAAGCTTGGTGG - Intronic
1028839504 7:95412704-95412726 GAGAGTAATCAGAAGGTTGGTGG + Intronic
1028982142 7:96979185-96979207 AGGAGGAGACAGAATGTTGAAGG + Intergenic
1029361074 7:100089032-100089054 CGGAGGAAGCAGCGGGATGGAGG + Exonic
1029805447 7:102991300-102991322 TGGGGGAAAAGGAAGGTTGGAGG + Intronic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1032676279 7:134132743-134132765 CTGAGGAAAGAGAAGGGTGTGGG + Intronic
1033086461 7:138346425-138346447 TGGAGGAAACAGAAGCTGGGAGG + Intergenic
1033365790 7:140672037-140672059 CGGAGGGAGCAGAGGGTCGGTGG - Intronic
1034492509 7:151401365-151401387 CTGAGGAAACAGAGGGTTTAGGG - Intronic
1034914228 7:155023590-155023612 CTGAGGATACAGGCGGTTGGGGG - Intergenic
1035004447 7:155644769-155644791 CGGAGGACAGAGAAGGGAGGGGG - Exonic
1035582211 8:747502-747524 CGGAGGACACAGGCGGCTGGAGG + Intergenic
1036762268 8:11517625-11517647 GGGAGGAAACAGCATGTTGGGGG + Intronic
1037234829 8:16705848-16705870 CAGAAGAAACAGGAGGCTGGAGG + Intergenic
1037275829 8:17177282-17177304 AGGAGGTAAAAGGAGGTTGGGGG + Intronic
1038486242 8:27937254-27937276 GGCAGGAAGCAGGAGGTTGGAGG - Intronic
1039419350 8:37422727-37422749 ATGAGGAAACTGAAGCTTGGAGG - Intergenic
1040500152 8:47998431-47998453 CAGAGGAACCAGAAGCCTGGAGG + Intergenic
1040892752 8:52334903-52334925 CGGTGGTGACAGAAGGTGGGTGG - Intronic
1045493817 8:102691194-102691216 CAGAGGAAACAGATGGGTTGTGG + Intergenic
1046611691 8:116432716-116432738 TGTGGCAAACAGAAGGTTGGTGG - Intergenic
1048480774 8:134790599-134790621 AGGAGAAAACAGAAGGTGTGAGG - Intergenic
1048533297 8:135270425-135270447 CTGGGAAAAGAGAAGGTTGGAGG + Intergenic
1048694765 8:137013233-137013255 CGGACCAAACACAAGGTTGTGGG + Intergenic
1049265702 8:141666809-141666831 TGGAGCAAAAAGAGGGTTGGAGG + Intergenic
1051173694 9:14343981-14344003 TGGAAGAAACAGAAGTTTTGAGG + Intronic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1053016016 9:34662602-34662624 AGGAGGCTGCAGAAGGTTGGGGG + Exonic
1053480877 9:38415396-38415418 GGGAGGAGACAGAAGGCAGGAGG + Intronic
1053898943 9:42773651-42773673 CAGTGGAAAAAGAAAGTTGGAGG - Intergenic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056774013 9:89498281-89498303 GGGAGGAAAAGAAAGGTTGGGGG - Intergenic
1056964011 9:91151148-91151170 TGAAGGAAACAGAAGTTTTGTGG - Intergenic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1058269307 9:102950063-102950085 AGGAGGAAAGGGAATGTTGGTGG - Intergenic
1059351451 9:113668182-113668204 TGGGGGAAACAGAATGGTGGTGG - Intergenic
1059653655 9:116337709-116337731 AGGAGGTAAGAGAAGGTGGGGGG - Intronic
1060307940 9:122433306-122433328 CTTGGGAAAGAGAAGGTTGGTGG - Intergenic
1060752698 9:126183903-126183925 AGGAGGAAACTGAGGCTTGGGGG + Intergenic
1061163779 9:128911006-128911028 GGGAGGACTCAGCAGGTTGGTGG - Intronic
1062133000 9:134910270-134910292 TGGAGGAAACAGGTGGTTGCTGG - Intronic
1186458825 X:9732197-9732219 GGGAGGAAACAGAGGATTGTAGG + Intronic
1187581555 X:20612685-20612707 GGGAGGACTCAGATGGTTGGGGG + Intergenic
1189387994 X:40553222-40553244 CGGAGGAAATAGAAGACTTGTGG + Intergenic
1189488709 X:41452891-41452913 TGGAGGAAACAGAAGTGCGGAGG - Intronic
1189949961 X:46218881-46218903 TGTAGGAATCAGAAGTTTGGGGG - Intergenic
1192215676 X:69156585-69156607 GGGAGGAAACAGGAGGAAGGGGG + Intergenic
1198561779 X:137858233-137858255 GGGAGGAAACAGGAGGCTGGGGG + Intergenic
1201466634 Y:14288591-14288613 TGCAGGAGACAGAAGGTAGGTGG + Intergenic