ID: 1127923595

View in Genome Browser
Species Human (GRCh38)
Location 15:63515850-63515872
Sequence GTGGACAGCAGGACTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 517
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127923595_1127923597 -7 Left 1127923595 15:63515850-63515872 CCACTCTCAGTCCTGCTGTCCAC 0: 1
1: 0
2: 2
3: 66
4: 448
Right 1127923597 15:63515866-63515888 TGTCCACAGACAATCTCTGTAGG 0: 1
1: 0
2: 3
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127923595 Original CRISPR GTGGACAGCAGGACTGAGAG TGG (reversed) Intronic
900001721 1:18175-18197 GTGGGCAGCAGGGCAGAGACTGG + Intergenic
900021441 1:188698-188720 GTGGGCAGCAGGGCAGAGACTGG + Intergenic
900166415 1:1245861-1245883 GTGGGCCCCAGGACTGGGAGGGG - Intronic
900249890 1:1663074-1663096 GGGGACAGCACGACTGAGCAAGG + Exonic
900260926 1:1728984-1729006 GGGGACAGCACGACTGAGCAAGG + Intronic
900666988 1:3822286-3822308 GTAGACACCAGCGCTGAGAGCGG + Intronic
901433661 1:9233569-9233591 GTGGCCGGCAGGACTGAATGGGG - Intergenic
901732803 1:11292765-11292787 GTGGTCCGCAGGGCTCAGAGAGG - Intronic
901951045 1:12746984-12747006 CTGGACATCAGCACAGAGAGTGG - Intronic
902373985 1:16021708-16021730 GCACACAGCAGGACAGAGAGGGG - Intronic
902378910 1:16043543-16043565 GCACACAGCAGGACAGAGAGGGG - Intergenic
902616559 1:17626557-17626579 CAGGCCAGCAGCACTGAGAGTGG - Intronic
902728039 1:18350274-18350296 GTGGGGAGCAGGAGTGAGGGTGG + Intronic
902826415 1:18977577-18977599 GGTAACAGCAGGAGTGAGAGAGG + Intergenic
903808906 1:26023495-26023517 GTAGAAGGCAGGACTGAGATGGG + Intronic
904382111 1:30118613-30118635 GAGGACAGCAGGGCTCAGGGAGG + Intergenic
904614466 1:31742541-31742563 ATGGCCAGCTGGACTGTGAGAGG - Intronic
905010840 1:34746101-34746123 GGAGCCAGCAGGACTGAGAGGGG - Intronic
905239139 1:36571237-36571259 GGGGACAGCTGGGCTGAGATGGG - Intergenic
905389443 1:37626761-37626783 CTGGGAGGCAGGACTGAGAGAGG + Intronic
906197822 1:43939928-43939950 GTGGACAGCAGATCTGAAGGAGG - Intergenic
906370738 1:45251267-45251289 GTGGACTCCAGAACTGAGATAGG + Intronic
906534852 1:46545733-46545755 GGGGAGAGCATGGCTGAGAGGGG + Intronic
906951873 1:50341277-50341299 GAGGAAAGCAGAAATGAGAGTGG + Intergenic
907456690 1:54580908-54580930 GAAGACAGCGGGAGTGAGAGTGG + Intronic
907734996 1:57103810-57103832 GGGGACAGAAGGACTAAGCGGGG + Intronic
912382358 1:109254388-109254410 CTGGACAGCAGGGCTGGGGGAGG + Intronic
912469512 1:109896744-109896766 GTGGAGAGCGGGAAAGAGAGGGG + Intergenic
914667345 1:149842164-149842186 GAGGAACGCTGGACTGAGAGTGG + Intergenic
914668422 1:149851626-149851648 GAGGAACGCTGGACTGAGAGTGG - Intronic
914753590 1:150551004-150551026 CTGGAAAGCAGAACTAAGAGTGG + Intronic
916051580 1:161040155-161040177 GTGGCTAGCAGAACTGAGAAGGG + Intronic
916055685 1:161067828-161067850 GTGGAAGGAAGGACAGAGAGAGG - Intronic
916156660 1:161856485-161856507 GTGGAAAGCAGAAGGGAGAGAGG - Intronic
917734430 1:177907572-177907594 GAGGACAGCAGGACTCAAAATGG + Intergenic
918341392 1:183570613-183570635 ATGGAAACCAGGACTGAGAGAGG + Intronic
919755803 1:201065782-201065804 GTGGGCACCAGGGCTGGGAGCGG + Intronic
919975163 1:202605672-202605694 GTGGACAACTCCACTGAGAGTGG - Exonic
920304972 1:205012885-205012907 GAGGACAGCCTGCCTGAGAGAGG - Intronic
920434767 1:205940707-205940729 CTGCAGAGCAGGACTGTGAGGGG + Intronic
921310451 1:213837484-213837506 GTGGAGAGCATGAATGAGTGGGG - Intergenic
921626832 1:217386408-217386430 CTGAACAGCAGGAATGAGAGGGG + Intergenic
922719975 1:227895356-227895378 GGAGACAGCAGGGCTGAGGGGGG + Intergenic
923502685 1:234578989-234579011 GTGGGCAGGGGGACTGTGAGGGG + Intergenic
923557343 1:235011350-235011372 GTCGACTGCAAGGCTGAGAGGGG - Intergenic
923678547 1:236100710-236100732 GTGGAGAGCTGGACTGAGACTGG + Intergenic
923981427 1:239328362-239328384 GAGGACAGCAGGCTTGAGAAAGG - Intergenic
924041424 1:239988078-239988100 CTGGGCAGCAGGAGTGGGAGTGG + Intergenic
1063751993 10:8959849-8959871 GAGAACAGCAGGAGTGGGAGAGG + Intergenic
1067414379 10:46092368-46092390 GTGGAGATCAGGACAGACAGGGG + Intergenic
1067563294 10:47319090-47319112 GTGTAAGGCAGGACTGAGAGAGG + Intergenic
1067832178 10:49616621-49616643 GGGGAAAGCAGGGTTGAGAGAGG - Intronic
1069615984 10:69806388-69806410 GAGGACAGGAGGCCTGAGAGGGG + Intronic
1069862305 10:71479412-71479434 CAGGAAAGCAGGAGTGAGAGGGG + Intronic
1071464849 10:85929748-85929770 CTGGGGAGCAGGACTGGGAGTGG - Intronic
1073376748 10:103041788-103041810 GTGGCCAGCAGGAAGGGGAGGGG - Intronic
1073445732 10:103579193-103579215 GTGAAGAGCAGGAGTGGGAGCGG - Intronic
1074712078 10:116185697-116185719 GTGGGGAGCAGGACAGGGAGGGG - Intronic
1074715640 10:116215997-116216019 TTGGACAGCAGGGCTAAGAAAGG - Intronic
1074854699 10:117464968-117464990 GAGGTCACCAGGCCTGAGAGTGG + Intergenic
1074869251 10:117564087-117564109 GGGGAAGGCAGGACTGAGAGAGG - Intergenic
1075070884 10:119319230-119319252 GGAGAAAGCAGGAGTGAGAGTGG + Intronic
1075919404 10:126197942-126197964 GTGAACTGCAGGAATGGGAGAGG + Intronic
1076642813 10:131930327-131930349 GCGGCCAGCAGGCCTCAGAGTGG - Intronic
1076847509 10:133076475-133076497 GTGGGCAGGAGGACCCAGAGGGG - Intronic
1076854852 10:133111100-133111122 GTGGCCAGCAGGATTAGGAGGGG - Intronic
1077118137 11:894642-894664 GATGACAGGAGGACTGAGAGTGG + Intronic
1077145538 11:1042662-1042684 GTGAAGAGCAGGACTGGGTGGGG + Intergenic
1078441947 11:11375642-11375664 GAGGAGAGCAAGACTGAGAGAGG - Intronic
1078628734 11:12982499-12982521 GTGGAAATCAGGGCTCAGAGAGG - Intergenic
1078762330 11:14261233-14261255 TTGGAAAACAGGACTGGGAGTGG - Intronic
1078923037 11:15848947-15848969 GTGGACACCAAGGCTCAGAGAGG - Intergenic
1078947414 11:16085179-16085201 GTGAACAGCAACACTGAGAGAGG + Intronic
1079271149 11:18987183-18987205 GAGCACAGCAGGAGTGAGACTGG - Intergenic
1079355257 11:19725315-19725337 GTGGGCGGCAGCACTGAGGGAGG - Intronic
1080167590 11:29258113-29258135 TTGAACAGCATGAATGAGAGTGG + Intergenic
1080184203 11:29460331-29460353 GGGGACAGAGAGACTGAGAGGGG + Intergenic
1080415724 11:32068281-32068303 ATGGAAAGCATGACTCAGAGAGG - Intronic
1081572856 11:44302343-44302365 GTGCACAGCATGAATGTGAGCGG - Intronic
1082096089 11:48130491-48130513 GTGGTCAGCACGACGGAGATCGG + Exonic
1083800082 11:65041503-65041525 GTGGCCAGCAGCACGGAGGGCGG - Exonic
1084375032 11:68770895-68770917 GTACGCAGCAGGACTGAGATCGG - Intronic
1084935100 11:72582724-72582746 GTGGGCTGCAGGGCTGTGAGGGG - Intronic
1088336396 11:108709125-108709147 TTGGACAGCAGTGGTGAGAGGGG + Intronic
1089287576 11:117417516-117417538 GTGGGCAGCACGCCTGGGAGGGG + Intergenic
1089370629 11:117953509-117953531 CTGCCCAGCATGACTGAGAGAGG - Intergenic
1089773349 11:120818881-120818903 CTGGACACCAGGGGTGAGAGTGG + Intronic
1089896671 11:121936916-121936938 GTGGTCAGCAGGTCTGAACGTGG + Intergenic
1090004470 11:122989461-122989483 GAGGACAGCAGGCCTTAGAAAGG - Intergenic
1090327177 11:125899124-125899146 GTAGAAAGCAGGAGTAAGAGTGG + Intronic
1091223553 11:133944902-133944924 ACTGACAGCAGGACTGGGAGGGG - Intronic
1091234053 11:134007790-134007812 TTGGACAGCAAGGCTGAGCGTGG + Intergenic
1091374804 12:18297-18319 GTGGGCAGCAGGGCAGAGAATGG + Intergenic
1091916415 12:4274004-4274026 GGGGAAAGCAGGAGGGAGAGGGG + Exonic
1092155850 12:6281053-6281075 GGGGACAGGTGGACAGAGAGGGG - Intergenic
1092196781 12:6554634-6554656 GTGGAGAGCAGGGCTGACAGGGG - Intronic
1094366815 12:29691755-29691777 GTGTACTGGAGGTCTGAGAGAGG + Intronic
1094414376 12:30201802-30201824 GTGAACAGCTGGAGTGGGAGAGG - Intergenic
1095185836 12:39199481-39199503 GGCAACAGCGGGACTGAGAGTGG - Intergenic
1095376013 12:41529890-41529912 GTGGAGAGAAGGAAAGAGAGTGG - Intronic
1096225924 12:49867010-49867032 GTGGACAGCAGGAGTGTCGGGGG + Exonic
1096478869 12:51924779-51924801 GTGCAAGGCAGGACTGAGGGAGG - Intergenic
1096491283 12:52014585-52014607 ATGGTCAGCAGGACGGAGCGGGG + Intronic
1096657984 12:53103610-53103632 GAGGACAGAAGGGCTGGGAGGGG + Exonic
1097221518 12:57454030-57454052 GTGGTCAGGAGGGCTGAGACTGG + Intronic
1097308187 12:58091613-58091635 GTGGGCAGAAGGAGAGAGAGAGG + Intergenic
1097550204 12:61058576-61058598 TTGAACAGCAGTAGTGAGAGAGG + Intergenic
1097635406 12:62115649-62115671 GTGGGAAGCAGGACTGTGGGAGG - Intronic
1098163382 12:67669314-67669336 GGGGACAGCAGGAGTGAGCCAGG - Intergenic
1098294394 12:68989746-68989768 GTGGACAACAGAAGTGAAAGAGG + Intergenic
1098682676 12:73377790-73377812 GTGGACAACTGGATTGATAGTGG - Intergenic
1100229523 12:92593122-92593144 GTGGAAAGGAGGAAAGAGAGAGG + Intergenic
1102218530 12:111178939-111178961 GGGGAAAGCAGGGCTGAGAGAGG + Intronic
1102506912 12:113389501-113389523 ATGGACAGAAGGACAGACAGAGG - Exonic
1102664856 12:114563155-114563177 CAGGTCAGCAGGACTGACAGTGG - Intergenic
1103412410 12:120721765-120721787 GTGGACGCCAGTTCTGAGAGTGG - Exonic
1103568036 12:121826873-121826895 CTGGACACCAGGCCTGAGATGGG + Intronic
1103877912 12:124142958-124142980 GCAGACAGCAGGCCTGAAAGAGG - Intronic
1104381543 12:128312110-128312132 GAAGAAAGCAGAACTGAGAGAGG - Intronic
1104618202 12:130288529-130288551 CTGGACAGCAGGAGGGAGAATGG - Intergenic
1109410177 13:61954551-61954573 GTGGAATGAAGGAATGAGAGTGG - Intergenic
1110119528 13:71865535-71865557 GCGGACAGCAGCGCTGAGAGGGG + Intronic
1110617446 13:77556738-77556760 GTGGACAGAAGGGCAGAGAGAGG + Intronic
1110760967 13:79229755-79229777 GTGGACTGTAGTACAGAGAGTGG + Intergenic
1112346245 13:98592484-98592506 GTGGACACCTGGATTAAGAGAGG + Intergenic
1112788157 13:102974364-102974386 GTGGACAGAAGGACAGAGACGGG - Intergenic
1113448415 13:110388011-110388033 GTGGACTGCATGACTGAAAATGG + Intronic
1113675279 13:112202678-112202700 GTGGACAGCCAGCCTGTGAGTGG - Intergenic
1113679869 13:112235806-112235828 GTGGCAGGCAGGACTCAGAGGGG - Intergenic
1113880051 13:113619925-113619947 GTGGACAGCAGGAGTGAGTGGGG + Intronic
1114032378 14:18588289-18588311 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114077159 14:19167315-19167337 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1114085005 14:19232249-19232271 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1114533827 14:23410938-23410960 GCAGACAGCAGGGTTGAGAGAGG - Intergenic
1114879382 14:26765029-26765051 CTGGACAGCAGGACAGAGGCAGG + Intergenic
1115302688 14:31902191-31902213 GTGGAGAGAATGACTCAGAGTGG - Intergenic
1115772633 14:36682312-36682334 GTGGAGGGCAGGTCTGTGAGTGG + Intronic
1116966604 14:51021673-51021695 GTGGCCAGCAGGCTTCAGAGTGG - Intronic
1118964606 14:70567975-70567997 GTTGACAGGAGGCATGAGAGGGG - Intergenic
1120012959 14:79437835-79437857 GAGGACAGCATGACTCAAAGAGG - Intronic
1121210671 14:92206165-92206187 TTGGACAGATGGACTGGGAGGGG - Intergenic
1121442324 14:93956878-93956900 GTGCAGAGCAGGAGTGAAAGAGG + Intronic
1121495735 14:94390392-94390414 AGGGACAGCAGGGCTTAGAGTGG - Intronic
1122055354 14:99094371-99094393 TTGGACAGCTGGACAGAGGGTGG - Intergenic
1202843721 14_GL000009v2_random:147713-147735 GGCGATGGCAGGACTGAGAGTGG - Intergenic
1202913125 14_GL000194v1_random:137953-137975 GGCGATGGCAGGACTGAGAGTGG - Intergenic
1202879530 14_KI270722v1_random:44732-44754 GGCGACGGCAGGACTGAGAGTGG + Intergenic
1124135840 15:27035710-27035732 GTGGACAGCAGGATTGGGGAAGG + Intronic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124500111 15:30220926-30220948 GTAGAAAGCAGGACTGGGACTGG + Intergenic
1124513573 15:30347953-30347975 GTGGGCAGGAGGAGTGAGGGTGG - Intergenic
1124729348 15:32182812-32182834 GTGGGCAGGAGGAGTGAGGGTGG + Intergenic
1124743464 15:32317740-32317762 GTAGAAAGCAGGACTGGGACTGG - Intergenic
1127707364 15:61560453-61560475 GTTGACAGCAGGGCTGAGCTGGG - Intergenic
1127849123 15:62897777-62897799 GTGGTCTGCAGGTCTCAGAGGGG - Intergenic
1127923595 15:63515850-63515872 GTGGACAGCAGGACTGAGAGTGG - Intronic
1128326242 15:66725952-66725974 GTGGGCAGGAGGACTGAGGAAGG - Intronic
1128539509 15:68516719-68516741 GTGGAAACCAAGGCTGAGAGCGG + Intergenic
1128611884 15:69080690-69080712 GTGGACCTCAGGTGTGAGAGAGG + Intergenic
1129037203 15:72657701-72657723 GTAGACAGCAAGCCAGAGAGGGG - Intronic
1129114389 15:73357194-73357216 GAGGAAAGCAAGACTCAGAGAGG + Intronic
1129168823 15:73795624-73795646 GTGGCCTGCAGGAATGAGAGAGG + Intergenic
1129212684 15:74079525-74079547 GTAGACAGCAAGCCAGAGAGGGG + Intronic
1129397715 15:75261561-75261583 GTAGACAGCAAGCCAGAGAGGGG - Intronic
1129401326 15:75285838-75285860 GTAGACAGCAAGCCAGAGAGGGG - Intronic
1130149866 15:81303294-81303316 GTGGACAGGGTGAATGAGAGAGG + Intronic
1130607657 15:85332169-85332191 GTGGAAAGTAGGACTGGAAGAGG + Intergenic
1131435304 15:92417143-92417165 GAGGACATCAAAACTGAGAGAGG + Intronic
1132102016 15:99030455-99030477 GTGCACAGCTGGACTCGGAGAGG + Intergenic
1132451790 15:101972765-101972787 GTGGGCAGCAGGGCAGAGACTGG - Intergenic
1132455103 16:17864-17886 GTGGGCAGCAGGGCAGAGACTGG + Intronic
1132846615 16:2003750-2003772 GTGGTGAGCAGGACTGGGATGGG + Intronic
1133458123 16:5960963-5960985 GAAGACAGCAGGGCTGAGATGGG + Intergenic
1133732748 16:8590409-8590431 CTGGAGAGCAGGGCTGGGAGTGG - Intergenic
1134909015 16:18007357-18007379 GAGGACAGCAGGTCTGGGTGCGG - Intergenic
1135945415 16:26860625-26860647 GTGGTCAACAGGAATGAGGGAGG + Intergenic
1135975577 16:27107199-27107221 GTAGAAAGCAGGAAGGAGAGAGG - Intergenic
1136372678 16:29846041-29846063 GTGGGCAGCAGGCCTGGGTGGGG + Intronic
1137302813 16:47169720-47169742 GTGAATAGCAGGAGTGAAAGTGG + Intronic
1137562056 16:49509240-49509262 GGGGACAGCAGGGATGGGAGTGG - Intronic
1137609011 16:49806421-49806443 GTGGAAAGAAGGAAAGAGAGTGG - Intronic
1138578163 16:57922084-57922106 GTGGGCAACTGGACTGAGGGTGG + Intronic
1139499462 16:67350269-67350291 GTTGACAGCAGGATTGAAATGGG + Exonic
1140548315 16:75834473-75834495 GTGGAAAGCAGAACTAAAAGTGG - Intergenic
1141593704 16:85085106-85085128 GTGCACAGCAGGCCTGCGAGGGG + Intronic
1142731607 17:1862355-1862377 GTGGACAGCAGGGACAAGAGAGG - Intronic
1143100653 17:4502973-4502995 GAGGGCAGCAGGCCTCAGAGCGG + Intronic
1143187419 17:5018973-5018995 GTGGACAGCAGGACGGGATGCGG - Intronic
1143430537 17:6879812-6879834 GGCAATAGCAGGACTGAGAGTGG - Intronic
1143627780 17:8121171-8121193 ATGGAGAGCAGGACTGAGGGTGG + Exonic
1143642475 17:8206982-8207004 GGGGACACCAGGGCTGGGAGTGG + Intronic
1144383365 17:14725281-14725303 GTGGACAGAGGAGCTGAGAGAGG - Intergenic
1147164467 17:38586061-38586083 CTGGACAGAAGGCCTGAGACAGG + Intronic
1147198556 17:38783989-38784011 GAGGGCAGCAGGAGGGAGAGGGG - Intronic
1148457772 17:47820192-47820214 GTGCTCAGCAGGTCAGAGAGTGG - Exonic
1149397701 17:56261764-56261786 GTGCCCACCCGGACTGAGAGTGG + Intronic
1150010152 17:61495595-61495617 CTGGACAGCAAAAGTGAGAGAGG - Intergenic
1150221378 17:63497498-63497520 GTGGTCTGGAGGACTGGGAGGGG - Intronic
1150231309 17:63552507-63552529 GTGGACAGCAGAACTGGAAATGG + Intronic
1150825956 17:68475413-68475435 CTATACAGCAGGACTTAGAGAGG - Intergenic
1151436221 17:74099482-74099504 GTGGAGAGAAGGACTCAGAGAGG - Intergenic
1151449788 17:74191535-74191557 CTGGAGAGGTGGACTGAGAGAGG - Intergenic
1152078078 17:78170708-78170730 GGGGACAGCAGTAGTGGGAGAGG + Intronic
1152217708 17:79044063-79044085 GGGAACAGCAGGAGTGGGAGGGG + Exonic
1152227834 17:79100922-79100944 GTGGACAGCAGGGCTCAGCCTGG + Intronic
1152637229 17:81435122-81435144 GTGGGCAGGAGGAGAGAGAGTGG - Intronic
1153411570 18:4799397-4799419 GTGGACAGCAGAGCTGAAAGAGG - Intergenic
1153753777 18:8260128-8260150 GTGGACACGAGCAGTGAGAGAGG + Intronic
1156437959 18:37153981-37154003 GGGGACAGCAGGAGGGAAAGGGG - Intronic
1157416873 18:47510776-47510798 GTGGCCTAGAGGACTGAGAGTGG - Intergenic
1157563394 18:48663962-48663984 GTGGAAAGAAGGCCGGAGAGAGG + Intronic
1159377881 18:67617218-67617240 GTGGACAGTAGTACAGATAGTGG + Intergenic
1159807646 18:72975206-72975228 GTGGACAGTAGGACTGTGTGGGG + Intergenic
1159972293 18:74669345-74669367 GAGGAAAGCAGGAAGGAGAGAGG - Intronic
1160131684 18:76231040-76231062 TAGGACAGCAGGACTCTGAGGGG - Intergenic
1160716269 19:578216-578238 GGGCACAGCGGGACGGAGAGGGG - Intronic
1160873591 19:1287480-1287502 GAGGACAGCAGGAGACAGAGGGG - Intronic
1160929602 19:1564062-1564084 GGGGATAGCAGCACTCAGAGAGG - Intronic
1161142041 19:2653805-2653827 GTGGATAGGAGGGCTGAGTGAGG - Intronic
1161278154 19:3430589-3430611 GTGGGCACCAGGGCTGGGAGAGG - Intronic
1161490007 19:4556531-4556553 GGGGGCGGCAGGACTGATAGGGG + Intronic
1161745346 19:6056216-6056238 GTGGAGAGGAGGACGGAGAGTGG + Intronic
1162843838 19:13376015-13376037 GCCCACAGCAAGACTGAGAGAGG + Intronic
1163637449 19:18443842-18443864 GTGGACAGAGGGACGGAGGGAGG + Exonic
1163739919 19:19005136-19005158 GTGGACTGCAGGCCCCAGAGCGG - Intronic
1163758191 19:19119490-19119512 GAGAGGAGCAGGACTGAGAGGGG - Intronic
1164594899 19:29526301-29526323 GTGGACGACCGGACAGAGAGAGG + Intergenic
1164787230 19:30943119-30943141 GTGGAGTGCAGGACTCAGAGGGG - Intergenic
1165154322 19:33778001-33778023 GTGGACAGCACCGCTGGGAGAGG - Intergenic
1165325283 19:35111171-35111193 GTGGAAGGCAGGTCTGAGATGGG + Intergenic
1165897361 19:39150832-39150854 GTGGGCAGCAGGCCTGAACGGGG - Intronic
1166521098 19:43480745-43480767 GTGGAAACCAAGACTCAGAGAGG + Intronic
1166569518 19:43784850-43784872 CTGGACTGCTGGTCTGAGAGAGG + Intergenic
1166867175 19:45846721-45846743 CTGGAAAGCAGGACTGAGGGAGG + Intronic
1166880899 19:45929380-45929402 GGGGACAGAAAGACAGAGAGGGG + Intergenic
1166880904 19:45929421-45929443 GGAGACAGAAGGACAGAGAGAGG + Intergenic
1167211913 19:48138966-48138988 GAGGACAGAGGGACTGAGAAAGG - Intronic
1167607756 19:50490555-50490577 GTGGACAGCCTGAGTGACAGGGG + Exonic
1167852323 19:52211603-52211625 GTGGTAAGCAGGAGTGGGAGTGG - Intronic
1202655149 1_KI270708v1_random:13741-13763 GGCGACGGCAGGACTGAGAGTGG + Intergenic
925125316 2:1450612-1450634 CAGGTCAGCAGGACTGAGAAGGG - Intronic
925149017 2:1601850-1601872 GTGGGCAGCAGAGCAGAGAGTGG + Intergenic
925733952 2:6944132-6944154 GAGGACAGCGGGTCTGAGGGAGG + Intronic
925780594 2:7378347-7378369 GCAGACAGCTGGGCTGAGAGTGG - Intergenic
925793296 2:7515392-7515414 GGGGACAGCAGGTATCAGAGAGG - Intergenic
925820905 2:7799284-7799306 GTGCACAGAAGGAGTGAGTGAGG + Intergenic
925888134 2:8411150-8411172 ATTTACAGGAGGACTGAGAGAGG - Intergenic
926014033 2:9433095-9433117 GTGGACTGCAAGAGTGAAAGGGG + Intronic
927199412 2:20569054-20569076 ATGATCAGCAGGACTGACAGTGG + Intronic
927199644 2:20570432-20570454 ATGATCAGCAGGACTGACAGTGG - Intronic
928126636 2:28620934-28620956 GGGGACAGCAGGACTAAATGTGG + Exonic
928831685 2:35493438-35493460 TCAGACAGCAGGACTGGGAGAGG + Intergenic
931271909 2:60711064-60711086 CTAGACTCCAGGACTGAGAGAGG - Intergenic
931437279 2:62259215-62259237 GTGGACAACAGGACTTAAAATGG + Intergenic
932983181 2:76695157-76695179 ATGGCCAGCAGAACTGAGAATGG - Intergenic
933645503 2:84809809-84809831 GTGGGAAGCAGGAAAGAGAGAGG + Intronic
933737516 2:85507113-85507135 GTGGGGAGCGGGGCTGAGAGAGG + Intergenic
934140764 2:89045102-89045124 GTGGAAAACAGGAATTAGAGAGG - Intergenic
934228472 2:90155440-90155462 GTGGAAAACAGGAATTAGAGAGG + Intergenic
934502989 2:94873709-94873731 GTGGAGCGCAGGACTGGGTGGGG + Intronic
936568001 2:113595232-113595254 GTGGGCAGCAGGGCAGAGACTGG - Intergenic
937312399 2:120910229-120910251 GTGGTCAGCAGGCCTGAGCCAGG + Intronic
937313373 2:120915753-120915775 GTGCACACCAGGGCTGGGAGAGG - Intronic
937875769 2:126824182-126824204 GTGGATGGCAGGGCTGAGTGGGG - Intergenic
938847499 2:135225030-135225052 TTGGACAGTAGGACTGAGAAAGG - Intronic
938900123 2:135792552-135792574 GGGCACAGCAGGAGTGAGACTGG + Intronic
940288514 2:152055589-152055611 GAGCACAGCAGGACTCAGTGGGG - Intronic
940855477 2:158725676-158725698 GTCTCCATCAGGACTGAGAGTGG + Intergenic
941110680 2:161416728-161416750 GTGGCTGGCTGGACTGAGAGAGG - Exonic
942413505 2:175735283-175735305 GAGCACTGCAGGACTGGGAGCGG - Intergenic
942870204 2:180725601-180725623 GTAGACAGCAGACCTGAGAGGGG + Intergenic
945448037 2:209961180-209961202 GGGGACAGCAAGAGTCAGAGAGG + Intronic
946143277 2:217709860-217709882 CTGGGCAGCAGGAATCAGAGGGG + Intronic
946590449 2:221241323-221241345 AAGGACAGCAGGACGTAGAGGGG + Intergenic
947610889 2:231524603-231524625 GGTGACAGCAGGGCTGAGATTGG + Exonic
948594966 2:239073949-239073971 ATGGGCAGCAGGACTGAGGGGGG + Intronic
948594978 2:239073984-239074006 GGGGGCCGCAGGACTGAGGGGGG + Intronic
948594989 2:239074020-239074042 GGGAGCAGCAGGACTGAGGGGGG + Intronic
948594993 2:239074038-239074060 GGGGGCAGCAGGACTGAGTGGGG + Intronic
948602708 2:239116382-239116404 CTGGACAGCTGGCCAGAGAGAGG - Intronic
948731241 2:239965041-239965063 GTTCACAGCAGTACTGACAGAGG + Intronic
1168848027 20:958684-958706 GTGGAGGGCAGGTCTGAGGGTGG + Exonic
1170329272 20:15190733-15190755 GTGCACAGGAGGCCTTAGAGTGG + Intronic
1171364299 20:24613357-24613379 GGAGACGGCAGGACAGAGAGCGG - Intronic
1172096297 20:32462149-32462171 GGGGAAAGCAGGGCTGATAGGGG + Intronic
1172115729 20:32572546-32572568 GTGCATTACAGGACTGAGAGCGG - Intronic
1172425205 20:34851319-34851341 GTGGGCAGCAGGAAAGAGAGTGG + Exonic
1173437563 20:43046593-43046615 TTGGACAGCGGGACTGAGGTCGG + Intronic
1173473170 20:43339050-43339072 GTGGAAAGCAGGAGAGGGAGCGG + Intergenic
1174203039 20:48820348-48820370 GGGGAAACCAGGACTCAGAGAGG + Intronic
1174284059 20:49459854-49459876 CTGGACAGCTGGACGGTGAGAGG + Intronic
1174559934 20:51423806-51423828 GTGGACAGCAAGTCTGGGAAGGG + Intronic
1174653705 20:52152301-52152323 GGGGACAGCAGAAGTGACAGTGG - Exonic
1175851601 20:62096977-62096999 GGAGCCAGCAGGGCTGAGAGGGG + Intergenic
1175891456 20:62317843-62317865 GTGGACAGCAGGGCAGGGAAGGG + Intronic
1176235930 20:64053563-64053585 AGGGCCAGCAGGACCGAGAGGGG + Intronic
1176632474 21:9152623-9152645 GGCGATGGCAGGACTGAGAGTGG - Intergenic
1176640834 21:9302194-9302216 GGCGATGGCAGGACTGAGAGTGG + Intergenic
1176708862 21:10133679-10133701 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1176952474 21:15064346-15064368 CTGGACAGCAGGACGGAGAGCGG + Intronic
1177245047 21:18512363-18512385 GTGGGCAGCAGGAGTGATTGAGG - Intergenic
1177371706 21:20213072-20213094 GTGGACAGAAGGCCTGAAAGAGG + Intergenic
1178795923 21:35744281-35744303 GTGGACAGAGGAAATGAGAGTGG - Intronic
1178922682 21:36748499-36748521 GTGGACGGCAGACCTGGGAGGGG + Exonic
1179116188 21:38494762-38494784 CTGGAAAGCAGGATTGAGAATGG - Intronic
1179553712 21:42159631-42159653 GTGGAACCCAGGACTCAGAGGGG + Intergenic
1179654547 21:42837330-42837352 GTGGACAGTGGGACAGAGAGAGG - Intergenic
1180292965 22:10860944-10860966 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180349860 22:11791577-11791599 GGCGATGGCAGGACTGAGAGTGG + Intergenic
1180374139 22:12075029-12075051 GGCGATGGCAGGACTGAGAGTGG + Intergenic
1180388349 22:12200675-12200697 GGCGATGGCAGGACTGAGAGTGG - Intergenic
1180456489 22:15515346-15515368 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180495771 22:15890366-15890388 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1180837287 22:18936223-18936245 GTGGACAGCGGGACGAAGCGGGG + Exonic
1181955372 22:26584374-26584396 GTGGACAGAGGGATGGAGAGCGG + Intronic
1182550883 22:31100197-31100219 GAGGAGAGCAGGACAGAGAAAGG - Intronic
1183368160 22:37417978-37418000 GGGGACAGCAGGAGGGAGGGAGG + Intronic
1183629455 22:39024498-39024520 TTCAACAGCAGGACTGAGACGGG + Intronic
1183632913 22:39044367-39044389 TTCAACAGCAGGACTGAGATGGG + Intronic
1183638675 22:39080361-39080383 TTCAACAGCAGGACTGAGATGGG + Intronic
1183724800 22:39582589-39582611 GAGGGCACCAAGACTGAGAGTGG + Intronic
1184094616 22:42309776-42309798 GAGGACAGCAAGGCTCAGAGAGG - Intronic
1184483880 22:44764849-44764871 GTCAACTGTAGGACTGAGAGAGG + Intronic
1184717707 22:46291296-46291318 GTGGACAGGAGGGCTGAGGATGG + Intronic
1184847831 22:47100000-47100022 CTGGGCTGCAGGCCTGAGAGTGG + Intronic
1184897614 22:47420678-47420700 GTGGAGAGTGGGAGTGAGAGAGG - Intergenic
1185161416 22:49232189-49232211 GTGGATGTCAGGTCTGAGAGGGG - Intergenic
1203287380 22_KI270734v1_random:161522-161544 GTGGACAGCGGGACGAAGCGGGG + Intergenic
950145049 3:10642972-10642994 GTTGACAGCAGGACTGGGGCAGG + Intronic
950199134 3:11030468-11030490 GAGGACAGCAGCACAGAGAATGG + Intronic
950296618 3:11837879-11837901 GAGGGCAGCAGGAGGGAGAGTGG + Intronic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
951400108 3:22222268-22222290 ATGGCCAGCAGAATTGAGAGTGG - Intronic
951475399 3:23100370-23100392 GGCGGGAGCAGGACTGAGAGAGG + Intergenic
951529738 3:23687121-23687143 GAGGAAACTAGGACTGAGAGAGG + Intergenic
952216570 3:31284056-31284078 GGGAACAGCTAGACTGAGAGTGG - Intergenic
952378683 3:32787718-32787740 GTGGACAGCAGTCCTGAGGTGGG + Intergenic
952813065 3:37422449-37422471 GTGGATAGCATGACTCAGAGTGG - Intronic
953317440 3:41942019-41942041 GTGGAGGGCAGGACTTTGAGAGG - Intronic
953463926 3:43103446-43103468 CTGGACAGCAGGGCTGGGTGAGG - Intronic
954130868 3:48560302-48560324 GTGGACAGCAGGGCTGGGGGTGG - Intronic
954289881 3:49644032-49644054 GTGGGCCACAGGACTGAGGGAGG - Intronic
955659663 3:61284051-61284073 GTGAACAGCAGGAATGTTAGAGG - Intergenic
955663680 3:61328024-61328046 GTGGACAGCAGGGCTAAAAGGGG - Intergenic
956621622 3:71226722-71226744 GTGGAGAGCAAGACTGCGAGAGG - Intronic
956882572 3:73526027-73526049 GTGCACAGCAGAGCTGAGATTGG - Intronic
957099319 3:75808358-75808380 GGCGATGGCAGGACTGAGAGTGG - Intergenic
957874319 3:86125618-86125640 GTGGAAAGAGGGACTAAGAGAGG + Intergenic
959542483 3:107556063-107556085 GTGGACAGAAGGACTTGGTGTGG - Intronic
959962415 3:112313775-112313797 TTGGAGAGAAGGACTGAGAGTGG + Intergenic
960903830 3:122577883-122577905 GGGGACAGCAGGGCTGAGCCTGG + Intronic
961002741 3:123384877-123384899 GGGGACAACAGGACTGTCAGAGG + Intronic
961043283 3:123692474-123692496 GTGGGGATCAGGACTGGGAGGGG + Intronic
961550658 3:127668967-127668989 GTGGAAAGCATGTCTAAGAGAGG + Intronic
962403443 3:135080575-135080597 GGGGACAGCAGGTGTGAGAGGGG + Intronic
962450498 3:135512342-135512364 GTGGACAACAGGAGTGTGTGAGG + Intergenic
962703277 3:138019566-138019588 GTGGAGAGTTGGACTGAAAGAGG - Intronic
965391291 3:168107588-168107610 GTGAACACCAGATCTGAGAGTGG + Intergenic
966473295 3:180316966-180316988 ATGGAGAGCAGGACAGGGAGAGG - Intergenic
967841597 3:194009258-194009280 GGAGACAGCAGCAGTGAGAGAGG + Intergenic
1202746059 3_GL000221v1_random:102830-102852 GGCGACGGCAGGACTGAGAGTGG - Intergenic
968679021 4:1903296-1903318 CTGGAGAGCAGAACTGTGAGTGG + Intronic
968808053 4:2787878-2787900 GGGGACAGTAGGACTGAGCTGGG - Intergenic
968986805 4:3880107-3880129 GAGGGCAGCAGGCCTGAGTGTGG - Intergenic
969031999 4:4222987-4223009 GAGGAAAGCAGGACTCAGAAAGG + Intronic
969050719 4:4370923-4370945 GGGGACAGCAAGACAGGGAGAGG + Intronic
969235602 4:5863319-5863341 GAGGACAGCACAACTCAGAGAGG + Intronic
969348660 4:6585135-6585157 GTGCACAGCAGAGGTGAGAGGGG - Intronic
971837781 4:31791243-31791265 GTGGAGAGCAGGGCAGGGAGGGG - Intergenic
972708504 4:41570059-41570081 GTGGACAGCAGGTCCCAGCGTGG + Intronic
974192300 4:58521647-58521669 GGGGACAGAAGGAGAGAGAGAGG - Intergenic
974771171 4:66415622-66415644 GTTCACAGTAGGACTGGGAGAGG - Intergenic
976671810 4:87662298-87662320 GTGGACAGCAAGCCTGAGGGAGG + Exonic
976835586 4:89369437-89369459 GGGGACAGCAGGTGAGAGAGAGG + Intergenic
978016175 4:103749320-103749342 GTGGTCAGCAGCACCGAGAAGGG - Intergenic
980095652 4:128487620-128487642 GTGGAGTGCAGGAGTGAGTGAGG + Intergenic
980969065 4:139552473-139552495 GTGGCCAGCAGGACAGTCAGAGG - Intronic
981108667 4:140910765-140910787 GTGCTCAGCAGGACTGGGATAGG - Intronic
981832827 4:149021805-149021827 GAGGAAAGCAGGCCTGTGAGAGG - Intergenic
982079285 4:151771941-151771963 GTCGACAGCCTGCCTGAGAGAGG - Intergenic
983750769 4:171266812-171266834 GTTGAAGGCAGGCCTGAGAGTGG - Intergenic
1202755722 4_GL000008v2_random:60468-60490 GGCGATGGCAGGACTGAGAGTGG + Intergenic
985837165 5:2280069-2280091 GAGGACAGGAGGAAAGAGAGAGG - Intergenic
986227361 5:5828322-5828344 GAGACCAGCAGGGCTGAGAGTGG + Intergenic
986227964 5:5835046-5835068 TTGGACAGGAGGGCTGTGAGCGG - Intergenic
988278568 5:29114499-29114521 GTGCACAGCAGGAGTGAGACTGG - Intergenic
988840071 5:35074905-35074927 CTGAACAGCAGAACTGAGACTGG - Intronic
989361666 5:40608385-40608407 AAGGGCAGGAGGACTGAGAGGGG - Intergenic
990190078 5:53249652-53249674 GTGGCCAGCAGGACTGTGCAAGG - Intergenic
990493957 5:56328015-56328037 GTGGAAAGGAGGGCGGAGAGTGG - Intergenic
990594625 5:57300463-57300485 GTGGCCACCCAGACTGAGAGTGG - Intergenic
990921592 5:60974121-60974143 GTGCCCACCTGGACTGAGAGTGG - Intronic
992911807 5:81402311-81402333 ATGGACAGCAGGTTTGACAGTGG + Intergenic
995259383 5:110084046-110084068 GTGGAGAGCAGGATGGAGAATGG - Intergenic
997256569 5:132433240-132433262 GTGGGAAGTAGGAGTGAGAGGGG - Intronic
997932439 5:138083628-138083650 GAGGATGGCAGGACAGAGAGTGG + Intergenic
999000163 5:147912082-147912104 GTGCAGAATAGGACTGAGAGAGG + Intergenic
999198777 5:149801497-149801519 GAAGCCAGCAGGACTCAGAGTGG + Intronic
999225957 5:150024745-150024767 CTGTACAGCATGCCTGAGAGAGG + Intronic
999461598 5:151761428-151761450 GTGGACTGCAGGCTTGGGAGAGG + Intronic
999548998 5:152663031-152663053 GGGGACTGCAGGACTGGAAGTGG - Intergenic
1001481505 5:172092153-172092175 GAGGCCGGCAGGAGTGAGAGTGG + Intronic
1001549028 5:172588613-172588635 GTGGACAGCCGGCGTCAGAGAGG + Intergenic
1001699411 5:173695969-173695991 GTGCTCAGCTGGACTGAGAAGGG + Intergenic
1002555630 5:180037253-180037275 GTGGAAAGAAGGACAGAGAGAGG + Intronic
1002801730 6:529376-529398 GGAGGCAGCAGGTCTGAGAGAGG + Intronic
1004014416 6:11719091-11719113 GTGGGCTGCTGGACTGAGAAGGG - Intronic
1004932586 6:20476498-20476520 GTGGAGAGAAGGAGAGAGAGGGG - Intronic
1006193518 6:32223457-32223479 GGGGACAGCTGGACTAAGAAAGG + Intronic
1006196110 6:32243565-32243587 CTGGACAGCAGCCCTGAGACAGG - Intergenic
1006341371 6:33448912-33448934 GTGGAGGGCAGCAGTGAGAGGGG - Intronic
1006364351 6:33606598-33606620 GTGGAGAGCAGAAAAGAGAGAGG + Intergenic
1006459560 6:34150495-34150517 GTGGGCAGAAGGGCTGTGAGTGG + Intronic
1006717792 6:36131172-36131194 CTGGGCAGCTGGGCTGAGAGGGG - Intronic
1006841010 6:37027894-37027916 TGGGGCAGTAGGACTGAGAGGGG + Intronic
1006843334 6:37046074-37046096 CTGGCCAGCTGGACTGGGAGGGG - Intergenic
1007340713 6:41189797-41189819 GTGGAGAGGAGGCCTGAAAGAGG + Intergenic
1007418514 6:41705954-41705976 GCTGACAGCTGGCCTGAGAGCGG + Intronic
1007763977 6:44150346-44150368 GGGGACAGCAGGATAGGGAGAGG + Intronic
1007766293 6:44162259-44162281 GTGGAAAGCAGTCCTGAGAGGGG - Intronic
1007941159 6:45782698-45782720 GTGATCAGCAGGACAGAGACAGG - Intergenic
1008041749 6:46808900-46808922 GAGGAAAGCAGAACTTAGAGAGG - Intronic
1009810470 6:68656773-68656795 GTGGAAAGCAGGGTTGGGAGTGG - Intronic
1010327186 6:74577889-74577911 GTGGATAGCTGGACTCAGGGGGG + Intergenic
1010329293 6:74603509-74603531 GGCGAGAGCAGGACTGGGAGGGG + Intergenic
1012500253 6:99880745-99880767 GTGGACGGCAAGACGGAGAGTGG + Intergenic
1013191890 6:107810578-107810600 GAGTACAGCAGGAATGTGAGTGG + Intronic
1013900407 6:115148809-115148831 TAGGACTGCAGGGCTGAGAGTGG - Intergenic
1013962203 6:115913990-115914012 GTGGAAAGCAGGACTAACTGAGG - Intergenic
1014009850 6:116462679-116462701 GTGGAAAGTGGGAGTGAGAGTGG + Intronic
1014999291 6:128194420-128194442 GTTGACTGTAGTACTGAGAGAGG - Intronic
1017113729 6:150956201-150956223 GTGCTCAGCAGGGCTGGGAGAGG + Intronic
1018921471 6:168178929-168178951 ATGGACAGCAGGCCAGGGAGAGG - Intergenic
1019979762 7:4612902-4612924 GTGCAAAGCAGGACTGTGAAAGG - Intergenic
1020158635 7:5749610-5749632 GTGGACAGCAAGACTTAAAATGG - Intronic
1020212461 7:6166778-6166800 GAGGACGGCAGCACTGAGTGAGG - Intronic
1022235392 7:28455756-28455778 GTGTAAAGGAGGAATGAGAGAGG + Intronic
1022794739 7:33722889-33722911 GTCAACAGCAGGTCGGAGAGTGG - Intergenic
1022991721 7:35714987-35715009 GTGAACAGCAGAACTGGCAGAGG + Intergenic
1023473977 7:40556421-40556443 AAGGAAAGCAGGACTGAGAAGGG - Intronic
1024230146 7:47357676-47357698 GAAGACAGCACGACTGAGGGAGG - Intronic
1024971894 7:55078728-55078750 GTGCTCAGGAGGACAGAGAGGGG + Intronic
1026019603 7:66697127-66697149 GTGCAGAGCAGGAGTGAGAGGGG + Intronic
1026493204 7:70880979-70881001 GAGGACAGAAGGTCTGACAGAGG + Intergenic
1026880781 7:73905453-73905475 GTGCAGAGCAGGAGCGAGAGGGG - Intergenic
1029155990 7:98518460-98518482 GGGGAAAGGGGGACTGAGAGTGG - Intergenic
1029494700 7:100890540-100890562 AAGGACAGCAGGAAGGAGAGAGG + Exonic
1030274645 7:107707502-107707524 GTGGACAACAAGACTTAAAGTGG + Intronic
1030617842 7:111756964-111756986 GAGGACAGCAGTTCTCAGAGGGG + Intronic
1031154174 7:118089278-118089300 ATAGACAGCAGGAGTGAGGGAGG - Intergenic
1031267531 7:119600220-119600242 TTGAACAGGAGGAGTGAGAGAGG + Intergenic
1031868546 7:127066944-127066966 GAGGACAGCAGGGCTCAGAGAGG + Intronic
1031895104 7:127339356-127339378 GTTGAAAGCGAGACTGAGAGTGG - Intergenic
1032076409 7:128838213-128838235 GGGGAGAGCAGTCCTGAGAGGGG - Intronic
1032200349 7:129817603-129817625 GTGAAAATCAGGAATGAGAGAGG - Intergenic
1033004896 7:137551042-137551064 GAGGACAGGAGGAATGAGCGAGG + Intronic
1033465630 7:141586931-141586953 GTTGATAGAAGGAATGAGAGTGG - Intronic
1034441716 7:151089009-151089031 GGGAACAGCAGGGCTGAGAACGG - Intronic
1034469690 7:151248647-151248669 GAGCCCAGCAGGACTCAGAGGGG - Exonic
1035041220 7:155928956-155928978 GGTGACAGCTGGACTGAGAGGGG - Intergenic
1036506527 8:9361626-9361648 GTGGTGAGCAGGGCTGATAGAGG - Intergenic
1036646045 8:10611863-10611885 GTGGACTGCAGGGGTGACAGTGG + Exonic
1036753658 8:11458345-11458367 GTGCACTGCTGCACTGAGAGTGG - Intronic
1038804520 8:30778163-30778185 GTGTTCAGGAGGACTGAGACAGG + Intronic
1039665928 8:39528045-39528067 TTGGCCAGCAGGATGGAGAGAGG - Intergenic
1040475842 8:47776693-47776715 GAGGAAAGCAGGGCTTAGAGAGG - Intronic
1040820113 8:51546809-51546831 GGGCACAGCAGGAGTGAGACTGG + Intronic
1041797783 8:61763762-61763784 GTGGACAGCAGGAAACAGGGAGG - Intergenic
1041859160 8:62491815-62491837 GGGGAAAGGAGGACTGAGAATGG + Intronic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1043386015 8:79748601-79748623 GGGGGCAGGAGGACAGAGAGGGG - Intergenic
1045504596 8:102769471-102769493 ATGGACAGCAGCACTGATACAGG - Intergenic
1048426470 8:134328428-134328450 GTAGACATCAGGCTTGAGAGGGG - Intergenic
1048432405 8:134382450-134382472 CTGGACAGCAGGTTGGAGAGTGG - Intergenic
1048923175 8:139248694-139248716 GTGGCCAACAGGAATGAGAGGGG + Intergenic
1049884529 9:18288-18310 GTGGGCAGCAGGGCAGAGACTGG + Intergenic
1052466734 9:28839222-28839244 CTGAATAGCAGGACTGAAAGAGG - Intergenic
1053645838 9:40119176-40119198 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053645844 9:40119203-40119225 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1053759874 9:41344333-41344355 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054326850 9:63717077-63717099 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054326856 9:63717104-63717126 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1054538727 9:66256769-66256791 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1054538733 9:66256796-66256818 GTGGACATCAGGCCTGAGAAGGG - Intergenic
1056136469 9:83633918-83633940 AATGACAGCAGGAATGAGAGGGG + Intronic
1056427879 9:86496193-86496215 TTGAAAAGCAGTACTGAGAGAGG + Intergenic
1056718531 9:89053928-89053950 CTGGACAGCAGGGCCGGGAGGGG - Intronic
1056889614 9:90478559-90478581 GTGGCCGGAAGGAATGAGAGTGG - Intergenic
1057863609 9:98662026-98662048 GTGGGAAGCAGGACTGGAAGGGG - Intronic
1061033922 9:128102999-128103021 CTGCACACCAGGACTCAGAGAGG - Intronic
1061290025 9:129645432-129645454 GTGGTCACCAGGAGTGGGAGAGG - Intergenic
1061414249 9:130437664-130437686 GGAGACAGCAGGGGTGAGAGAGG - Intergenic
1061707309 9:132463034-132463056 CTGGATAGCAGGACGGGGAGAGG + Intronic
1061838174 9:133342709-133342731 GTGGACAGGAGGCCTGCGGGAGG + Intronic
1062186345 9:135220585-135220607 GTGGACAGCAGGGCTGCTGGGGG + Intergenic
1062214684 9:135382848-135382870 GACGCCAGCAGGACTGTGAGTGG - Intergenic
1062394780 9:136348367-136348389 GGGAACAGCAGGACTGACGGGGG + Intronic
1202793623 9_KI270719v1_random:102649-102671 GTGGACATCAGGCCTGAGAAGGG + Intergenic
1203687325 Un_GL000214v1:7512-7534 GGCGATGGCAGGACTGAGAGTGG + Intergenic
1203755307 Un_GL000218v1:120247-120269 GGCGATGGCAGGACTGAGAGTGG - Intergenic
1203536525 Un_KI270743v1:45304-45326 GGCGATGGCAGGACTGAGAGTGG + Intergenic
1203648950 Un_KI270751v1:96541-96563 GGCGATGGCAGGACTGAGAGTGG - Intergenic
1185484900 X:474873-474895 CTGGTCTGCAGGACTGGGAGAGG - Intergenic
1185670189 X:1802691-1802713 GTGGTCTGCAGGACTGGGAGAGG + Intergenic
1186691619 X:11983693-11983715 ATGAACAGCAGGAGTGACAGTGG - Intergenic
1186766139 X:12772351-12772373 GTACACAGCAGCCCTGAGAGAGG - Intergenic
1190322391 X:49186655-49186677 GTGGCCAACTGGACTGAGAGGGG + Intergenic
1192905269 X:75544530-75544552 GGGCACAGCAGGAATGAGATTGG - Intergenic
1193185857 X:78511576-78511598 TTGGACAGAAGTACTGAAAGAGG - Intergenic
1193914178 X:87345394-87345416 CTGGACAGTAGGAGTGAGTGAGG - Intergenic
1195589260 X:106604906-106604928 CTGAATAGCAGTACTGAGAGTGG - Intergenic
1196513904 X:116546941-116546963 GTGGTCTGCAGCACTCAGAGAGG - Intergenic
1196650467 X:118163595-118163617 TTGGACAGCAGGAATAAGATAGG + Intergenic
1198316448 X:135471514-135471536 GTGGGAAGAAGGACTGAAAGAGG - Intergenic
1200401278 X:156021863-156021885 GTGGGCAGCAGGGCAGAGAATGG - Intergenic
1202367787 Y:24178791-24178813 AGGGACAGCAGGACTGGTAGAGG + Intergenic
1202502996 Y:25491332-25491354 AGGGACAGCAGGACTGGTAGAGG - Intergenic