ID: 1127924329

View in Genome Browser
Species Human (GRCh38)
Location 15:63524086-63524108
Sequence GATGTTTGTGCTCAAGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127924329 Original CRISPR GATGTTTGTGCTCAAGAATT AGG Intronic
902227856 1:15007996-15008018 GATTTTTCTGCTCCAGAACTTGG - Intronic
903658830 1:24964825-24964847 TCTGTTTGTACCCAAGAATTTGG + Exonic
906913753 1:49984542-49984564 GGAGTTTGTGCTGAACAATTTGG - Intronic
907070159 1:51527365-51527387 GATGATGGTGATTAAGAATTGGG + Intergenic
907378741 1:54067197-54067219 CATCTTTGTCCTAAAGAATTCGG - Intronic
908848112 1:68345456-68345478 GTTGTTTGTTTTAAAGAATTAGG - Intergenic
908880485 1:68726090-68726112 GATGTTTCTGGTCAAGATTTTGG + Intergenic
910649440 1:89549857-89549879 GCTGTTTTTGCTGAAGACTTGGG - Intronic
910680080 1:89854038-89854060 TATGCTTGTGCTCTAGAACTTGG - Intronic
910693958 1:89993183-89993205 TATGAAAGTGCTCAAGAATTTGG + Intergenic
912131995 1:106614982-106615004 GATAATTGGGCTCTAGAATTAGG - Intergenic
912585390 1:110759828-110759850 GGTGTATGCGCTAAAGAATTGGG + Intergenic
913301107 1:117369331-117369353 TATATTTGTACTCAAGAGTTTGG + Intronic
913405844 1:118489769-118489791 GATGTTTATCCTGAAGAATTTGG - Intergenic
915820638 1:159019832-159019854 AATGTTTGAGCTCAAGGACTTGG + Intronic
916080581 1:161229509-161229531 GATGTTTGGTCTCAGGAAGTGGG + Exonic
916428479 1:164704478-164704500 TGTAGTTGTGCTCAAGAATTCGG + Intronic
924367999 1:243317240-243317262 AATGTTTTTCCTCAATAATTGGG + Intronic
1063622311 10:7660761-7660783 AGTGTCTGTGCTCAAGAATTAGG - Intronic
1065796886 10:29315987-29316009 GATGTCTGTCCTCAAGCAGTCGG - Intronic
1067829188 10:49600329-49600351 GTGGTTTGTGCTCAGGAATGGGG - Intergenic
1067988026 10:51173982-51174004 TATCTTTGTTCTCAAGAATGAGG + Intronic
1068414194 10:56696756-56696778 GTTGTTTGTGCTTAAGAAGGAGG - Intergenic
1070537195 10:77388518-77388540 GTTGTTTGTTCTCAGGGATTTGG - Intronic
1070990849 10:80730994-80731016 GAAGTTTCTGCTGAGGAATTAGG + Intergenic
1071781280 10:88848070-88848092 CATGTTTGTGCTCAAAAATTTGG + Intronic
1073970960 10:109045043-109045065 GGTTTTTGTACTCTAGAATTGGG - Intergenic
1074528922 10:114283511-114283533 GCTGTTTCTGCTCAGAAATTAGG + Intronic
1075798454 10:125136995-125137017 GATGTCAGTGCTGAAGATTTGGG - Intronic
1080980172 11:37392856-37392878 CATGTTTGTCCTCAAAAATCAGG - Intergenic
1081166815 11:39817803-39817825 GATTTCTGAGCTCCAGAATTAGG - Intergenic
1081905743 11:46668531-46668553 CATGTTTGCTCCCAAGAATTTGG + Exonic
1082573734 11:54776404-54776426 TTTCTTTGTGTTCAAGAATTTGG + Intergenic
1082620382 11:55413385-55413407 GATGTATGTATTCAAGAATTAGG - Intergenic
1088142023 11:106628750-106628772 GAAGTTTCTGCTCAAAACTTTGG + Intergenic
1089547599 11:119241690-119241712 GATCTTTGTGTTCAGGAATTTGG + Intronic
1094352130 12:29538746-29538768 GATGTTTTTTATCAAGAATCTGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1096369159 12:51054340-51054362 GATTTTGTAGCTCAAGAATTAGG + Intronic
1096568516 12:52501949-52501971 GATGTGTCTGTTAAAGAATTTGG + Intergenic
1101870459 12:108561454-108561476 GATGTCTGTAGTGAAGAATTTGG + Intergenic
1105676667 13:22679426-22679448 GATGTTGGTGGTGAAGAAGTTGG - Intergenic
1106100462 13:26690957-26690979 GATATGTATGCTGAAGAATTCGG - Intergenic
1106165469 13:27241905-27241927 ATTGTTTGTGCTCAGGAGTTTGG + Intergenic
1106693689 13:32146958-32146980 CATATTGGTGCTAAAGAATTTGG + Intronic
1106720288 13:32428554-32428576 GATGTTGGTGCTCACAAATCGGG - Intergenic
1107178357 13:37426152-37426174 TATGTTGGTGCTCCAGCATTAGG - Intergenic
1107315439 13:39126681-39126703 TATGTTTGTGTTCATAAATTAGG - Intergenic
1108206666 13:48096716-48096738 GATATTTGTGTTCAAGAGATTGG + Intergenic
1111385886 13:87526889-87526911 GATGTTTGTGAACAAGAGTTTGG + Intergenic
1111647805 13:91053445-91053467 ACTGTTTGTACTAAAGAATTTGG - Intergenic
1112690524 13:101888469-101888491 AAAGCTTGTGCTCAAGAATTGGG + Intronic
1113561011 13:111281263-111281285 GTGTTTTGTGCTCAAGAAGTTGG + Intronic
1114818628 14:25989471-25989493 AATATTTGTGCTCCAGAATCAGG + Intergenic
1120613704 14:86675274-86675296 GAGGTGTGTGCTCAGGAATCAGG + Intergenic
1126024948 15:44437138-44437160 TATGTTGGTGCTCAAAAACTTGG + Intronic
1127924329 15:63524086-63524108 GATGTTTGTGCTCAAGAATTAGG + Intronic
1129962908 15:79704603-79704625 GATGTTTGTGATTTAGAATTAGG - Intergenic
1130756325 15:86768239-86768261 GATGTTTGTGTCCAGAAATTTGG - Intronic
1132033041 15:98454239-98454261 GTTGTCTGTGTTAAAGAATTTGG - Intronic
1137381001 16:47999766-47999788 GATCTTTGTGCTGAAGAGGTTGG - Intergenic
1139033551 16:62915153-62915175 AGTGTTTGTGGTTAAGAATTTGG + Intergenic
1139810962 16:69616614-69616636 GATGTTAGTGCCCAAGAGGTGGG - Intronic
1139912611 16:70407454-70407476 GAAGTTTGTGGTCACAAATTTGG + Intronic
1144236040 17:13261660-13261682 AATGTTTTTCCTGAAGAATTGGG + Intergenic
1151201262 17:72469647-72469669 GAAGTGTGTGCTAAATAATTAGG + Intergenic
1154946771 18:21169706-21169728 TTTATTTTTGCTCAAGAATTTGG - Intergenic
1155708020 18:28839943-28839965 GACACTTGTGCTCAAGTATTTGG + Intergenic
1156815026 18:41299315-41299337 GATTTTTGTGGTCAGGTATTTGG + Intergenic
1157828056 18:50830598-50830620 GATGTTTGTTCTATAGAATCGGG + Intergenic
1157839850 18:50946635-50946657 GAGGTTTCTGCTCTAGAATTTGG - Intronic
1161352317 19:3800784-3800806 AATGTTTTTACTCATGAATTGGG - Intronic
1167014888 19:46834713-46834735 GATGTAAGAGGTCAAGAATTGGG - Intergenic
925072460 2:981527-981549 CATGTGTGTGCTCATGAGTTTGG - Intronic
926447514 2:12961940-12961962 GATGTTTGGGGTCAAGAACCTGG + Intergenic
927927849 2:27025713-27025735 GTTGGTTGAGTTCAAGAATTTGG - Exonic
934872489 2:97879969-97879991 GCAGTGTGTGCTCAAGAATTAGG + Intronic
938503367 2:131849434-131849456 AATTTTTGTGGTCTAGAATTGGG - Intergenic
940754390 2:157665368-157665390 GATATTGCTGCTAAAGAATTTGG + Intergenic
941214771 2:162692755-162692777 AATATTAGTGTTCAAGAATTTGG + Intronic
942150224 2:173068943-173068965 GATGTTTTTGATAAAGAAATGGG - Intergenic
942441930 2:176045892-176045914 GATGAATTTGATCAAGAATTAGG - Intergenic
942780825 2:179640331-179640353 GATGTCCATGCTGAAGAATTTGG + Intronic
943490857 2:188554804-188554826 GATCTTTGTGCTCCAATATTGGG + Intronic
947189147 2:227483761-227483783 AATGTTTATGCTCAAGTTTTTGG + Intronic
1170001938 20:11624519-11624541 GAATTGTGTGCTCAATAATTAGG + Intergenic
1175253814 20:57626299-57626321 AATGTTTGTGCCCAAAAATATGG - Intergenic
1176904748 21:14486062-14486084 GATGTCTGAGCTCAAGGATAGGG + Exonic
1177993048 21:28060705-28060727 AATTTTTGTGATCTAGAATTGGG + Intergenic
1182525805 22:30918234-30918256 GAAGTGTTTGCTCAAGATTTGGG - Intergenic
1183996189 22:41634498-41634520 TTTGTTAGTGCTCCAGAATTAGG + Intronic
950599343 3:14018189-14018211 GATATTAGTGTTCCAGAATTAGG + Intronic
950803275 3:15573217-15573239 GATATCTGTGCAGAAGAATTGGG - Exonic
953165189 3:40458626-40458648 GATGTTTGTGTTCTAGGCTTTGG + Exonic
953836104 3:46345734-46345756 TATATTTGTGTACAAGAATTTGG + Intergenic
955641718 3:61092731-61092753 GATATTTATGCTCATAAATTAGG + Intronic
959348466 3:105229880-105229902 GATTATTGTCCTCAATAATTTGG - Intergenic
959416564 3:106082865-106082887 GGTGTCTGTGCTGAAGAAATGGG + Intergenic
960143091 3:114170118-114170140 GATATTTCTGTTCAAGAATGAGG - Intronic
960535001 3:118805768-118805790 TGAGATTGTGCTCAAGAATTTGG - Intergenic
960853466 3:122079364-122079386 GATTTTTCTGCTGAAGAATCTGG - Intronic
961397851 3:126609596-126609618 GAGGGTTCTGCTCAAGAAATAGG + Intronic
962769082 3:138595291-138595313 GATGTTTGGCCTCTACAATTAGG - Intergenic
965463042 3:168992596-168992618 AATTTTTGTGTTTAAGAATTGGG + Intergenic
965686416 3:171307696-171307718 GATGTTTATACTCAAGATTTGGG - Intronic
965779062 3:172264446-172264468 GATGTTTGTACCCAGAAATTAGG + Intronic
967657180 3:192064186-192064208 GATGGATGTACTTAAGAATTTGG + Intergenic
970362510 4:15323886-15323908 GTTATTAGTGCTCAAGAAATGGG - Intergenic
970764206 4:19527437-19527459 GATAAAAGTGCTCAAGAATTAGG + Intergenic
972374166 4:38455347-38455369 GATCTTCTTGCTCAAGAATGGGG - Intergenic
973645308 4:52944741-52944763 GATGTCTCTGATCAAGCATTAGG - Intronic
976681315 4:87759213-87759235 GATGTCTGTGCCCCTGAATTTGG - Intergenic
977132670 4:93262152-93262174 TATATTTGAGCTTAAGAATTTGG + Intronic
979431702 4:120640189-120640211 GAAGTTTGTGATCATGGATTTGG - Intergenic
979535667 4:121817751-121817773 AATGTTTGTACTCATGTATTGGG + Intronic
980784169 4:137531100-137531122 GATGTTCAGGCTCAAGATTTGGG - Exonic
986535324 5:8780670-8780692 GAAATTTGTGTTCAATAATTAGG + Intergenic
989083770 5:37653671-37653693 GGTGTATGTGTCCAAGAATTTGG + Intronic
990331986 5:54736750-54736772 GCTGTTTATGGACAAGAATTTGG + Intergenic
991454928 5:66792858-66792880 GATGTGTGTGTTCAAGTATGGGG + Intronic
993191817 5:84692871-84692893 AATGTTAATGCTCAATAATTTGG + Intergenic
994207913 5:97056609-97056631 GATGTTGGTGCTGATGAGTTAGG - Intergenic
995209490 5:109521042-109521064 GATGAGTGTGCCCTAGAATTTGG - Intergenic
995319381 5:110815081-110815103 CATCTTTGGGATCAAGAATTAGG + Intergenic
996105736 5:119500271-119500293 GATGTTTGTTCTGGATAATTGGG + Intronic
997765422 5:136498773-136498795 GGTGTTTTTGCTTAAGTATTGGG + Intergenic
1000176926 5:158765672-158765694 GTTGTTTCTGCTCATGATTTAGG + Intronic
1000407388 5:160902893-160902915 GAAGTTTGTAATCAACAATTAGG + Intergenic
1000589142 5:163137121-163137143 GATCTCTATGCTCAAGAAATTGG + Intergenic
1002920906 6:1572437-1572459 GGTGTGTGTGCTCAAGACATGGG - Intergenic
1004645207 6:17553916-17553938 GGTGTTTGTTCTCAAGAACCAGG - Intronic
1007478410 6:42134369-42134391 GATATTTATGCTCAATAATTGGG + Intronic
1010863946 6:80949151-80949173 GATGTTTCTGCTGATGTATTAGG + Intergenic
1011465576 6:87652841-87652863 GATGTTTGTAATAAAGAATAAGG - Intronic
1014734875 6:125081220-125081242 GATGCATGTGCTCAGGACTTTGG + Intronic
1016303911 6:142662847-142662869 GATTTTGGTTCTCAAGAGTTTGG - Intergenic
1016846022 6:148569435-148569457 GATGTCTGTGCTCAACAGTTAGG + Intergenic
1017194212 6:151682843-151682865 GATGTTTGTGATGCAGAATGGGG + Intronic
1021694118 7:23259679-23259701 GCTGTTTGTGCTAAGTAATTTGG - Intronic
1021704426 7:23352632-23352654 GAAATTTATGCTCAAGATTTGGG - Intronic
1023332507 7:39133502-39133524 GGTGAATGTACTCAAGAATTTGG + Intronic
1023729749 7:43179412-43179434 GTTCTTTGTGCTCAAGAGCTAGG + Intronic
1030952696 7:115811692-115811714 AATGTTTGTGCAAAAGTATTTGG + Intergenic
1030972840 7:116081682-116081704 CATATCTGTGCTAAAGAATTTGG - Intronic
1032552556 7:132798384-132798406 GATGTTCGTGGTAAAGGATTAGG - Intronic
1032662700 7:134003340-134003362 GATGTTTGTGTTCTGTAATTTGG + Intronic
1033288382 7:140061662-140061684 GAGGTTTATGCTAAAGAATTTGG - Intronic
1033439269 7:141364338-141364360 GATATTTGTTCCCAAGTATTAGG + Intronic
1035828559 8:2669850-2669872 GCTGTTTCTGCTGAAGACTTAGG + Intergenic
1035936691 8:3849311-3849333 GAAGTTTCTGCACCAGAATTTGG + Intronic
1036721367 8:11178513-11178535 GATGTTTGGACTTAAAAATTTGG - Intronic
1037618887 8:20545712-20545734 TATGTTCGTGGACAAGAATTTGG - Intergenic
1038067963 8:23983304-23983326 GAGGTTTTTGCTGAAGATTTTGG - Intergenic
1038102581 8:24395310-24395332 GGGGTCAGTGCTCAAGAATTTGG - Intronic
1041346181 8:56900904-56900926 ATTTTTTGTGCCCAAGAATTTGG - Intergenic
1041690557 8:60681730-60681752 CATGCTGGTACTCAAGAATTGGG + Intronic
1042951496 8:74204792-74204814 AATGCTTGTTCTCAAGAATGGGG + Intergenic
1044420375 8:91988813-91988835 CATGTTTGAGCTCAAGTACTTGG + Intronic
1044653404 8:94522916-94522938 AATGGTTGTGCTAAGGAATTTGG - Intronic
1047777525 8:128085345-128085367 GATTTTTTTGGTCAAGAATTTGG - Intergenic
1049335112 8:142080131-142080153 GATGTTAGTGCTGAAGAAATGGG - Intergenic
1054743907 9:68835056-68835078 GATGTTTGTTCTGGAGAAATGGG - Intronic
1057421798 9:94918785-94918807 GATGTTTGGGTACAAGAATAAGG + Intronic
1058632973 9:107008366-107008388 GCTGTTTGTGCTGAAGATTAAGG + Intronic
1188036374 X:25321966-25321988 GAACATTGTGTTCAAGAATTTGG - Intergenic
1188559055 X:31447091-31447113 AATATGTGTGCTCAGGAATTTGG - Intronic
1188992252 X:36836064-36836086 GATGATTAGGCTCATGAATTAGG + Intergenic
1189595343 X:42558996-42559018 GAAAATTGTGCTTAAGAATTTGG + Intergenic
1195069303 X:101263872-101263894 GATGTGTGTGCTTGAGATTTGGG + Exonic
1195539294 X:106044170-106044192 CATGTTTGTGATCAAGAGCTGGG + Intergenic
1196184562 X:112732150-112732172 GGTGTTTTTGCTCTAGACTTAGG + Intergenic
1196242792 X:113363223-113363245 TATCTTTGTGCTCTAGTATTGGG + Intergenic
1196247627 X:113418495-113418517 TATCTGTGTGCTCCAGAATTGGG - Intergenic
1196261886 X:113592809-113592831 CATGATTGTGCTCAAGAAACAGG - Intergenic
1197939850 X:131778205-131778227 GTTGTTTGTAGTCAACAATTTGG - Intergenic
1200023550 X:153233846-153233868 GAAGTTTGAAATCAAGAATTAGG - Intergenic
1200913139 Y:8548620-8548642 AATGTGTGTGTGCAAGAATTGGG - Intergenic
1200935786 Y:8737101-8737123 AATGTGTGTGTGCAAGAATTGGG + Intergenic