ID: 1127926184

View in Genome Browser
Species Human (GRCh38)
Location 15:63545728-63545750
Sequence GGGAGGCTAAGGCGGGCGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82185
Summary {0: 1, 1: 37, 2: 664, 3: 7999, 4: 73484}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127926174_1127926184 15 Left 1127926174 15:63545690-63545712 CCAGGCACGGTAGCTCACAACTG 0: 3
1: 219
2: 7371
3: 40115
4: 106206
Right 1127926184 15:63545728-63545750 GGGAGGCTAAGGCGGGCGGATGG 0: 1
1: 37
2: 664
3: 7999
4: 73484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127926184 Original CRISPR GGGAGGCTAAGGCGGGCGGA TGG Intronic
Too many off-targets to display for this crispr