ID: 1127926184 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:63545728-63545750 |
| Sequence | GGGAGGCTAAGGCGGGCGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 82185 | |||
| Summary | {0: 1, 1: 37, 2: 664, 3: 7999, 4: 73484} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1127926174_1127926184 | 15 | Left | 1127926174 | 15:63545690-63545712 | CCAGGCACGGTAGCTCACAACTG | 0: 3 1: 219 2: 7371 3: 40115 4: 106206 |
||
| Right | 1127926184 | 15:63545728-63545750 | GGGAGGCTAAGGCGGGCGGATGG | 0: 1 1: 37 2: 664 3: 7999 4: 73484 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1127926184 | Original CRISPR | GGGAGGCTAAGGCGGGCGGA TGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||