ID: 1127931846

View in Genome Browser
Species Human (GRCh38)
Location 15:63601995-63602017
Sequence CCCGGCAGCCGCCTGGTCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127931846 Original CRISPR CCCGGCAGCCGCCTGGTCCT GGG Exonic