ID: 1127932948

View in Genome Browser
Species Human (GRCh38)
Location 15:63609435-63609457
Sequence CCCGTGGCCCTCGAGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127932940_1127932948 6 Left 1127932940 15:63609406-63609428 CCAGATAGAATGAGCTGAGGCCC 0: 1
1: 0
2: 1
3: 16
4: 111
Right 1127932948 15:63609435-63609457 CCCGTGGCCCTCGAGGCTCTGGG 0: 1
1: 0
2: 1
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127932948 Original CRISPR CCCGTGGCCCTCGAGGCTCT GGG Intronic
900097375 1:945437-945459 CAGGTGGCCCTCGTGGCTCTGGG + Intronic
900116110 1:1028582-1028604 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900116131 1:1028643-1028665 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900116152 1:1028704-1028726 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900116173 1:1028765-1028787 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900116194 1:1028826-1028848 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900116214 1:1028887-1028909 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900116235 1:1028948-1028970 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900116256 1:1029009-1029031 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900116278 1:1029070-1029092 CCCTTGGCCCACGAGGGGCTGGG - Intronic
900616917 1:3569597-3569619 CCCGTGGCCCCCCAGTCTCCTGG - Intronic
902531498 1:17093652-17093674 CCCCTGGCCCTCGGGGCCCCAGG + Exonic
904464344 1:30699010-30699032 CCTGGGGCCCTGCAGGCTCTGGG - Intergenic
904673276 1:32181531-32181553 CCTGTGGCCTTCGATGGTCTCGG - Exonic
907689155 1:56645264-56645286 CCCGCGCCCCTCGCGGCTCGGGG + Intronic
912170252 1:107091318-107091340 CCTGTGTCCTTCGAGGCTCAGGG + Intergenic
914923627 1:151864870-151864892 CCCTTGGCCCTAGTGGCTCCTGG - Intergenic
916639344 1:166710240-166710262 CCAGTGGCCCCCCAGGTTCTAGG - Intergenic
921159768 1:212464574-212464596 CCTGTTGCCCTGCAGGCTCTGGG + Intergenic
1064317286 10:14270085-14270107 CCAGTGGCCCCCCAGGCTTTTGG + Intronic
1066156295 10:32681521-32681543 CCCTTGGCCAACCAGGCTCTTGG - Intronic
1067022979 10:42818324-42818346 CCAATGGCCCACAAGGCTCTAGG - Intronic
1069704689 10:70451057-70451079 CCCATGGCCCCCCAGCCTCTTGG + Intergenic
1072671329 10:97431992-97432014 CACGTGGGCCTCTAGGCCCTCGG - Intronic
1073509559 10:104034699-104034721 CCGGGGGCCCTCGAGGCCCTGGG + Exonic
1075093413 10:119456044-119456066 CCTGTGGGCCCCGAGGCTTTGGG - Intronic
1075425620 10:122339604-122339626 CCTGTGTCCCTCCAGGCTCTGGG + Intergenic
1075875576 10:125803347-125803369 CACGGGGTCCTGGAGGCTCTGGG - Intronic
1076479077 10:130772546-130772568 CCTGTGGCCCTGCAGGTTCTTGG - Intergenic
1077228801 11:1449645-1449667 ACCCAGGGCCTCGAGGCTCTTGG + Intronic
1077446153 11:2591900-2591922 CCCTTTGCCCAGGAGGCTCTTGG + Intronic
1081773811 11:45664895-45664917 GCGGTGGCCCCCGAGGCGCTTGG - Intronic
1084225444 11:67712102-67712124 CGCGTGGCCCGGGAGGCTCCCGG - Intergenic
1084263266 11:67991952-67991974 CGCGTGGCCCGGGAGGCTCCCGG - Intronic
1084489544 11:69471058-69471080 CCCGTGGGAATCGAGGCTCCGGG - Intergenic
1084810135 11:71607175-71607197 CGCGTGGCCCGGGAGGCTCCCGG + Intergenic
1086728727 11:90222547-90222569 CCTCTGGCCCTCCAGTCTCTGGG - Intronic
1097063378 12:56302201-56302223 CCCATGGCACTAGGGGCTCTGGG - Intronic
1101397642 12:104362519-104362541 CCCGTGGGCTTCGCAGCTCTTGG + Intergenic
1104945935 12:132414905-132414927 CCCGGGGCCCCCGTGGGTCTGGG + Intergenic
1104984358 12:132588137-132588159 CCCCTGGCCCTGGAGGATTTTGG + Intergenic
1110567239 13:76968530-76968552 CCCCTGACCCACGTGGCTCTCGG + Intergenic
1112091764 13:96090687-96090709 CCCGCGGCCCTCGGGGCTTGAGG - Intergenic
1118314166 14:64715591-64715613 CCCCAGGCCCTCGAGGCTGAAGG - Intronic
1122649300 14:103216858-103216880 CAAGTGGCCCTGGAGGCTCCAGG - Intergenic
1122811898 14:104293354-104293376 CCCCTGGCCCTCCAGGCCCCTGG - Intergenic
1123005935 14:105323858-105323880 CCCGTAGCCCTGGAGGCCTTGGG + Intronic
1125536302 15:40442360-40442382 GCTGTTGGCCTCGAGGCTCTGGG + Intronic
1127932948 15:63609435-63609457 CCCGTGGCCCTCGAGGCTCTGGG + Intronic
1131248875 15:90818257-90818279 CAGGTGGCCCCTGAGGCTCTGGG - Intergenic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132556568 16:575292-575314 CCCGTGCCCCTCAGGGCCCTTGG - Intronic
1132816014 16:1826950-1826972 CCCGTGGCAGTCGGGGCTCGCGG - Exonic
1132909177 16:2299564-2299586 GCCGTGGGCCTCGGGGCTGTGGG - Intronic
1133272115 16:4615295-4615317 CACGTCGCCCTCGTTGCTCTGGG + Intergenic
1133272152 16:4615473-4615495 CACGTCGCCCTCGTTGCTCTCGG + Intergenic
1133433974 16:5763473-5763495 CCCCTGGCCCAGGAGGCTCTTGG + Intergenic
1134213460 16:12297247-12297269 GCTGAGGCCCTGGAGGCTCTGGG + Intronic
1138106444 16:54289473-54289495 CCCGCGGCCCGCCAGGTTCTGGG + Intergenic
1139477592 16:67210411-67210433 CCCGAGGCCCTGCAGGCTCTGGG - Exonic
1141525135 16:84606284-84606306 CCAGTGGCCCACAAGGCTCCCGG - Intronic
1142859052 17:2749789-2749811 CCCGGGGCTCTCGGGGCTCCCGG - Intergenic
1142982305 17:3679369-3679391 CCCATGGCCATCCAGGGTCTCGG + Intronic
1144955837 17:19018362-19018384 CCCATGCCCCTCAAGGCTCGGGG + Intronic
1146352977 17:32111465-32111487 CCCGTGGCCCAGGAGGCCCCTGG + Intergenic
1147360620 17:39927445-39927467 CCCGTAGCCCTGGGGCCTCTTGG + Intronic
1152553497 17:81041281-81041303 CCAGGGTCCCTGGAGGCTCTGGG + Intronic
1152848258 17:82615828-82615850 CCCGTGGCCCAGGAGGCCCCTGG + Exonic
1152893496 17:82896261-82896283 CCCCTGGCCCTGGAGGCTCGGGG - Intronic
1153828835 18:8901557-8901579 CCAGTGGGGCTCCAGGCTCTGGG - Intergenic
1154201899 18:12306113-12306135 CCTGGGGCTCTCCAGGCTCTGGG - Intergenic
1154246393 18:12703006-12703028 CCCGCGCCCCGCGAGGCTCCGGG + Exonic
1155785884 18:29899027-29899049 CCCGTGGCCCTGGATCCACTAGG - Intergenic
1157330780 18:46702402-46702424 CCCGTGGCTCTCATGGCCCTTGG + Intronic
1160415247 18:78705395-78705417 CCCGTGGCCCGAGGGGCCCTGGG - Intergenic
1160742725 19:694933-694955 CTCGTGGCCCCCGATGATCTGGG + Exonic
1160988665 19:1851807-1851829 CCCGCCGGCCTCCAGGCTCTGGG + Intergenic
1161613977 19:5259876-5259898 TCCCTGGACCTCGAGGTTCTGGG + Intronic
1163176673 19:15569126-15569148 CCCGTGGCTCTGGACGCCCTTGG + Intergenic
1163375948 19:16930671-16930693 TCTGTGGCCCACGAGGATCTAGG - Intronic
1163630910 19:18417594-18417616 CCCGTGGTCCCCCAGGCTCCGGG + Intergenic
1163683517 19:18697128-18697150 TCCCTGGCCCTCGAGGCACGCGG - Intronic
1165419864 19:35717528-35717550 CCCGGGACCCCCGAGGCCCTGGG - Intergenic
1166947365 19:46405249-46405271 CCAGCGGCCCTGGAGCCTCTTGG - Intergenic
1167250993 19:48398403-48398425 CCGGTGGCCCCCGCGGCCCTCGG + Exonic
927948071 2:27149309-27149331 CCCCTGGCCCTCGAGGGACCAGG + Exonic
929531745 2:42757043-42757065 CCCGGGGCCCTCGGAGCTCAAGG - Intergenic
932209266 2:69914386-69914408 GCCGCGGCCCTGGAGGTTCTGGG - Intronic
932263217 2:70344236-70344258 CCCGTGGTCATCCAGGCTCTAGG - Intergenic
934459120 2:94201566-94201588 CCAATGGCCCACAAGGCTCTAGG + Intergenic
934618629 2:95790915-95790937 CCCGTGGCCCCCGAGACCCTGGG + Intergenic
934642264 2:96033642-96033664 CCCGTGGCCCCCGAGACCCTGGG - Intronic
937274100 2:120673176-120673198 CCCTTGGCCCTCGGGGTTCCAGG + Intergenic
938135732 2:128755067-128755089 CCCTCGGCCCTGGAGACTCTGGG + Intergenic
940868462 2:158839593-158839615 CCAGTGGCCCTGAGGGCTCTTGG - Intronic
941905095 2:170712506-170712528 CCCTTGGCCCTCGGAGCTCCTGG - Exonic
948808443 2:240462946-240462968 CCCCTGGCCTGCGAGGCTCTGGG - Intronic
1175371494 20:58495895-58495917 CCCGGGGCCCTCAAGGCTGGAGG - Intronic
1175892109 20:62320527-62320549 CCCGGGGCCCTGGGGGGTCTTGG + Intronic
1175927101 20:62476230-62476252 CCCGGGGCCCACGAAGCCCTCGG - Intergenic
1177944739 21:27454029-27454051 CCAGTGGTCCCCGGGGCTCTTGG - Intergenic
1180208389 21:46277627-46277649 CCCGAGGCCCTCGGAGCCCTCGG + Exonic
1181357093 22:22304920-22304942 CCAATGGCCCACAAGGCTCTAGG - Intergenic
1181464817 22:23105236-23105258 CAAGTTGCCTTCGAGGCTCTGGG - Intronic
1184781053 22:46649824-46649846 CCCGTGGCCCTCCCTGCTCAGGG - Intronic
1184878314 22:47289399-47289421 CCCGAGGCCCGAGAGGCACTCGG + Intergenic
949344812 3:3066945-3066967 CCCGTGGCTGTGGAGGCTCTAGG + Intronic
952415234 3:33084116-33084138 CCCCAGGCCCTTGAGTCTCTGGG - Intronic
953404662 3:42654477-42654499 CCCGCCGCGCCCGAGGCTCTGGG + Intronic
954133002 3:48569609-48569631 CCCGTGGGCCTGGAGGCCCCAGG + Exonic
954763485 3:52894801-52894823 CCCGTGGCCCTCGAGGCAATGGG - Intronic
957078704 3:75619894-75619916 CGCGTGGCCCGGGAGGCTCCCGG - Intergenic
961555594 3:127694875-127694897 GAGGTGGCCCTCGAGGGTCTGGG + Intronic
969732084 4:8963553-8963575 CGCGTGGCCCGGGAGGCTCCCGG + Intergenic
969791677 4:9497638-9497660 CGCGTGGCCCGGGAGGCTCCCGG + Intergenic
980526874 4:134000792-134000814 TCCCTGGCCCTCAATGCTCTTGG + Intergenic
984764350 4:183388211-183388233 CCTGTGGCCCCCCAGCCTCTCGG + Intergenic
985520310 5:371055-371077 CCCCTGGCCCTCAGGCCTCTGGG - Intronic
985616607 5:926794-926816 CGCGTGGCTCCGGAGGCTCTGGG - Intergenic
987181526 5:15372936-15372958 CCCCTGGCCACAGAGGCTCTCGG + Intergenic
997294979 5:132763514-132763536 CCAGTGGCCCCCAATGCTCTGGG - Intronic
998323855 5:141260612-141260634 CTAGTGGCCCTCCAGGTTCTTGG + Intergenic
998424844 5:142017830-142017852 CTTGTGGACCTCCAGGCTCTAGG + Intergenic
999192615 5:149759798-149759820 CCCCTGGCCCAGGGGGCTCTTGG - Intronic
999768242 5:154756258-154756280 CCCGGGGCCCTGGAGGTGCTGGG - Intronic
999962086 5:156766824-156766846 GCTGTGGCCCTCTAAGCTCTGGG - Intronic
1001399224 5:171436946-171436968 CCAGAGGCCCTCCAAGCTCTGGG - Intronic
1003328326 6:5109522-5109544 ACCGTGGCCCTCTAGCCCCTGGG + Intronic
1007357051 6:41328712-41328734 TCAGTGGCCCTAGAGGGTCTTGG + Intergenic
1010853809 6:80812825-80812847 CCAGTGGCTCTCCTGGCTCTCGG - Intergenic
1020309202 7:6855892-6855914 CGCGTGGCCCGGGAGGCTCCCGG - Intergenic
1023814826 7:43941589-43941611 CCCGTGGCCCTGGAGCCTCAAGG - Intronic
1024229748 7:47354975-47354997 CACGTGGTTCCCGAGGCTCTGGG - Intronic
1024858602 7:53811788-53811810 CCTGTGGCCCCTGGGGCTCTCGG - Intergenic
1026494932 7:70893938-70893960 CCAGTGGCCACCGTGGCTCTTGG - Intergenic
1026967191 7:74447809-74447831 CGTGTGGCCCTCAAGGCTCCTGG - Intergenic
1028527494 7:91801730-91801752 CCCGTGCCCCTGCAGGCTCAGGG - Intronic
1030596009 7:111539544-111539566 CCCCTGGCCCTTGAGACTCCAGG - Intronic
1034334093 7:150309313-150309335 CTTCTGGCCCTCGAGGGTCTAGG - Intronic
1038332972 8:26624090-26624112 CCCACGGCCCTTGAGGCTCTTGG + Intronic
1038596389 8:28890296-28890318 CCCTTGGCCCTCTAGGCGCCGGG + Intergenic
1046625510 8:116572680-116572702 GCCGTGGCCCTCCTGGCACTGGG + Intergenic
1049398260 8:142411976-142411998 CCCATGGCCCCTGAGGCCCTGGG - Intergenic
1053689615 9:40577353-40577375 CCAATGGCCCACAAGGCTCTAGG + Intergenic
1054274415 9:63053704-63053726 CCAATGGCCCACAAGGCTCTAGG - Intergenic
1054300861 9:63378292-63378314 CCAATGGCCCACAAGGCTCTAGG + Intergenic
1054400409 9:64711225-64711247 CCAATGGCCCACAAGGCTCTAGG + Intergenic
1054433999 9:65195483-65195505 CCAATGGCCCACAAGGCTCTAGG + Intergenic
1054496388 9:65826187-65826209 CCAATGGCCCACAAGGCTCTAGG - Intergenic
1057996591 9:99825048-99825070 CCCCTGGCCCTCGAAACTCGCGG + Intronic
1060784132 9:126435769-126435791 CCTGTGGCCTTCGAGCCTCTGGG - Intronic
1061963710 9:134001411-134001433 CCCGTGGCCATAGGGGTTCTGGG + Intergenic
1187823813 X:23315104-23315126 TCCGTGGCCCTCTGAGCTCTGGG + Intergenic
1190263561 X:48814726-48814748 CCAGTCGCCCTCGAGGTCCTGGG + Exonic
1196759303 X:119186995-119187017 ATGGTGGCCCTCGAGGCTCATGG - Intergenic