ID: 1127935690

View in Genome Browser
Species Human (GRCh38)
Location 15:63635389-63635411
Sequence CTGTTGAGACAGATCAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127935690_1127935695 11 Left 1127935690 15:63635389-63635411 CCAAGTCTGATCTGTCTCAACAG 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1127935695 15:63635423-63635445 CCAAGCTGAACAGCATACCCTGG 0: 1
1: 0
2: 0
3: 4
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127935690 Original CRISPR CTGTTGAGACAGATCAGACT TGG (reversed) Intronic
901868022 1:12120300-12120322 CAGTTGAGCCAGATCAGAGCAGG + Intronic
903008874 1:20316593-20316615 CTGTGGAGACAGAACAGGATGGG + Intronic
903789894 1:25885729-25885751 ATGGTGAGAGAGATCAGACCAGG + Exonic
904517763 1:31069980-31070002 CTCTTGAGCCAGACCAGCCTGGG - Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
911590243 1:99739038-99739060 ATGTAAAGACAGATCATACTAGG + Intronic
915639976 1:157217264-157217286 CTTTTGAGAAAGATGAGTCTTGG - Intergenic
918081176 1:181208894-181208916 CTGTTGAGACAGAACTGAATAGG + Intergenic
919840468 1:201605598-201605620 TTGTTTAGACAGATGGGACTGGG + Intergenic
920110978 1:203586807-203586829 ATAGTGAGACAGATCAGACAAGG - Intergenic
920144977 1:203852231-203852253 CTGTTGAGGCAGAGCTGAGTCGG - Exonic
921820331 1:219609773-219609795 CTGTTGAGGCAGAGCTGAGTCGG + Intergenic
922151414 1:223008130-223008152 CCGTGGAGACAGAGCAGGCTCGG - Intergenic
922886757 1:229026302-229026324 CTGTTGAGACTGCGCAGAATGGG - Intergenic
923280786 1:232441232-232441254 GTGCTGAGACAGATCAGTCCTGG + Intronic
1063052265 10:2465410-2465432 AGGTTGAAACAGATTAGACTTGG - Intergenic
1068734998 10:60403408-60403430 TTGATGAGAGAGATCAGTCTGGG - Intronic
1070748401 10:78948971-78948993 CTGTTGAGAAAGAACAGCTTTGG - Intergenic
1072290934 10:93963690-93963712 CAGTTGAGACAGATAATACCAGG - Intergenic
1072670155 10:97423531-97423553 CTGTGGTGACAGTGCAGACTAGG + Intronic
1073996226 10:109318085-109318107 CTAATGAGACAGATAAGACCAGG - Intergenic
1075080025 10:119377204-119377226 CTGTTGAAACAGATCCGAAAGGG + Intronic
1078323105 11:10354676-10354698 CTGTTGTGATAAAGCAGACTAGG - Intronic
1080412431 11:32038410-32038432 CTGGTGAGACAGAAAAGACAAGG - Intronic
1081031782 11:38093573-38093595 CTGTTGACGCAGTTCTGACTAGG + Intergenic
1081730507 11:45368801-45368823 CTGTTAAGACAGATGAAAATGGG + Intergenic
1085261604 11:75208661-75208683 CTGTGGGGAGAGATAAGACTGGG - Intergenic
1086493164 11:87375963-87375985 CTGTTGAGACTGAACAGAGTGGG - Intergenic
1088186922 11:107180938-107180960 ATGTTGAAACACATGAGACTGGG + Intergenic
1088439937 11:109858962-109858984 CTGTTGAGAGAAATGAAACTTGG + Intergenic
1088927123 11:114313861-114313883 CTGTTGAGTCAGCTGACACTGGG - Intergenic
1088962118 11:114679195-114679217 CTCTTGAGGCAGATAAGACCAGG + Intronic
1089571124 11:119410655-119410677 CTGTTGAGAAAGAAAAGGCTGGG - Intergenic
1089781294 11:120874946-120874968 CTGTGGAGACAATTCAGACTTGG - Intronic
1090357434 11:126149471-126149493 GTGTTGGGACAGGTCAGACCAGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1095304606 12:40624879-40624901 ATGAAGAGACATATCAGACTAGG + Intergenic
1095947190 12:47759851-47759873 CTGTTGAGCCAGCCCAGACTGGG + Intronic
1096072774 12:48784621-48784643 CTGTTGAGAAAAATCAGATCGGG - Intronic
1098415338 12:70228678-70228700 GTGTTCAGACAGAGCAGACTAGG - Intergenic
1101531207 12:105575131-105575153 CTGATGAGATAGATTAGGCTTGG + Intergenic
1102440533 12:112960712-112960734 CTTTGGAGACAGATAAGCCTGGG - Intronic
1102474547 12:113180156-113180178 CTTAGGAGACAGATCTGACTGGG + Intronic
1103453618 12:121047644-121047666 CAGGTGAGCCAGATCAGACCAGG + Intergenic
1103738240 12:123074222-123074244 CTGTTAAATCAGATGAGACTTGG + Intronic
1104428230 12:128695587-128695609 CTTATGAGACAGTGCAGACTTGG + Intronic
1106535827 13:30641835-30641857 CTGTAGAAACACATCAGAATTGG - Intronic
1107541702 13:41394919-41394941 CTGTCCTGACAGATCAGCCTTGG - Intergenic
1109009034 13:56915937-56915959 CTGTTGATACAGAACAGTTTAGG - Intergenic
1111004167 13:82227294-82227316 CTGCTGAGACAAAACATACTTGG - Intergenic
1112471903 13:99696952-99696974 CTGTTGAAACAGAGAAGACAGGG - Intronic
1112999111 13:105611538-105611560 CTGGGGAGACAGAGCAGACCCGG + Intergenic
1114334986 14:21679692-21679714 CTGTAAAGACAGAACAGACAAGG - Intergenic
1121155885 14:91683549-91683571 ATTTTGAGACAAATCAGACATGG + Intronic
1127935690 15:63635389-63635411 CTGTTGAGACAGATCAGACTTGG - Intronic
1128111652 15:65079899-65079921 TTGTTGAGACTTATCAGACTAGG - Intergenic
1128758321 15:70197994-70198016 CTGTTGAGACACGTCAGGCTGGG - Intergenic
1133581643 16:7150004-7150026 CTGTTGAGTCAGAACAGAGGTGG - Intronic
1136987531 16:35124081-35124103 TTATTGAGACAGTACAGACTAGG + Intergenic
1140032475 16:71349541-71349563 CTGGGGAGACAAATAAGACTGGG + Intergenic
1141181621 16:81756853-81756875 CTCTCAAGACAGATCAGACTCGG - Intronic
1148570001 17:48660651-48660673 CTGTTCACACAGATAAAACTAGG - Intergenic
1150054256 17:61997767-61997789 CTGTAGAGACAAATAAAACTCGG + Intronic
1152477452 17:80527316-80527338 CAGTGGAGAGAGATCAGACAGGG + Intergenic
1153161473 18:2209278-2209300 TTGTTGAACCTGATCAGACTGGG - Intergenic
1153937656 18:9944290-9944312 CTGTTGAGACAGAACAAATGGGG + Intronic
1154388552 18:13917116-13917138 CTGTTGTGAGAATTCAGACTAGG + Intergenic
1159896773 18:74004420-74004442 AAGATGAGAAAGATCAGACTAGG - Intergenic
925254267 2:2468847-2468869 CTATTGAGGCAGATGAGACTGGG + Intergenic
927047609 2:19295759-19295781 CTTTTGAGAAAGATAGGACTTGG + Intergenic
930026648 2:47033288-47033310 CTGTGGATACAGATCTTACTGGG - Intronic
935955045 2:108367457-108367479 CCGGTGAGGCAAATCAGACTAGG + Intergenic
936442646 2:112568308-112568330 CTGTGGAGTGAGATCAGACATGG - Intronic
939780265 2:146437738-146437760 ATGTAGAGAGAGATCACACTGGG + Intergenic
940034029 2:149294498-149294520 CTATTGAGATAGAGAAGACTGGG + Intergenic
944659534 2:201909826-201909848 CTGAAGAGACAAATCAGAATAGG + Intergenic
1169118154 20:3080629-3080651 CTGTAGAGACTGAGCAGACAAGG + Intergenic
1170139516 20:13111729-13111751 CAGCTGAGAGAGAGCAGACTGGG + Intronic
1173310557 20:41892822-41892844 TTATTGAAACAGATCAGACCAGG + Intergenic
1175280524 20:57801203-57801225 CTGTTGTCACAGCTCAGCCTGGG + Intergenic
1183409580 22:37647027-37647049 CTGTTGAGACTGAGGACACTCGG + Intronic
953048635 3:39319318-39319340 CTTTTGAGACAGATCACAACTGG - Intergenic
953537171 3:43785249-43785271 CTGTAGAGACAGACCCGACTGGG - Intergenic
957668630 3:83270535-83270557 CTGCTGAGATATATCAGACATGG - Intergenic
960159653 3:114336416-114336438 CTGTTAAAACAGATCAGTTTTGG + Intergenic
960571907 3:119192776-119192798 CTGATGAGGCAGATCAGAGCAGG - Intronic
962163107 3:133020236-133020258 CATTTGAGACAAATCAGACAAGG - Intergenic
962261772 3:133914948-133914970 ATTGTGAGTCAGATCAGACTGGG + Intergenic
962830480 3:139134791-139134813 CTGTTGAAACTGGTCAGACCTGG + Intronic
964989096 3:162784664-162784686 CAGATGAGACAGATCAGGGTAGG - Intergenic
965551396 3:169968078-169968100 GAGTTCAGACAGATAAGACTAGG + Intronic
966877294 3:184330087-184330109 CTGTTAAGAAAGAAAAGACTGGG + Intronic
967149804 3:186638209-186638231 CTGTGGAGATAGATCAATCTAGG - Intronic
968894851 4:3393457-3393479 CTGAGGAGACAGGTCAGAATCGG - Intronic
969683443 4:8656009-8656031 GTGAGGAGACAGATCAGAGTCGG - Intergenic
972140153 4:35948720-35948742 CTCTTGAGACAGAACATACAAGG - Intronic
973123336 4:46551585-46551607 ATGTTGAGAAAAATCATACTAGG + Intergenic
974405487 4:61462907-61462929 CTGTTGAAACAGTTCTGACTAGG - Intronic
982344083 4:154337105-154337127 CAGATGAGAAAGATCTGACTTGG - Intronic
982755345 4:159211627-159211649 CTGTAGAGAAAGATCAGCCTGGG + Intronic
985670492 5:1204228-1204250 CTGTTAAGACACAGGAGACTCGG - Intronic
986091945 5:4517469-4517491 CTGGTGAGGCTGATCAGACATGG + Intergenic
988342468 5:29991050-29991072 CTGTGGAGACAGATCATCCATGG - Intergenic
990054762 5:51559123-51559145 CTGTTGAGCAACATCAAACTTGG - Intergenic
992861986 5:80920591-80920613 ATGGTGACAGAGATCAGACTAGG - Intergenic
993314995 5:86391658-86391680 CTTTTGAGACTGATCTAACTGGG - Intergenic
993951631 5:94182969-94182991 CTCTTGGGACAGAACAGGCTAGG - Intronic
999276794 5:150336779-150336801 ATGGTGAGACAAAGCAGACTCGG + Intronic
999291993 5:150431781-150431803 CTCTGGAGACAGCTCAGACCTGG - Intergenic
999742832 5:154569583-154569605 CTGCTGGGAAAAATCAGACTTGG - Intergenic
1006243184 6:32705500-32705522 TTGTTGAGACATGTGAGACTTGG - Intergenic
1009565306 6:65304789-65304811 CTGTTGAGGCAGAGCTGAGTCGG - Intronic
1009684619 6:66940830-66940852 CTTTTTAAACAGAACAGACTTGG + Intergenic
1010213361 6:73380748-73380770 CTGTTGAGACTAATCATATTTGG - Intronic
1014396951 6:120935602-120935624 CTGTGGAGACAGAACAATCTCGG + Intergenic
1014711977 6:124817088-124817110 CTGTTGAGTCAGCTCAGTCTTGG - Intronic
1016792518 6:148080212-148080234 CTGTTGAGACACAGCAGAGTTGG + Intergenic
1025153174 7:56576635-56576657 CTGTGTTGACAGATCAGTCTGGG + Intergenic
1026830681 7:73608150-73608172 CTGTAGAGGAAGATCAGGCTGGG - Intronic
1028975764 7:96911980-96912002 ATGTTGATAAAAATCAGACTAGG + Intergenic
1029657181 7:101934997-101935019 CTGCTGGGACAGATCCGACTTGG + Intronic
1035571762 8:677028-677050 CTGTTGAGACAGAGGAGAATAGG - Intronic
1038218237 8:25582506-25582528 TTGTTTAGCCAGATCATACTTGG - Intergenic
1041533602 8:58899931-58899953 TTGTTGAAACAGATCAAAATAGG - Intronic
1042121353 8:65491812-65491834 CTGCTAAGTCATATCAGACTGGG - Intergenic
1043274549 8:78376958-78376980 CAGCTGAGACAGAGCAGACAGGG - Intergenic
1047462251 8:125077707-125077729 CTGTTGAGAAGAATAAGACTTGG - Intronic
1049993035 9:1007893-1007915 CTTTGGAGACAGATCTAACTGGG + Intergenic
1050898035 9:10909121-10909143 CTGTTGATTGAGATCAGTCTTGG + Intergenic
1053277702 9:36795781-36795803 CTCTGGAGTCAGATCAGCCTGGG + Intergenic
1054888196 9:70222230-70222252 GAGTTGAGACAGAGCAGACCTGG + Intronic
1056150059 9:83776964-83776986 TTGTAGAGACAGATAGGACTGGG + Intronic
1058775060 9:108274727-108274749 CTATGGAGACAGATCACACTGGG - Intergenic
1060702573 9:125770681-125770703 GTGTTCAGGCAAATCAGACTTGG + Intronic
1187230585 X:17418480-17418502 CTGTTTTGACAGATTAGATTTGG - Intronic
1187245206 X:17547806-17547828 CTGCTGAGTCAGCTCAGACCTGG - Intronic
1188457832 X:30387488-30387510 CTGTAGAGACAGACCAGCCATGG - Intergenic
1189113394 X:38317759-38317781 CTGTTTAGAAACATCAGAATGGG - Intronic
1192211605 X:69131352-69131374 CTGTGGAGAGAAATCAGACATGG + Intergenic
1193754015 X:85384042-85384064 CTGTTGAGAAACTTTAGACTGGG + Intergenic
1195331563 X:103807324-103807346 GTGAGGAGATAGATCAGACTTGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1197088388 X:122507410-122507432 CTGATGAGACAGCTCAGAGTAGG + Intergenic
1197196764 X:123710147-123710169 CTGTTGACAGAGATCAGCCAAGG + Intronic
1197766661 X:130063707-130063729 GGGTTGAGACAGATCACGCTGGG + Intergenic
1199997342 X:153033729-153033751 CTGTGGACATAGACCAGACTGGG - Intergenic