ID: 1127935754

View in Genome Browser
Species Human (GRCh38)
Location 15:63636066-63636088
Sequence GACCTCACCACTTTCAGTTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127935747_1127935754 12 Left 1127935747 15:63636031-63636053 CCAAGTTTACCATAGTCACCATC 0: 1
1: 0
2: 5
3: 13
4: 126
Right 1127935754 15:63636066-63636088 GACCTCACCACTTTCAGTTAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1127935746_1127935754 18 Left 1127935746 15:63636025-63636047 CCATGGCCAAGTTTACCATAGTC 0: 1
1: 0
2: 0
3: 5
4: 110
Right 1127935754 15:63636066-63636088 GACCTCACCACTTTCAGTTAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1127935749_1127935754 -6 Left 1127935749 15:63636049-63636071 CCATCTCCCCAGCTAAAGACCTC 0: 1
1: 1
2: 0
3: 20
4: 258
Right 1127935754 15:63636066-63636088 GACCTCACCACTTTCAGTTAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1127935748_1127935754 3 Left 1127935748 15:63636040-63636062 CCATAGTCACCATCTCCCCAGCT 0: 1
1: 0
2: 3
3: 31
4: 282
Right 1127935754 15:63636066-63636088 GACCTCACCACTTTCAGTTAGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1127935745_1127935754 19 Left 1127935745 15:63636024-63636046 CCCATGGCCAAGTTTACCATAGT 0: 1
1: 0
2: 0
3: 1
4: 66
Right 1127935754 15:63636066-63636088 GACCTCACCACTTTCAGTTAGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127935754 Original CRISPR GACCTCACCACTTTCAGTTA GGG Exonic
902518409 1:17002170-17002192 GAGCTCCCCACTTTCAGCTGGGG + Intronic
904425002 1:30417400-30417422 GACCTCACCTCCTCCAGGTATGG - Intergenic
905823226 1:41010354-41010376 GACCTCACCACTTTCATTCCTGG - Intronic
906307161 1:44726681-44726703 GACTTTCCCACTTTCAGGTAGGG + Intergenic
911939656 1:104025908-104025930 CACCTCTCCACTTTCAATAATGG + Intergenic
913013391 1:114708374-114708396 GACCTCAGTACTTTCAGAAAGGG + Intronic
921816901 1:219574587-219574609 GAACTCACTACTTTCTATTATGG - Intergenic
1065661201 10:28005692-28005714 GGTCTCAACACTTTCAGTGAAGG - Intergenic
1066372400 10:34828547-34828569 GACCACACCACCTTCAGGAAAGG - Intergenic
1071732992 10:88267715-88267737 GACCTTCCCATTTTGAGTTAGGG + Intergenic
1075187966 10:120280212-120280234 GACTCCACCACTTTTATTTATGG + Intergenic
1083002125 11:59302145-59302167 GAACTCACCAGTCTCAGATAGGG + Intergenic
1085665836 11:78415517-78415539 CATATCACCAGTTTCAGTTAGGG + Intronic
1097602942 12:61717306-61717328 GACCAGACAACTTTCAGGTAAGG + Intronic
1097899875 12:64861999-64862021 AACTTAAGCACTTTCAGTTATGG - Intronic
1098612747 12:72481288-72481310 GAACTCACTACTTTCATTTCTGG - Intronic
1099295168 12:80821244-80821266 GACCTCTCCCCTCTCAGCTAGGG + Intronic
1109123561 13:58488815-58488837 GACTTGCCCACATTCAGTTAGGG + Intergenic
1109596253 13:64558168-64558190 GCCCTCCCTACTTTCAGTAATGG - Intergenic
1110560122 13:76902259-76902281 GATCTCACCAGTCACAGTTATGG + Intergenic
1111694762 13:91609474-91609496 CACGTCACCAATTTCTGTTAAGG + Intronic
1116112035 14:40597331-40597353 GACCTTCCCTTTTTCAGTTACGG + Intergenic
1118100700 14:62598878-62598900 GACCTCAACACTTTCAGCAGTGG + Intergenic
1127935754 15:63636066-63636088 GACCTCACCACTTTCAGTTAGGG + Exonic
1141736052 16:85854245-85854267 GAGCTCCCCACTTTAAGTAAAGG - Intergenic
1144563933 17:16344378-16344400 AACTTCACCACATTCAGATATGG + Intronic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1148405033 17:47404763-47404785 TACTTGAACACTTTCAGTTATGG + Intronic
1154029009 18:10734032-10734054 AACTTCACCAATTTCAGTTAAGG - Intronic
1165822820 19:38687289-38687311 GACCTCAGATCTTTCATTTATGG + Intronic
932097449 2:68864115-68864137 TTCCTCACCACTTTCAGTCCTGG + Intergenic
944661346 2:201924294-201924316 GAGCTCCCCACTTTCAGATGGGG + Intergenic
945405724 2:209446423-209446445 GACATCACCAATCTCAGTTCTGG + Intronic
1169249006 20:4046122-4046144 GTCCTCACCCCTGTCAGCTACGG - Intergenic
1170712544 20:18805432-18805454 GACTTTACCACAGTCAGTTAGGG + Intergenic
1173419832 20:42891208-42891230 GACCTCACCACAATCATTTTTGG + Intronic
1177757683 21:25367578-25367600 GACCTCAACACTTCCAGCCAAGG + Intergenic
1178476301 21:32940200-32940222 GACCTGACCACTCTCTGTTGTGG - Intergenic
1178897034 21:36567514-36567536 TACATGACCACTTTCATTTAGGG + Intronic
1184808210 22:46810141-46810163 GGGCTCACCACTTGCAGTTTAGG + Intronic
963555153 3:146777951-146777973 GTCCTCCCCACCTTCTGTTAAGG - Intergenic
965047740 3:163600433-163600455 GACCTCAACACTTTCAGCATTGG + Intergenic
967473902 3:189893472-189893494 GATATCACCACAGTCAGTTAAGG + Intronic
968529351 4:1082496-1082518 GCCCTCAGCAGTTTCAGTTTGGG + Intronic
969561811 4:7953192-7953214 CACCTTACCACTTTCAATCAAGG - Intergenic
970693820 4:18651419-18651441 GCCCTCACCCCTTTCAGTTGTGG - Intergenic
971352191 4:25863886-25863908 GGCCTCACCCCTTTCATTTGGGG - Intronic
972006711 4:34118667-34118689 GACCTCACCATTTTTAGATCTGG - Intergenic
973560657 4:52131819-52131841 GAGCACACCACTTCCACTTACGG - Intergenic
973867917 4:55132757-55132779 GATTCCACCACTTACAGTTATGG - Intergenic
975210684 4:71696426-71696448 GATCTCTCCACTTTCATTTTTGG + Intergenic
976679213 4:87736434-87736456 CACCTCAACATTTTCAGTTTAGG + Intergenic
979100045 4:116601757-116601779 TACCTCCCCACTTCCAGTTTCGG + Intergenic
983352125 4:166603089-166603111 GAACTCACTACTTACAGTTTAGG - Intergenic
984749012 4:183253622-183253644 GACCACACCTCTTTCTGGTAAGG + Intronic
985989109 5:3540389-3540411 AACCTCATCATTTACAGTTAAGG + Intergenic
988623694 5:32848926-32848948 GACCTCACCACTCTTACTTAAGG - Intergenic
989352354 5:40500657-40500679 AAATTCTCCACTTTCAGTTATGG + Intergenic
993409743 5:87558956-87558978 AACTTTCCCACTTTCAGTTAGGG + Intergenic
999131220 5:149284926-149284948 AAACTCTCCACTTTGAGTTAGGG + Intronic
1006631874 6:35435972-35435994 GTCCTCACCACATACAGTTTCGG + Intergenic
1009423714 6:63491191-63491213 GACCTCTCAGCTTTCAGTCAGGG - Intergenic
1009712589 6:67345122-67345144 GAATTCACCATTTTCAGTGAAGG + Intergenic
1011001637 6:82595463-82595485 GACTTCAGTACTTTCGGTTAGGG - Intergenic
1015741157 6:136455397-136455419 GAATTCCCCACTTTCAGTAATGG + Intronic
1020875182 7:13684646-13684668 GACATCACTAATTGCAGTTATGG - Intergenic
1030014553 7:105205669-105205691 GACCATTCCACTTTCAGTAAGGG - Intronic
1044318253 8:90774217-90774239 TACCTCACCACTGTCTTTTAGGG + Intronic
1049000722 8:139824150-139824172 GACCTGACCACTTTCTTTAATGG - Intronic
1049154887 8:141060359-141060381 GAACCCTCCACTTTCACTTAAGG - Intergenic
1062290804 9:135793557-135793579 CACCTCACCACGTTCACTTCAGG + Intergenic
1195598028 X:106715066-106715088 CAACTCACCAATTTCAGTCATGG - Intronic
1201275059 Y:12288689-12288711 GTCCTCACCACTTTCTCTTGTGG - Intergenic
1202274895 Y:23107074-23107096 GACCTCTCCGCTTTGACTTAAGG + Intergenic
1202291133 Y:23313615-23313637 GACCTCTCCGCTTTGACTTAAGG - Intergenic
1202427887 Y:24740796-24740818 GACCTCTCCGCTTTGACTTAAGG + Intergenic
1202442904 Y:24929295-24929317 GACCTCTCCGCTTTGACTTAAGG - Intergenic