ID: 1127939626

View in Genome Browser
Species Human (GRCh38)
Location 15:63681850-63681872
Sequence GAGAACAGAAGGAAGCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 6, 3: 26, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127939626 Original CRISPR GAGAACAGAAGGAAGCCTAC AGG Intronic
900548554 1:3242058-3242080 GGGAACAGGAGGGAGCCTCCCGG + Intronic
902648136 1:17818343-17818365 GAGAGCAGAAGAAAGATTACAGG - Intronic
904740191 1:32668778-32668800 GACATCAGAAGGAAGGCTATGGG + Exonic
909076615 1:71056329-71056351 TAGATCAGAAAGAACCCTACTGG - Intergenic
909582794 1:77256854-77256876 GAGAACAGATGGACACATACAGG - Intergenic
910468961 1:87530260-87530282 GTGAACAGGAGGAAGCTCACAGG + Intergenic
910615659 1:89195409-89195431 GAGCCCAGAGGGAAGCCTGCAGG + Exonic
910632408 1:89369539-89369561 GAGCCCAGAGGGAAGCCTGCAGG - Exonic
911029442 1:93470472-93470494 GACAAGAGAAGCAAGCCAACTGG - Intronic
911638903 1:100266480-100266502 GAGAAGAGAAGTAAGCACACCGG - Intronic
916789093 1:168109318-168109340 GAAAAAAGAAAGAAACCTACAGG + Intronic
916930692 1:169575537-169575559 GAGAACAGATAGAAGACTCCAGG + Intronic
917241069 1:172949349-172949371 GAGAACAAAACGAAGCTAACTGG - Intergenic
917642156 1:176993419-176993441 GAGAACAGAAGCAAGTGTTCTGG + Intronic
918083752 1:181227796-181227818 GAGAAGAGAAGGAAGGATGCTGG - Intergenic
919155644 1:193762421-193762443 GGGAACAGAAAGAAGTCAACTGG + Intergenic
919220246 1:194618860-194618882 AAGAAATGAAGGAAGCCTACAGG + Intergenic
919272646 1:195369596-195369618 GAGAACAGTATGAAGTCAACAGG + Intergenic
920170230 1:204067423-204067445 GAGAACAGGAAGAAGCATACTGG - Intergenic
920258857 1:204675217-204675239 GAGGTCAGAAGGAGGCCAACTGG + Intronic
921303534 1:213772847-213772869 GAGAACAGAAGGAAACCAGTTGG - Intergenic
921839703 1:219815497-219815519 GAGAATTGGAGGAAGACTACAGG - Intronic
922318816 1:224466275-224466297 GAGAACAGAAGAATGGCTGCTGG - Intronic
922507725 1:226136167-226136189 GAGGGCAGAAGCCAGCCTACTGG + Intergenic
922933656 1:229408400-229408422 GGGAACAGAAAGAAGCCATCAGG + Intergenic
923000844 1:230005203-230005225 GAGGGCAGAAGGAGGCCTGCAGG - Intergenic
923462583 1:234219956-234219978 GAGACCAGCAGGCAGTCTACTGG + Intronic
1063139819 10:3245887-3245909 GAGAATAGAAGAAAGCCAATCGG - Intergenic
1063310937 10:4951096-4951118 TAGAGCAGAAGGATGGCTACTGG + Intronic
1063656831 10:7998968-7998990 GAAAACAGAACAAAGCCTTCAGG + Intronic
1063746984 10:8895116-8895138 GAGAACACATGGACGCATACAGG - Intergenic
1063837425 10:10031180-10031202 GAGTACAGAGGGGTGCCTACAGG - Intergenic
1064082966 10:12323345-12323367 GACAACGGAAGGACGCCCACAGG - Intergenic
1064562614 10:16607813-16607835 GAGCACAGAAGGAATCTTAGAGG - Intronic
1065193687 10:23239661-23239683 GAGAACAGAAAGAAACAGACAGG + Intronic
1066633600 10:37480109-37480131 AACAACAGAAGGAAGCCCACAGG - Intergenic
1067185289 10:44021986-44022008 GAATAAATAAGGAAGCCTACTGG + Intergenic
1069225758 10:65942267-65942289 TAAAACAGAAGGAAGCATCCAGG + Intronic
1071052921 10:81473352-81473374 GAGAGCAGAAGGAGGCAGACAGG + Intergenic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1071509853 10:86254689-86254711 CAGCACAGCTGGAAGCCTACTGG - Intronic
1072651568 10:97299852-97299874 GAGAAAAGAAAGAAGGCAACTGG - Intergenic
1073148164 10:101293704-101293726 GAGAAAAGAAGGAAATATACTGG + Intergenic
1073348858 10:102804730-102804752 CAAAACAGAAGGAAGACTAATGG + Intronic
1073586701 10:104717378-104717400 GAGAACAGAAGGAAACCTGAAGG - Intronic
1076349662 10:129807334-129807356 CAGAACATAAGGAAGCCTCCTGG - Intergenic
1076501836 10:130943331-130943353 AAGAACAGCTGGAAGACTACTGG + Intergenic
1076838096 10:133031476-133031498 GGGAACTGCAGGAACCCTACAGG + Intergenic
1077277890 11:1725049-1725071 GAGAACAGAAGGATAACTACAGG + Intergenic
1078671257 11:13367732-13367754 GAGAACACAAGGGAGATTACTGG + Intronic
1079322668 11:19464431-19464453 GAGAGCAGAATGAAGCAAACAGG + Intronic
1079993066 11:27266847-27266869 AGGAACAGAAAGAAGCCTAGTGG - Intergenic
1080026297 11:27618822-27618844 GAGAAAAGAAGGATGCCAAAAGG - Intergenic
1080202495 11:29689218-29689240 AAGAACAGAAAGATGCCTAGAGG + Intergenic
1080729847 11:34938141-34938163 GTGAACAGAAGGACGACTAGAGG + Intronic
1083489081 11:63001566-63001588 CAGAACAGCAGGAAGCCTGACGG - Intronic
1083737574 11:64690458-64690480 GAGAACAGTAAGGACCCTACTGG + Exonic
1085007586 11:73107615-73107637 GAGAGTAGAAGGAAGTTTACTGG - Intronic
1085250607 11:75141170-75141192 GTGAACAGGAGGAAGGCTGCAGG + Intronic
1085517462 11:77119704-77119726 GAGAACGGAATGAAGCCACCGGG + Intronic
1086968672 11:93056835-93056857 GAGAATACATGGAAGCCTAGAGG - Intergenic
1087542287 11:99534947-99534969 GAGAACTGAAAGAAGGCTAGTGG + Intronic
1087892843 11:103554514-103554536 GAGAACACAAGGAAACTTAGAGG - Intergenic
1088318595 11:108532055-108532077 GAGAACAAATGGAAGACTGCAGG - Intronic
1088574076 11:111252708-111252730 GAGGACAGAGGGAAGACTAATGG - Intergenic
1089132733 11:116224947-116224969 GAGAAAAGGAGGCAGCCTCCCGG + Intergenic
1089569818 11:119398029-119398051 AAAAAAAGAAGAAAGCCTACAGG + Intergenic
1091042713 11:132297049-132297071 CAGAAGAGCAGGAAGCCTATTGG - Intronic
1091363629 11:134999102-134999124 GAGCTCAGAATGAAGCCTTCAGG + Intergenic
1092696083 12:11172554-11172576 GAGAACAGTATGAAGTCAACAGG + Intergenic
1092721704 12:11447602-11447624 GAGAACATGAGGAAGACCACTGG - Intronic
1095787105 12:46121930-46121952 GAGTACAGAAGGGAGCATTCTGG + Intergenic
1096384379 12:51185226-51185248 GGGAAGAGAAGGCAGCCAACGGG - Intergenic
1096903927 12:54915840-54915862 GAGAACAGTAAGAAGTCAACAGG - Intergenic
1097738714 12:63212804-63212826 GAAAGCAGAAGGTAGCCTCCAGG - Intergenic
1097744387 12:63285309-63285331 GAGAAGAGAAGGAGCCCTAAGGG + Intergenic
1097929991 12:65172296-65172318 GAAAAGAGTAGGAAGCCTTCAGG - Intronic
1101965000 12:109276491-109276513 GACACCAGAAGAAAGCATACAGG - Intergenic
1102057656 12:109908659-109908681 GAAAGCAGATGGAAGCCTTCCGG + Exonic
1102823381 12:115926672-115926694 GGGAAGGGAAGGAAGCCTGCAGG + Intergenic
1102871942 12:116420546-116420568 AACAACAGAAGGAATCCTATGGG - Intergenic
1104108642 12:125686392-125686414 GAGAAGAGAAAGCAGCCAACAGG - Intergenic
1106091548 13:26599769-26599791 TAGAACACAAAGAAACCTACAGG - Intronic
1106136550 13:26977887-26977909 GGGAGCAGAAGGAAGCCTTCAGG - Intergenic
1106569524 13:30914615-30914637 GGTCACAGAAGGAAGCCTGCTGG - Intronic
1107341680 13:39413800-39413822 AGGAATAGAAGGAAGGCTACTGG - Intronic
1109207611 13:59499633-59499655 GAAACCAGAGGGAAGTCTACCGG - Intergenic
1109334220 13:60971780-60971802 GAGAACAGAAGGAAGGGTGGGGG - Intergenic
1110184334 13:72655894-72655916 GAGAACAGAAGGAAGAATGTAGG + Intergenic
1110478647 13:75947726-75947748 AAGGAGAGAAGGCAGCCTACTGG + Intergenic
1111982478 13:95031423-95031445 GAGAACAGAAGGTAGATTGCTGG - Intronic
1113091273 13:106619372-106619394 GAGACCAGGAGGAAGGCCACTGG - Intergenic
1113139881 13:107135431-107135453 AAGGACAGAAGGAAGCAAACAGG - Intergenic
1113143653 13:107183211-107183233 GACAAGAGAAGCAAGCCAACTGG - Intronic
1113750099 13:112770983-112771005 CAGAACAGAAGCAAGCCGACCGG - Intronic
1114323226 14:21564339-21564361 GACATCAGAAGGAAGGCTATGGG + Intergenic
1115924936 14:38422023-38422045 GAGAATAGAAGGATGTTTACTGG - Intergenic
1116224402 14:42130581-42130603 GAAAACAGAAGGAAGTCTTGTGG - Intergenic
1116229394 14:42196892-42196914 TAGAACAGAAGGAAGTCAAGGGG + Intergenic
1116585125 14:46693951-46693973 GGGAACAAAAGGAAGACTACTGG - Intergenic
1116766296 14:49074599-49074621 AAGAAAAGAAGGAAAACTACAGG + Intergenic
1117684272 14:58237506-58237528 GAGAAAAAAAGGAAAACTACAGG + Intronic
1117723727 14:58652059-58652081 AAGAAAAGAAGGAAGCTTATGGG - Intergenic
1118073113 14:62268009-62268031 GAGAACAGAAGGATGGGGACAGG - Intergenic
1118729687 14:68657675-68657697 GTGTACTGAAGGAAGCCTGCAGG + Intronic
1119488258 14:75006746-75006768 CAGAAAAGAAGGAAGCCAAAGGG + Intronic
1120378583 14:83743056-83743078 GGGAACACAGGGAAGCCTAGTGG - Intergenic
1120692638 14:87610070-87610092 AAGAAGAGAAGGAAGCATACAGG + Intergenic
1121728942 14:96173053-96173075 GAGAAAAGAAGGCAGCCACCTGG - Intergenic
1123970200 15:25501110-25501132 GAGAACACAAGGATGCCTGTCGG - Intergenic
1124216233 15:27808960-27808982 AAGGACAGAAGGAAGACAACAGG - Intronic
1125132172 15:36295793-36295815 GAGAACTGAAGGAACCCTTTTGG - Intergenic
1125493604 15:40168390-40168412 GAGAAAAGAAAAGAGCCTACTGG + Intronic
1126428169 15:48551710-48551732 GAGAACAGATGGACGCATAGAGG - Intronic
1126768621 15:52033441-52033463 AGGAACAGAAGGAAGCATCCAGG - Intronic
1127051462 15:55088559-55088581 GAGAATTGAAGGAAGCCTTGGGG - Intergenic
1127939626 15:63681850-63681872 GAGAACAGAAGGAAGCCTACAGG + Intronic
1128545647 15:68565935-68565957 GAGAGCAGAAGGGAGCCTTGGGG + Intergenic
1129958117 15:79657848-79657870 GAGGACAAAAGGAAGACTGCAGG - Intergenic
1130760190 15:86811330-86811352 GAGAACAGTCAGAAGGCTACTGG + Intronic
1131471855 15:92704494-92704516 GGGAAAGGAAGGAAGCCAACAGG - Intronic
1132363848 15:101241387-101241409 GAAAACACAAGGAAGACTATTGG - Intronic
1133899061 16:9956204-9956226 GAAAACACAAGAAAGCCCACAGG - Intronic
1135554028 16:23420497-23420519 GTGAACAGAAGGAAGCTTTTAGG - Intronic
1136176392 16:28519957-28519979 GAGAGCACAATGGAGCCTACTGG + Intergenic
1138367554 16:56493542-56493564 GAGAACAGAATGAAGGTCACAGG + Intronic
1138720272 16:59071821-59071843 GACAAAAGAAGGAAGAGTACTGG + Intergenic
1139312358 16:66038307-66038329 GAGAAGAGAAGGCAGCACACAGG + Intergenic
1140737825 16:77913965-77913987 GAGAAAATAAGGCAGCCTTCAGG - Intronic
1203012163 16_KI270728v1_random:305198-305220 GAAAACAGAAGGAAGCTATCTGG + Intergenic
1203030498 16_KI270728v1_random:578357-578379 GAAAACAGAAGGAAGCTATCTGG + Intergenic
1203041223 16_KI270728v1_random:756074-756096 GAAAACAGAAGGAAGCTATCTGG - Intergenic
1144373025 17:14611104-14611126 AAGAGAAGAAAGAAGCCTACAGG - Intergenic
1144796677 17:17896165-17896187 GAGAACAGAAAGAACCCCTCTGG - Intronic
1146409226 17:32567754-32567776 GTGCACAGAAGGACACCTACAGG + Intronic
1146866387 17:36338508-36338530 GAGAACAGAAGAGAGCCTACTGG + Intronic
1147069257 17:37939120-37939142 GAGAACAGAAGAGAGCCTACTGG + Intergenic
1147080785 17:38018657-38018679 GAGAACAGAAGAGAGCCTACTGG + Intronic
1147096728 17:38142617-38142639 GAGAACAGAAGAGAGCCTACTGG + Intergenic
1147700744 17:42392857-42392879 AAGAATAGAAGGAAGCCTAGAGG - Intergenic
1147879302 17:43643630-43643652 GAGAACAGAGGGAAGCCGGAGGG - Exonic
1149845080 17:60004350-60004372 GAGAACAGAAGAGAGCCTACTGG - Intergenic
1149890147 17:60381851-60381873 GAGAACAGGAGAGAGCCTACTGG - Intronic
1151192933 17:72411907-72411929 GAGAAAAGGAGGAAGCCAACCGG + Intergenic
1151448349 17:74181861-74181883 GAGAAGGGAGGGAAGCCTGCAGG - Intergenic
1151546629 17:74797283-74797305 CCGAACAGAAGGAACCCTTCAGG + Intronic
1152037934 17:77884703-77884725 GAAAACAAGAAGAAGCCTACAGG + Intergenic
1152058154 17:78049051-78049073 GAGAACAGTAGCATGGCTACAGG + Exonic
1153918937 18:9771473-9771495 GAAAAGAGAATGAAGCCTACTGG - Intronic
1155424718 18:25695056-25695078 GAGAACAAATGGAGGCCCACAGG - Intergenic
1156901349 18:42303707-42303729 CAGAACAGAAGGAAACCTTGGGG + Intergenic
1157423243 18:47563466-47563488 GAGATCAGAAGGGAACCTAGGGG - Intergenic
1158847851 18:61463571-61463593 GAGAAGAGAAGGAAGCCAAAGGG - Intronic
1159619672 18:70622776-70622798 AAGATCACAAGGAAGCCTGCAGG + Intergenic
1160042821 18:75360934-75360956 GAGAACAGAAGGAGTCCTGCCGG - Intergenic
1160373991 18:78397007-78397029 CAGAACAAAAGGCAGCATACTGG - Intergenic
1160666287 19:330735-330757 GAGAACAAGAGGGAGCCTTCTGG - Intronic
1161362077 19:3856034-3856056 GAGAGCAGAAGGAAGCGTGAAGG + Intronic
1162484542 19:10951175-10951197 GACAACTTTAGGAAGCCTACGGG - Intergenic
1162495025 19:11018738-11018760 GAGGACAGAAGGGAGGCCACTGG - Intronic
1163822784 19:19505708-19505730 GAGAAAGGAAGAAAGCCCACGGG - Exonic
1164159123 19:22615263-22615285 AGGAACAGAAGGAAGACTGCTGG + Intergenic
1164508688 19:28880065-28880087 GAGAGCAGAAGGATGGTTACAGG - Intergenic
1166277367 19:41763302-41763324 GAGACCAGAAGCAAGTCTAGAGG - Intronic
1168707208 19:58476977-58476999 GAGAGCAGGAGGAAGCCTCAGGG - Intronic
924962726 2:47788-47810 GAGAAGAGAAGGAAGGATGCGGG + Intergenic
925260393 2:2523733-2523755 CAGAAGAGAAGGGAGCCTGCTGG + Intergenic
925372239 2:3355122-3355144 CAGGACAGGAGGAAGCCTAGGGG + Intronic
925943374 2:8839797-8839819 GAGGACAGAAGGAGGACTAGGGG - Intergenic
926494822 2:13573115-13573137 GAGAACAGAACCAAGGCTAAAGG + Intergenic
928264729 2:29802208-29802230 GAGAAAAGAAGAAAGCTTAGAGG + Intronic
929411915 2:41706627-41706649 GAGGAAAGAAGGAAGCAAACAGG + Intergenic
932565252 2:72902017-72902039 GTGACCAGAAGGAAGGCCACGGG + Intergenic
932575796 2:72961762-72961784 GAGAACAGAAGACACCCCACTGG + Intronic
932706070 2:74026081-74026103 GAGAGCAGAAGGCAGCTTCCTGG - Intronic
932845692 2:75133965-75133987 GAGACCAGAAGGATGACTTCTGG + Intronic
933720134 2:85392460-85392482 GAGGACAGAAGGTAGCATAGTGG - Intergenic
934481909 2:94657325-94657347 GAGAACAGATGAAATCCTAGGGG + Intergenic
935077190 2:99756476-99756498 CAGACCAGAAGGAAGGCAACGGG - Intronic
935137970 2:100323743-100323765 GAGAACAGAAAGAAGCTTGCCGG + Intergenic
935561162 2:104561508-104561530 GAGAAAGGAAGGAAGTCTCCTGG + Intergenic
936664442 2:114577860-114577882 GGGAACAGAGGGAGGCTTACAGG - Intronic
937926685 2:127173273-127173295 GAGAACATGAGGAAGCCAGCTGG - Intergenic
938899543 2:135788350-135788372 GAAAACACAACGAAGCCAACAGG - Exonic
940438521 2:153684844-153684866 GAGAACACAAGGAAACATAGAGG - Intergenic
940505193 2:154545458-154545480 GGGAACATAAGGAAACTTACTGG + Intergenic
940777527 2:157900435-157900457 AAGCAAAGAAGGAAGCCAACTGG - Intronic
942577545 2:177380359-177380381 GTGAACATCAAGAAGCCTACAGG - Intronic
943836183 2:192516652-192516674 GGGAACACAGGGAAGCCTTCAGG + Intergenic
944019309 2:195082248-195082270 GAGAACAGAAAGAAGTGAACAGG - Intergenic
945061249 2:205910751-205910773 GAGAATAGAAGACAGCCCACGGG - Intergenic
947628076 2:231633563-231633585 GAGAAGAGAAGGAAGCTGATAGG + Intergenic
947829013 2:233125717-233125739 GAGAACAGCAGGAAGGCCATTGG - Intronic
948332394 2:237180022-237180044 GAGGAAGGAAGGAAGCCTGCTGG + Intergenic
948384478 2:237573009-237573031 GAGAGCAGAAGGAAGCCCGGAGG + Intergenic
948715597 2:239859200-239859222 GAGAACTGCAGGAAGACTTCTGG + Intergenic
948816801 2:240514657-240514679 GAGCACAGAAGGAATCCAAGAGG + Intronic
1168770160 20:409260-409282 GAGAACCGAAGGAAGCCAGTGGG - Intronic
1169315369 20:4586005-4586027 GAGAAGAGAAGGAAGCTGGCTGG + Intergenic
1169508674 20:6240861-6240883 GAGAGTAGAAGGATGCTTACTGG - Intergenic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1171280233 20:23890054-23890076 GAGGACAGAACCAAGCCGACGGG - Intergenic
1172368771 20:34370772-34370794 CAGGAGAGAAGGAAGACTACTGG + Intronic
1173458235 20:43220967-43220989 GAGTACAGGAAGAAGCCAACAGG + Intergenic
1173653336 20:44681791-44681813 GAGAACAGAAGAAATACTTCTGG + Intergenic
1173725230 20:45292920-45292942 GATGACAGAAGGAAGGCCACAGG + Intergenic
1178154031 21:29831299-29831321 GGGAACTGAAGGAAGCCAATGGG - Intronic
1178635695 21:34300524-34300546 GAGAAAAGAAGGTAGACTAGAGG - Intergenic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1182534515 22:30990641-30990663 GACACCAGAAGGAAGCGTCCTGG - Intergenic
1182763070 22:32738553-32738575 AAGAACAACAGGAAGCCAACAGG - Intronic
1183732714 22:39627719-39627741 GAGAGCAGAAGGAAAGCTACTGG + Intronic
1184351815 22:43949260-43949282 GCTAACAGAACAAAGCCTACTGG - Intronic
1184489204 22:44799503-44799525 AAGAACTGAAGGAAGGCTGCTGG + Intronic
1184899436 22:47435309-47435331 GAGGACACAAGGAAGCCACCAGG + Intergenic
951470435 3:23050766-23050788 GAGAACAGGAGGGAGTCCACTGG + Intergenic
951491017 3:23270508-23270530 GAGAACAGAACGAGCCCTGCAGG - Intronic
953867437 3:46596361-46596383 GAGAAGAGGAGGAGGCCTGCAGG - Intronic
954901283 3:54022168-54022190 GAGAACAGAAGGAAGAGTCAGGG + Intergenic
957019502 3:75109238-75109260 GTGAAGAGAAGGATGCCAACTGG + Intergenic
957717582 3:83949759-83949781 GAGAACAGAAGAAAATCTACTGG + Intergenic
959859035 3:111195759-111195781 GAGAACAGATGGAAGGCACCAGG - Intronic
960910505 3:122644615-122644637 GAGAAAAGAAGAAAGGCTAATGG + Intergenic
961025397 3:123551139-123551161 GAACACAGAAGGAAGGCCACAGG - Intronic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
961319360 3:126062175-126062197 GAGAACAAAAGGGTGCCTCCTGG + Intronic
963270224 3:143279206-143279228 GAGAAGAGAAGCAAACCTTCAGG - Intronic
964572689 3:158127338-158127360 GAAAAGTGAAGGAAGCCTAAGGG - Intronic
969435869 4:7189070-7189092 GAGAATGGAGGGAAGCCTGCAGG - Intergenic
970515709 4:16828076-16828098 GAGAGCAGATGGAAGCATCCTGG - Intronic
971209570 4:24602728-24602750 TAGAACAAAAGGGAGGCTACTGG + Intergenic
974069006 4:57107368-57107390 GAGAATAGAAGGGAACCTAGAGG + Intronic
974086836 4:57270406-57270428 GAGGACAGAAGGAAGCCACTTGG + Intergenic
978303943 4:107301518-107301540 GAGAAGAAATGGAAGCCTAGAGG + Intergenic
978392017 4:108236848-108236870 GAGGCCAGAAAGAAGCCTACTGG + Intergenic
978547197 4:109883447-109883469 GAGAAAAGAAGGAAGCAAAATGG + Intergenic
979164728 4:117514454-117514476 GAGAACACAAGGAATCCTGGGGG - Intergenic
980014450 4:127632833-127632855 GAGAACAGAAAGCAGCCAATGGG - Intronic
980118938 4:128708040-128708062 GAGAAGAGAAGAAAGGCTCCGGG - Intergenic
981358306 4:143818417-143818439 AAGAAAAGAAAGAAGCCAACAGG - Intergenic
981955193 4:150463841-150463863 ATGACCAGAAGGAAGCCTCCAGG - Intronic
982620722 4:157701025-157701047 CAGAAAAGAAGGAAGCCAATGGG - Intergenic
982771559 4:159401472-159401494 GTGAGCAGCAGGAAGCCTTCAGG - Intergenic
987124373 5:14797855-14797877 GACATCAGAAGGAAGGCTATGGG - Intronic
988475568 5:31582282-31582304 GAGGAGAGTAGGAAGCCTAGGGG - Intergenic
988957740 5:36335870-36335892 GATACAAGAAGGAAGCCTGCAGG + Intergenic
991238418 5:64426806-64426828 GAGAGCAGAAGGATGGCTAAAGG + Intergenic
993335000 5:86646046-86646068 GAAAACAGAATGAAGCCAAGAGG - Intergenic
993664210 5:90675236-90675258 GAGAACTGCAGCAAGCCTAGTGG - Exonic
994475966 5:100270358-100270380 GATAAAAGAAGCAAGCCAACTGG + Intergenic
994617872 5:102129011-102129033 GAGAACAGCAGCAAGCCTTGTGG - Intergenic
994866788 5:105283198-105283220 GAGAACAGAATGCAACCAACTGG - Intergenic
995511795 5:112918043-112918065 GATAACAGGAGGCAGACTACTGG - Intronic
996898792 5:128519870-128519892 GAGAAGAAAAGGAAGCCAAGGGG + Intronic
997597120 5:135114487-135114509 GACAACAGAGGGAAGGCTCCAGG + Intronic
998788909 5:145744430-145744452 CTGTACAGAAGGAATCCTACTGG + Intronic
998861775 5:146451410-146451432 GAGAACAGGAGGAACCTGACAGG - Intronic
999001561 5:147929343-147929365 GAGCACAGAAGGAAGATTAGAGG + Intergenic
999739091 5:154535642-154535664 GTGTACAGCAGGAAGCATACAGG - Intergenic
999883635 5:155895069-155895091 GTGATCAGAAGTAAGTCTACAGG - Intronic
1000095464 5:157967430-157967452 GAGCACAGAAGGCACCCTGCCGG - Intergenic
1000169710 5:158690138-158690160 AAGAACAGAAAGAAGGCTAGAGG - Intergenic
1000818571 5:165955508-165955530 GAGAAGAGAAAGAAGTCTAATGG + Intergenic
1001052116 5:168422043-168422065 GAGAACTGGAGGAAGCCACCCGG + Exonic
1002160339 5:177311070-177311092 GAGAAGAGGAGGAAGCCAGCGGG + Intronic
1003100907 6:3175931-3175953 GGGAACAGAAGGCAGCCCCCAGG + Intergenic
1004184581 6:13411123-13411145 AAAAACAGAAGGAAGACTCCAGG + Intronic
1007271927 6:40644354-40644376 GAGATGACAAGAAAGCCTACAGG + Intergenic
1008526522 6:52412817-52412839 GACTACAGAAGAAACCCTACTGG + Intergenic
1008703590 6:54130687-54130709 CAGAAAAGTGGGAAGCCTACGGG + Intronic
1009036267 6:58120484-58120506 GACATCAGAAGGAAGGCTATGGG - Intergenic
1009212083 6:60874098-60874120 GACATCAGAAGGAAGGCTATGGG - Intergenic
1010392495 6:75353679-75353701 AAAAACAGAAAGAAACCTACCGG - Exonic
1010534580 6:77011526-77011548 AAGAACAGCATGAAGCCTAGGGG + Intergenic
1010850649 6:80772350-80772372 GAGTACATATGGAAGCCTATAGG + Intergenic
1014310899 6:119800070-119800092 GAGCAAAGAAGGAAACTTACCGG - Intergenic
1016894515 6:149039103-149039125 GAGAACACAGGAAAGTCTACAGG - Intronic
1017715768 6:157211995-157212017 GAGCACAGTTGGGAGCCTACAGG - Intergenic
1017844478 6:158244554-158244576 GAGAAAAAAAGCAAGCCTCCTGG - Intronic
1018101156 6:160441643-160441665 GAGAACACACAGAAGTCTACTGG + Intronic
1020510319 7:9048404-9048426 GAGAACAGAATCAAGACAACGGG - Intergenic
1023258658 7:38336593-38336615 GAGAACACAGGGAAACTTACAGG + Intergenic
1023387223 7:39671137-39671159 AAGAACAGGTGGAAGGCTACAGG - Intronic
1023635018 7:42200898-42200920 GAGAACAGAATGCTGCCTAGTGG + Intronic
1024548189 7:50539525-50539547 GAGAACAGAAGGAATGAGACAGG + Intronic
1029119386 7:98256527-98256549 GAGACCATATGGATGCCTACTGG - Intronic
1030277993 7:107740379-107740401 CAGAAAAGAAGGAAGGCTGCAGG + Intergenic
1032212578 7:129929388-129929410 GAGAGGAGAAGGAAACATACTGG - Intronic
1033821194 7:145135916-145135938 GAGAATAGAAGGATGGTTACCGG - Intergenic
1035076820 7:156184392-156184414 GAGAATGGAAGGGAGACTACTGG + Intergenic
1035451496 7:158980022-158980044 GAGCTCAGGAGGAAGCCTGCAGG + Intergenic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1036633550 8:10531997-10532019 CAAAACAGAAGAAAGTCTACTGG + Intronic
1037453673 8:19042209-19042231 GAAAACAAAAAGGAGCCTACAGG - Intronic
1038515886 8:28187411-28187433 GAGAACAGAATGAAGGCTCCAGG - Intronic
1040984209 8:53276032-53276054 GAGAACAGATGTAATCCTTCAGG + Intergenic
1041015301 8:53587238-53587260 GAGAGTGGAGGGAAGCCTACGGG + Intergenic
1041670790 8:60489722-60489744 GAGGACAGAAAGATGCCTAAGGG - Intergenic
1041790835 8:61694422-61694444 GAAACCAGATGGAAGCCTACAGG - Intronic
1042336901 8:67639294-67639316 GAGAACAGAAGGAGCCCAGCAGG - Intronic
1042796006 8:72664140-72664162 GAGATCAGAATGAGGCTTACCGG + Intronic
1043765258 8:84122778-84122800 GAGAACAGAAGAAAGCGAATGGG + Intergenic
1043834973 8:85035512-85035534 GAGATCAGAAATAAGCATACTGG + Intergenic
1044175151 8:89110887-89110909 AAGGAATGAAGGAAGCCTACAGG + Intergenic
1044966103 8:97575466-97575488 GAGAACAGAAAGAAGGCCAGTGG + Intergenic
1046056983 8:109090631-109090653 GAGAAAAGAAGGAAAATTACTGG + Intronic
1046323803 8:112614095-112614117 GAGAACTGAAGGAAGCAAATGGG + Intronic
1047759112 8:127940962-127940984 CAGAATGGAAGGCAGCCTACAGG - Intergenic
1048482756 8:134815637-134815659 GAGAATTGAATGAAGCCTAGAGG - Intergenic
1049516820 8:143063805-143063827 TGGAACAGAAGGGAGGCTACTGG - Intergenic
1049563635 8:143325920-143325942 CAGAACAGCAAGAAGCCGACTGG + Intronic
1051343405 9:16131234-16131256 GAGACCAGAAAGAAGCCTCAGGG + Intergenic
1051521879 9:17998526-17998548 AAGAAGAGAAGGAAGTCTATAGG + Intergenic
1053675924 9:40427608-40427630 GAGAACAGATGAAATCCTAGGGG - Intergenic
1053925705 9:43053722-43053744 GAGAACAGATGAAATCCTAGGGG - Intergenic
1054287792 9:63197285-63197307 GAGAACAGATGAAATCCTAGGGG + Intergenic
1054288998 9:63263118-63263140 GAGAACAGATGAAATCCTAGGGG - Intergenic
1054387029 9:64567674-64567696 GAGAACAGATGAAATCCTAGGGG - Intergenic
1054508698 9:65948684-65948706 GAGAACAGATGAAATCCTAGGGG + Intergenic
1055561256 9:77523750-77523772 GAGAAAAAAAGAAGGCCTACAGG - Intronic
1057451706 9:95168375-95168397 GAGAACAAAAGAAAGCTTAGTGG - Intronic
1059195550 9:112367959-112367981 AAAAACTGAAGAAAGCCTACAGG - Intergenic
1059758550 9:117316911-117316933 GAGACCAGAAGGAAACACACTGG + Intronic
1060107305 9:120881120-120881142 GAGATCAGAAGGAAGCACATCGG + Intronic
1062649591 9:137568730-137568752 GGGAACAGAAAGAAGCCTGCAGG + Intronic
1185924234 X:4128657-4128679 GGGAACAGAAGGAAGACAAATGG - Intergenic
1186205644 X:7197138-7197160 AAGAGAGGAAGGAAGCCTACTGG - Intergenic
1186579109 X:10798134-10798156 GAGAACATGAGAAACCCTACAGG - Intronic
1187096071 X:16150063-16150085 GAGAAGAGAAGGCATCCTTCAGG + Intronic
1188021411 X:25162885-25162907 AAAAAAAGAAGGAAGGCTACTGG - Intergenic
1189638751 X:43043962-43043984 GAGAACACATGGATGCCTAGAGG - Intergenic
1189687652 X:43582310-43582332 GGGAACAGAAGAAAGCCTTTTGG + Intergenic
1190919165 X:54834499-54834521 GAGAACATATGGAAGCATAGAGG - Intergenic
1191703078 X:64064154-64064176 GAGAACAGAAGGGAACCCCCAGG + Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1192421805 X:71039140-71039162 AAGAACAGAAGGAAGCCCAAAGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193339792 X:80334830-80334852 GAGAACAGAGGCAAGGCAACAGG - Intergenic
1194041109 X:88943045-88943067 GAGAGTAGAAGGATGGCTACAGG + Intergenic
1194296229 X:92129699-92129721 GAGAAGGGAGGGATGCCTACAGG - Intronic
1194639018 X:96380172-96380194 GAAAAAAAAAGGAAGCCAACTGG + Intergenic
1195626533 X:107009772-107009794 GAAAACAGAAGCAAGCCTGGGGG + Intergenic
1195655352 X:107327079-107327101 GAAAACAGAAGCAAGCCTGGGGG + Intergenic
1195754191 X:108184827-108184849 GTGAACAGAAGGAAGCTTGCAGG - Intronic
1195922415 X:109996722-109996744 GGGAAAAGAAGGAAGCCTCCTGG - Intergenic
1196179978 X:112679161-112679183 GAAAATAGAATGAAGCCTAGGGG - Intronic
1197905734 X:131423605-131423627 GAGAAAACAAGGAAGACTTCAGG + Intergenic
1198392269 X:136188416-136188438 GAGAACACAAGGAAGGGAACAGG - Intronic
1200613737 Y:5354306-5354328 GAGAAGGGAGGGATGCCTACAGG - Intronic
1201964774 Y:19719977-19719999 GAAAACAGAAGGACTCCTTCAGG + Intronic