ID: 1127952371

View in Genome Browser
Species Human (GRCh38)
Location 15:63821862-63821884
Sequence CTCCATGAAAGCAGGAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 1, 2: 5, 3: 40, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127952371_1127952375 17 Left 1127952371 15:63821862-63821884 CCAAGGTTCCTGCTTTCATGGAG 0: 1
1: 1
2: 5
3: 40
4: 270
Right 1127952375 15:63821902-63821924 AAGACAAATAATAACCAGGTAGG 0: 1
1: 0
2: 2
3: 55
4: 631
1127952371_1127952373 -6 Left 1127952371 15:63821862-63821884 CCAAGGTTCCTGCTTTCATGGAG 0: 1
1: 1
2: 5
3: 40
4: 270
Right 1127952373 15:63821879-63821901 ATGGAGTTTACATTCTAGTAAGG 0: 1
1: 35
2: 164
3: 684
4: 1672
1127952371_1127952374 13 Left 1127952371 15:63821862-63821884 CCAAGGTTCCTGCTTTCATGGAG 0: 1
1: 1
2: 5
3: 40
4: 270
Right 1127952374 15:63821898-63821920 AAGGAAGACAAATAATAACCAGG 0: 1
1: 0
2: 3
3: 44
4: 593

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127952371 Original CRISPR CTCCATGAAAGCAGGAACCT TGG (reversed) Intronic
900518887 1:3096168-3096190 CCCCATGTGGGCAGGAACCTCGG + Intronic
901463465 1:9405522-9405544 CAGCATGAAAGCAGGAATCTGGG - Intergenic
904210807 1:28885843-28885865 CTCCTTGAAGGCAGGAACCAGGG + Intergenic
908570277 1:65402520-65402542 CTCCTTGAAAACAGGCTCCTTGG - Intronic
908748590 1:67398625-67398647 CAACTTGAAAGCAGGAACTTTGG + Intergenic
909034755 1:70584215-70584237 CTCCATGAGAGCAGCGACCTTGG - Intergenic
909072457 1:71013135-71013157 CTCCATGATAGCAGGAATTTGGG + Intronic
909346538 1:74594548-74594570 CTACAAGAAAACAGAAACCTTGG + Intronic
909635286 1:77810996-77811018 CTCCATGAAAGCAAAACACTTGG + Intronic
911301504 1:96179903-96179925 CTTCTTGAAAGCAGGAAATTGGG - Intergenic
912513465 1:110203593-110203615 CTCCCAGGAAGCAGGAAGCTGGG - Intergenic
913220039 1:116652546-116652568 CACCTTGGTAGCAGGAACCTGGG + Intronic
915504415 1:156344485-156344507 GTCCATGAAAGCAGGTGCCCAGG - Intronic
915960732 1:160264313-160264335 TTCCATGAATGCAAGAATCTTGG - Intergenic
916770447 1:167902632-167902654 CTTCATAAAAGCAGGAACTATGG - Intronic
918628311 1:186684086-186684108 CTCCATGAAAACCAGTACCTGGG + Intergenic
919396298 1:197053176-197053198 CTCCATGGGAGCAGGAGTCTTGG - Intronic
919920023 1:202162016-202162038 CTGGAGGGAAGCAGGAACCTGGG + Intergenic
920370316 1:205474731-205474753 CTCCATGAGGGCAGGAACTTTGG + Intergenic
922121146 1:222670171-222670193 CTCCATGAAAGCAAAACACTTGG + Exonic
923633449 1:235671237-235671259 CTCCATAAAAACAGGTACTTTGG - Intronic
924584408 1:245349072-245349094 CTCCGTGAGAGCAGGGACCTTGG + Intronic
1065238126 10:23675809-23675831 CTCCAAGAATGCAGGCAACTAGG - Intergenic
1065654546 10:27934340-27934362 CTCCAACAAAGGAGGAACCTGGG - Intronic
1067433983 10:46264537-46264559 CTGCAGGAAAGCAGGAAGCAGGG - Intergenic
1068733165 10:60382535-60382557 GTCCATGAAAGCAGAATCCTGGG + Intronic
1068753852 10:60627974-60627996 CTGCTTGAAAGCATGAACTTTGG - Intronic
1069717533 10:70530560-70530582 GTCCTTGAAAGCAGGCACTTGGG - Intronic
1070247591 10:74746856-74746878 CTCCATGAAGGCAAAGACCTCGG - Intergenic
1071428179 10:85580593-85580615 CTTCCTGAAAGCAGGAACTCTGG + Intergenic
1071457227 10:85860255-85860277 CCCCATGCAAGCAGGAGCCCAGG + Intronic
1071758966 10:88578851-88578873 CTCCATGAAGGCAAGGACATTGG + Intronic
1073542093 10:104322873-104322895 CTCCAAGAAAGAAGGAGCCAAGG + Intronic
1075080638 10:119381357-119381379 CTCCCTGAGGGCAGGACCCTGGG + Intronic
1076039487 10:127231955-127231977 CTCCATGTGTGCAGGGACCTTGG - Intronic
1076981721 11:208371-208393 CTCCACAAAGGCAGGGACCTGGG + Intronic
1077377710 11:2213036-2213058 CTCCATGCTAGCAGGAGCCAGGG - Intergenic
1077791825 11:5449416-5449438 CTCCATGAAAGCATTAGACTGGG + Intronic
1078637188 11:13063010-13063032 CTGCATGAAGGCAGGAAGTTTGG + Intergenic
1078849778 11:15153138-15153160 TTCCATGAGGGCAGGAAACTAGG - Intronic
1078936507 11:15956008-15956030 CTCCAGGACAGCAAGCACCTTGG + Intergenic
1079546119 11:21633773-21633795 CTCCATGAAGGCAGGGTCGTTGG + Intergenic
1080180967 11:29425822-29425844 ATCCATGAAAGCAGTGACTTAGG - Intergenic
1080202724 11:29692199-29692221 CTCCATGGTATCAGGAAGCTAGG + Intergenic
1080497448 11:32833761-32833783 CTCCATTAAAGCAGGGATGTTGG - Intronic
1080898498 11:36465969-36465991 CTCCATGAGAGCAGGCACCTTGG - Intergenic
1080932415 11:36825834-36825856 CTTCATCAAAGGAGGAATCTTGG - Intergenic
1081495227 11:43602503-43602525 CTCCATGAGAGCAGGAATTTGGG + Intronic
1081608177 11:44540634-44540656 CTCCATGACAGCAGGGGCCGGGG + Intergenic
1082092341 11:48100210-48100232 CTGCATGAAAGGAGGAACTTGGG - Intronic
1084858388 11:72003134-72003156 CACCAGGACAGCAGGAACCAGGG + Exonic
1085479285 11:76808096-76808118 CTCCATGACAGCAGGGACCAAGG - Intergenic
1087291638 11:96326920-96326942 CTCTATGAGACCAAGAACCTGGG - Intronic
1088585006 11:111354174-111354196 CTCCAAACAAGCATGAACCTGGG + Exonic
1088756232 11:112887480-112887502 CTCCATCACAGCAAGGACCTGGG - Intergenic
1089025473 11:115265285-115265307 CTCTAAGAGAGAAGGAACCTGGG + Intronic
1090531482 11:127595468-127595490 CTCCATGAAGGATGGAATCTTGG - Intergenic
1091762093 12:3094282-3094304 CGCAAAGAAAGCAGGAATCTAGG - Intronic
1092810656 12:12268454-12268476 CTTCCTCAAAGCAGGAAACTGGG + Intergenic
1094082723 12:26555191-26555213 CACCATTTAAGCTGGAACCTTGG - Intronic
1094318432 12:29157751-29157773 ATCCTTGAAAGCAAGATCCTTGG + Intronic
1096237949 12:49942584-49942606 CTCTCTGAAGGCAGGAACTTGGG - Intergenic
1097179081 12:57160643-57160665 CTCCGTGGGAGCAGGGACCTTGG + Intronic
1097657096 12:62378992-62379014 CTCCATGAAAGCAGGTACCAGGG - Intronic
1097707942 12:62887593-62887615 CACCATGAGAGCAGGGTCCTTGG - Intronic
1099675530 12:85755906-85755928 GCCCATGAAAGCAGCAACCAAGG + Intergenic
1101646676 12:106636917-106636939 CTAGATGAAAGCAGCAAACTTGG - Intronic
1101792441 12:107939983-107940005 CTCCTAGAAAGCAGGAACTCTGG - Intergenic
1102882519 12:116496887-116496909 CCCCATGAAAGTAGGAACTATGG - Intergenic
1103212059 12:119174498-119174520 CTCCATGAAAGCAGGACCCTTGG - Intergenic
1103368402 12:120399977-120399999 CTCCATGAGGACAGGGACCTTGG + Intergenic
1104293611 12:127491929-127491951 CTCCTGCAAAGCAGGAACTTAGG + Intergenic
1104572479 12:129936930-129936952 CTTTGTAAAAGCAGGAACCTGGG + Intergenic
1105580037 13:21687085-21687107 CTCCATGTAATCAGTAACCAAGG + Intronic
1106187967 13:27425372-27425394 GTCCATGGCAGCAGAAACCTTGG - Intronic
1108373589 13:49793377-49793399 CTCAATGAGAGCAGGTACTTTGG + Intergenic
1110621571 13:77601780-77601802 CTCCAAGAAAGCAAAAGCCTTGG + Intronic
1110749712 13:79098498-79098520 CTCAATGAAGTCAGGAAGCTGGG + Intergenic
1111017099 13:82395282-82395304 CTCCTTGAAAGCAGAACCTTTGG + Intergenic
1112766200 13:102747035-102747057 CTGCATGATAGCTGCAACCTTGG - Exonic
1113269672 13:108659826-108659848 CCCCATAAAGGCAGGAACTTGGG - Intronic
1115501413 14:34053248-34053270 CTCCAGGAAGGCAGGGACTTTGG - Intronic
1115924071 14:38411413-38411435 CCCCATGAAAGCATGGTCCTGGG - Intergenic
1117379382 14:55145200-55145222 CTCAATGAAATCAGCAAACTGGG + Exonic
1117706006 14:58468864-58468886 CTCAATCAAAAGAGGAACCTTGG - Intronic
1119536652 14:75408486-75408508 CTCCTTGAGAGCAGGAGCCTAGG - Intergenic
1120368398 14:83600362-83600384 ATCCATGAATGCAGAAACCATGG + Intergenic
1121397940 14:93643510-93643532 TTCCATGAAAGAAAGAACCATGG - Intronic
1122839788 14:104451623-104451645 CTCCAGGGCAGAAGGAACCTAGG + Intergenic
1124591854 15:31060919-31060941 CTCCAGGAAGGCTGGAACCCTGG + Intronic
1124598494 15:31111576-31111598 CTGCATGAAAACAGGATCTTTGG + Intronic
1124825333 15:33088782-33088804 CTCCATGTAAGTAGAAATCTTGG - Exonic
1125196856 15:37057073-37057095 CTCCATGTAATGAGGAACCCGGG - Intronic
1126009319 15:44287968-44287990 GTTCGTGAAAGCAGTAACCTAGG + Intergenic
1126466043 15:48962639-48962661 CTCCAGGAAAGCCGGGACCCAGG - Exonic
1127952371 15:63821862-63821884 CTCCATGAAAGCAGGAACCTTGG - Intronic
1129054649 15:72810412-72810434 CTCCATGTAACCCTGAACCTAGG - Intergenic
1129516992 15:76162978-76163000 CTCCAGGACAGCAGGAGCCCCGG - Intronic
1129807906 15:78480073-78480095 CTCCATGAGGACAGGAACTTTGG + Intronic
1131002438 15:88949649-88949671 CCCCAGGAATGCAGGAACCAAGG - Intergenic
1131444843 15:92489753-92489775 CTAAATGAAAGCAGAAATCTAGG + Intronic
1132329083 15:100998529-100998551 CTTCCTCAAAGCAGAAACCTTGG + Intronic
1133578684 16:7121187-7121209 CTCCATTAGAGCAGGAACAAGGG + Intronic
1134390235 16:13813169-13813191 CTCCAGGAATGCAGGAACTTGGG + Intergenic
1135972097 16:27079765-27079787 TTCCAGGAAAGCAGAAATCTAGG + Intergenic
1136617697 16:31408668-31408690 ATCCTTGAGAGCAGGAACCCAGG - Intronic
1137444789 16:48525134-48525156 CTCCACGAGGGCAGGAACCTTGG + Intergenic
1137624736 16:49900437-49900459 CTACATGAAAGCAGGAGGCGTGG - Intergenic
1139919681 16:70451413-70451435 CTCCATTAAAGCAGGATGTTTGG - Intergenic
1141207744 16:81946444-81946466 CTCCAGGAAAGGAGGATGCTGGG - Intronic
1141351525 16:83302645-83302667 CTCCTTAAAAGCAGGAACCATGG - Intronic
1141383174 16:83594472-83594494 CTCCACGAAGGCAGGGACCTTGG - Intronic
1142233023 16:88908637-88908659 CTCCATGGAAGGAGGACCCATGG + Intronic
1142665598 17:1461679-1461701 CTCCATGAGAGCAGGGATTTGGG + Intronic
1143371911 17:6445494-6445516 CTTCATGAAAACAGGGACGTTGG + Intronic
1144032583 17:11335699-11335721 CTCCATGTTCGCTGGAACCTCGG - Intronic
1144418278 17:15072050-15072072 CTCCATGAGGGCAGGGACCTGGG + Intergenic
1144659327 17:17058249-17058271 CTCTTTGCAAGCAGGGACCTGGG + Intronic
1144776007 17:17784917-17784939 CCCCATGTAAGCAGCAGCCTGGG - Intronic
1146691525 17:34879546-34879568 CTCCATGCAAGAGGGCACCTGGG + Intergenic
1146936829 17:36817311-36817333 CTCCTTGGAAGCCTGAACCTGGG + Intergenic
1147246178 17:39122512-39122534 CCGCAAGATAGCAGGAACCTAGG + Intronic
1151172923 17:72263139-72263161 CAACAGGAAAGCAGGAGCCTGGG + Intergenic
1152319622 17:79601141-79601163 CTGCTTGAGAGCAGGAGCCTGGG - Intergenic
1152409499 17:80116049-80116071 CTCTGTGAAAACAGGAACATCGG - Intergenic
1152524058 17:80877264-80877286 CTCCCCGCAGGCAGGAACCTGGG - Intronic
1152607397 17:81299625-81299647 CGGCAAGAAAACAGGAACCTTGG - Intergenic
1153080751 18:1221749-1221771 CTCCCTGAGGGCAGGAACCATGG + Intergenic
1155606480 18:27612163-27612185 CTCCATGGAAGCCGGAAGCCAGG + Intergenic
1157382405 18:47231371-47231393 CTCCTTGAAGGGAGGAAGCTTGG + Intronic
1157438425 18:47690855-47690877 ATCCATGAAAGCAAGAAACTGGG + Intergenic
1158239164 18:55357752-55357774 CTCCCTGGAAACAGGAACCAGGG + Intronic
1158338683 18:56441547-56441569 CTTCATGAAAGCAGGGACCTTGG + Intergenic
1160162316 18:76483156-76483178 CTCCAGCAAAGCAGGCAGCTGGG - Intronic
1161335520 19:3710776-3710798 CCCCACGAGAGCAGGAAGCTTGG - Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1164420529 19:28088003-28088025 CTCCATGGACGTAGGACCCTCGG - Intergenic
1164559001 19:29275661-29275683 CACCATGAACTCTGGAACCTTGG + Intergenic
1164805820 19:31115774-31115796 CTGTATCAAACCAGGAACCTTGG + Intergenic
1165823568 19:38692803-38692825 ACCCATGGAAGCAGGAACCATGG + Intronic
1167046761 19:47054280-47054302 CTCCAGAAAAGCAGGAAGCGGGG + Intergenic
1168019213 19:53596351-53596373 CTCCATGAAAGCAGCGCACTGGG + Intergenic
926265079 2:11308784-11308806 CTCCATGAAAGCAAAACACTTGG - Intronic
929892651 2:45931317-45931339 CTCCCTGAAAGCAGGAACTCTGG - Intronic
931863432 2:66381887-66381909 CTCTCTGAAAGCATAAACCTTGG - Intergenic
932348022 2:71008199-71008221 CTCCATGAGGGCAGGGACTTTGG + Intergenic
932528159 2:72495933-72495955 CCCCAGGACAGCAGAAACCTGGG - Intronic
932795072 2:74687452-74687474 CTCCATGAAAGCCTGAACTATGG + Intergenic
934519619 2:95011715-95011737 CTGCATTGAAGAAGGAACCTGGG + Intergenic
935388364 2:102524820-102524842 CGCCCTGAAAGCAGTGACCTGGG + Intronic
936053314 2:109241948-109241970 CACCATGAAAGCAGCACTCTGGG - Intronic
936466273 2:112753986-112754008 CTCTATGAAGGCAGAAACCTTGG + Intronic
936478946 2:112867612-112867634 CTCCATGAGAGCAGGAGGCATGG + Intergenic
937161257 2:119764001-119764023 CTTCAGGCAAGAAGGAACCTTGG - Intronic
937698855 2:124840455-124840477 CTCCATGAAAGCAGAGGCATTGG + Intronic
937865906 2:126751756-126751778 TTCCATGAGAGCAGGCACCGTGG - Intergenic
938939982 2:136161618-136161640 CTCCATGAAAGGAGGGGACTAGG - Intergenic
941023596 2:160436738-160436760 TTCCATGACAGCAGCACCCTCGG - Intronic
943324372 2:186480338-186480360 CTTCATGGGAGCAGGAACCTTGG - Intergenic
944034159 2:195273318-195273340 CTACAAGATAGAAGGAACCTGGG + Intergenic
944690348 2:202153225-202153247 CCCCCTGAAGGCAGGAACCATGG - Intronic
944782158 2:203030284-203030306 CTTAATGAAAGCAGAAACTTAGG + Intronic
946007032 2:216533991-216534013 CTGGATGAAAGCAAGAACCAAGG + Intronic
946747929 2:222863916-222863938 CTCTTTGAAAGCAGTAACTTTGG - Intronic
947018937 2:225653352-225653374 CTCAATGAAAGCAGGTTCTTGGG + Exonic
947331414 2:229033254-229033276 CTCCAGGAAAGCAGGTGCTTGGG - Intronic
1168876761 20:1177234-1177256 CTCCATGAAAGCCGGAATTTTGG - Intronic
1169009066 20:2234888-2234910 CTTCAGAATAGCAGGAACCTAGG - Intergenic
1169897970 20:10524244-10524266 CTCCAGGAAAGGAGGACCCTTGG + Intronic
1171976095 20:31595693-31595715 CTCTAAGAGAGCAGGAACCACGG - Intergenic
1172670494 20:36631717-36631739 CTCCCTGAGAGCAGGGACCATGG + Intronic
1174170604 20:48615963-48615985 CTCCATGAGGGCAGGAGCCATGG - Intergenic
1174719516 20:52797121-52797143 CTCCATGAAGACAGGAACAATGG - Intergenic
1174725087 20:52852837-52852859 CTCCAAAAAGGCAGGAACCATGG + Intergenic
1174874423 20:54211594-54211616 ATCCAAGCAAACAGGAACCTTGG - Intronic
1175166636 20:57048790-57048812 CTCCAGGCAAGGAGGCACCTTGG - Intergenic
1176169715 20:63691304-63691326 CCCCAAGGAAGAAGGAACCTGGG - Intronic
1176359932 21:5986698-5986720 CTCCATGAAGGCAAGGACTTGGG - Intergenic
1177666711 21:24169150-24169172 CTCCATGAGGCCAGGAACTTAGG - Intergenic
1178622844 21:34191754-34191776 CTCCATGAAAACAAGCTCCTAGG - Intergenic
1179763586 21:43551852-43551874 CTCCATGAAGGCAAGGACTTGGG + Intronic
1180064916 21:45407448-45407470 TTCCCTGTAATCAGGAACCTGGG + Intronic
1181779344 22:25181528-25181550 GAGCATGAAAGCAGGCACCTTGG + Intronic
1183373573 22:37449368-37449390 CTCCCTGAAAGCAGGGCCCTTGG + Intergenic
1184449982 22:44577030-44577052 GTCCATGGAAGCAGGATCCCAGG - Intergenic
1184950387 22:47837760-47837782 TTTCATGAAAGCAGGGACCTGGG + Intergenic
949164122 3:917037-917059 CTCCATGAGGACAGGAGCCTTGG - Intergenic
950487251 3:13281120-13281142 TCCCATGAAAGCAGGGACTTGGG + Intergenic
950710468 3:14810178-14810200 CTCCATGAGGGCAAGAATCTGGG + Intergenic
951465253 3:22993859-22993881 GTCCATGAAAGCATTAACTTAGG - Intergenic
951711895 3:25591877-25591899 CTCCAAGAAGGCAGTGACCTAGG - Intronic
953278878 3:41532506-41532528 CTCCATGAAGGCAGGGATTTTGG + Intronic
954595465 3:51820316-51820338 CTCCAGGAGAGCAGGATTCTGGG + Intronic
955616054 3:60807746-60807768 CTCCACGAAAGCAGAAACCATGG - Intronic
955751738 3:62190362-62190384 CTCCATGAAGGCAGGCAGCACGG + Intronic
955819897 3:62885699-62885721 CTCCTTGGAAGCAGAAAACTTGG - Intergenic
955881905 3:63555773-63555795 CTCCATGATAGTGGGAATCTTGG - Intronic
956990291 3:74754862-74754884 CTCCATGAGGGCAGGGACCAAGG + Intergenic
958144098 3:89601701-89601723 CTCCATGAAAGCAGAAAGTCGGG + Intergenic
960351142 3:116594627-116594649 CTCCAAGGAAGCAGGAAGCCAGG - Intronic
960513814 3:118580932-118580954 CTCCAAGAAAGCCGGAGCCCTGG + Intergenic
960545092 3:118905106-118905128 CTACATGAATGCTGGAAACTAGG + Intronic
960600502 3:119453348-119453370 ACCCAGGAGAGCAGGAACCTTGG - Intronic
962917034 3:139913532-139913554 ATCCATGAAGGCAGGACCCATGG + Intergenic
963063408 3:141242859-141242881 CTCCATGAGGGCAGGAATTTGGG + Intronic
964348543 3:155779890-155779912 CTCCTTGAGAGCAGGAACATTGG - Intronic
964414144 3:156430040-156430062 ATCCATAAAAGTAGGAAACTAGG - Intronic
964724676 3:159802318-159802340 CTCCAGGAGATCAGGAGCCTTGG - Intronic
965502195 3:169470534-169470556 TGCCATGAAAGCAGGAATCATGG + Intronic
967550371 3:190787274-190787296 CTACTTGAAAGCAGGAGTCTGGG - Intergenic
967949595 3:194830566-194830588 ATCCAGGAATGCAGGAGCCTTGG - Intergenic
967972637 3:195010821-195010843 CTCCCTCAAAGAAGGAACCGAGG + Intergenic
969180116 4:5433935-5433957 TTCCAGAAAAGCAGGAACATGGG - Intronic
970445034 4:16116284-16116306 CTCCATGGCAGCAGGAACTTGGG + Intergenic
972564047 4:40254215-40254237 CTCTATGAAAGCGGGAACTTTGG - Intergenic
972671301 4:41215668-41215690 TTCCATGAAAGCAGGGGCCTGGG - Intronic
978777605 4:112518510-112518532 CTGAATGATAGGAGGAACCTTGG + Intergenic
979962551 4:127037549-127037571 CTCCAGGTGAGAAGGAACCTGGG + Intergenic
981016675 4:139980741-139980763 CTCCTTGAGAGGAAGAACCTTGG - Intronic
982490757 4:156026349-156026371 CACCATGAAAGCAGGAGCAGAGG - Intergenic
982664969 4:158250794-158250816 GTTCATAAAAGCAGGACCCTGGG - Intronic
982667113 4:158278519-158278541 CTCCATGAAAGCAAAACACTTGG - Intergenic
983095471 4:163556180-163556202 CTTCATCAAAGCAGAAATCTTGG - Intronic
983112182 4:163765695-163765717 CACCATGAAAGTAGTAAACTTGG - Intronic
984575721 4:181446076-181446098 CTCCATGAGGGCAGGAATCATGG - Intergenic
984640397 4:182158569-182158591 CTGCTTTAAAGCAGAAACCTAGG + Intronic
985220698 4:187701030-187701052 CTCCTTAAAAGCAGGAACTGAGG + Intergenic
986215733 5:5717165-5717187 CTGCAGGAACACAGGAACCTGGG - Intergenic
989344601 5:40415874-40415896 CTTCTTGAAAGCTGGAACCAGGG + Intergenic
990308100 5:54512698-54512720 CTCCATGAAGGCAGGAGGTTTGG - Intergenic
990316851 5:54590838-54590860 CTCCATGAGGGCAGGAAGCATGG + Intergenic
991640562 5:68747604-68747626 CTCCATGAAAGCAAAGTCCTTGG - Intergenic
992340249 5:75815635-75815657 CTCCAAGAAGGCATGAACCATGG + Intergenic
992879786 5:81096432-81096454 CTCCCTGAGAGCAAGAACCATGG - Intronic
995574278 5:113513413-113513435 CTCCATGAAGGTAGGAACCTTGG + Intergenic
996151201 5:120036931-120036953 ATCCATGAGAGCAGGGGCCTTGG + Intergenic
996516769 5:124378603-124378625 CTTCTGGAAAGCAGGACCCTGGG - Intergenic
997616737 5:135251732-135251754 CTCCAGGAGGGCAGGAACCATGG - Intronic
998833868 5:146185768-146185790 CTCCATGAAGGAAGGGACCATGG - Intergenic
999142967 5:149374830-149374852 CTGCACGAAAGAAGGAAGCTGGG - Intronic
999973086 5:156884310-156884332 CTCTATGAAAACAGTCACCTTGG - Intergenic
1001804240 5:174569908-174569930 CTCCTTGAGGGCAGGAACTTTGG - Intergenic
1002327322 5:178418397-178418419 CTCCAGGAAAGCTGGAACGTAGG - Intronic
1003972737 6:11314560-11314582 AGCCAGGAAATCAGGAACCTAGG - Intronic
1004181599 6:13385285-13385307 CTCCATGGGGGCAGGTACCTGGG - Intronic
1004453509 6:15769780-15769802 CTCCATGAAAGAAGGAAGGGAGG - Intergenic
1005592689 6:27345059-27345081 GTCCATAATAGCAGGAACATAGG - Intergenic
1005652026 6:27893504-27893526 CTCCAAGAAAGCCGTAACCAAGG + Exonic
1007341140 6:41192225-41192247 CTCCTTGGGGGCAGGAACCTGGG - Exonic
1008053986 6:46927762-46927784 CTCTATGAAAGCTGGTACCTAGG - Intronic
1008524660 6:52396167-52396189 CTCCATGAATGAAGAAAACTGGG + Intronic
1009353076 6:62707137-62707159 CACCATGAAGGCAAGAACATAGG - Intergenic
1009523451 6:64713873-64713895 CTCCATGAAACGAATAACCTTGG + Intronic
1012551476 6:100467697-100467719 CTCCATGAGGGCAGCATCCTGGG - Intergenic
1013229269 6:108147020-108147042 ATAAATGAAAGCAGGAACCGTGG + Intronic
1013440562 6:110161793-110161815 CTACATGAAAGGAAGAACCAAGG + Intronic
1013573606 6:111455327-111455349 CTTAATGAAAGCAGGTACCTTGG - Intronic
1014260399 6:119209923-119209945 CTGTTTGAAAGCAGGAAGCTGGG - Intronic
1016811432 6:148264914-148264936 CTTCATGAAAGTAGGGGCCTTGG + Intergenic
1018291756 6:162298692-162298714 CTTGATGAAAGCAGCAATCTTGG + Intronic
1018467509 6:164063648-164063670 GAAAATGAAAGCAGGAACCTGGG - Intergenic
1019147953 6:169986851-169986873 GTCCATGAAAGCATGGCCCTGGG - Intergenic
1019717767 7:2548163-2548185 CTCCATGCAAGCAGGTACAATGG + Intronic
1019919818 7:4156410-4156432 CTCCATTAAAGCTGGGACCAAGG + Intronic
1021194802 7:17663206-17663228 CTCCATGGGAACAGGAACCTGGG - Intergenic
1021534189 7:21684399-21684421 CTCTGTGACAGCAGGAACCCTGG - Intronic
1021972176 7:25976210-25976232 CTCCATGAGAATAGGAACTTTGG - Intergenic
1022021552 7:26404521-26404543 CCCCTTGAAAGCAGGAGCTTTGG + Intergenic
1023789977 7:43746251-43746273 CTTCATGAAAGCAGGAAGGAAGG + Intergenic
1024341562 7:48268700-48268722 CTCCCTTAAAGCAGCAAGCTGGG + Intronic
1026398674 7:69986205-69986227 TTCCATGAGAGCAGGACCTTAGG + Intronic
1027425772 7:78060471-78060493 CTCCTTGAAGCCAGGAACCTAGG - Intronic
1028297725 7:89156117-89156139 CTCCATGAAAGAAGGAAAGAAGG - Intronic
1029151088 7:98480964-98480986 CTCCTGGAAGGCAGGAGCCTGGG + Intergenic
1030079753 7:105767246-105767268 CCCCAGGAAAGCTGGAATCTTGG - Intronic
1030130891 7:106198717-106198739 CTCTATGCAAGCAGTAACATTGG - Intergenic
1032365893 7:131299364-131299386 CTACATGAAAAAAGGAATCTGGG + Intronic
1033395351 7:140968457-140968479 CTCCATGAGAGCAGGGGTCTTGG + Intergenic
1033968368 7:147006815-147006837 CTCCAAGAAGACAGGAACCAAGG - Intronic
1034634918 7:152559622-152559644 CTTCTTGAGATCAGGAACCTTGG - Intergenic
1038848259 8:31249805-31249827 CTCCCTGAAAGCAGGAATGGTGG - Intergenic
1040757862 8:50802616-50802638 TTTTATGAAAGCAAGAACCTAGG - Intergenic
1041338285 8:56812350-56812372 CTCCATGCATGTAGGACCCTCGG + Intergenic
1041786584 8:61640679-61640701 ATCCATGAGAACAGGAACCATGG + Intronic
1043141280 8:76593282-76593304 ATCCATGAAATCAGTAACTTTGG + Intergenic
1045836482 8:106527288-106527310 CTCCATGAGAGCAGGTACCATGG - Intronic
1047998871 8:130360115-130360137 CTTCATGAGAGCAGGGGCCTTGG - Intronic
1048809230 8:138270143-138270165 CTCCAGGAAAGTAGCAACCTTGG - Intronic
1048962970 8:139595301-139595323 ATCCAAGAATGCAGGGACCTGGG + Intergenic
1049366030 8:142237297-142237319 CTCCATGAGGGCAGGAGTCTTGG + Intronic
1050208828 9:3230264-3230286 CTCCTTCAAAGCAGTCACCTAGG - Intronic
1051362221 9:16291356-16291378 CACCATGAAGGCAGGGACTTTGG - Intergenic
1051364698 9:16313288-16313310 GTCCATGAAACCTGGAACCTGGG + Intergenic
1051382883 9:16476625-16476647 CTCCAAGAAAGCAGGGACCACGG + Intronic
1051740300 9:20245150-20245172 CTCCTTGAGGGCAGGAACCATGG - Intergenic
1052997356 9:34558217-34558239 CTCAATGGAGGCAGGAACCGTGG + Intronic
1055405958 9:75973976-75973998 CAGCATGAAAGAAGGAAGCTTGG + Intronic
1056224752 9:84483869-84483891 TGCCATGACAGCAGGAACCCCGG - Intergenic
1056327062 9:85488931-85488953 CTCCATGAAGGCAGGAAGCTGGG + Intergenic
1057073163 9:92117973-92117995 CTCCAGGAGAGCAGGAAACGTGG - Intergenic
1058264927 9:102887446-102887468 TTCCATGAAAGCAAGCACATAGG - Intergenic
1059256486 9:112935770-112935792 TTCCAGGGAAGCAGGAGCCTTGG + Intergenic
1059551014 9:115228891-115228913 CTCCATTAGAGCAGAGACCTTGG + Intronic
1059648351 9:116289765-116289787 CTCCTTGAGAGCAGAAACATAGG - Intronic
1061695866 9:132372978-132373000 CTCCAAGAAAGCAGGCCCCAAGG + Intergenic
1186154117 X:6707994-6708016 CTCCTTTAAAGCAAGAAACTTGG + Intergenic
1186371917 X:8955491-8955513 CTCCAAGAAGGCAGGGACTTTGG - Intergenic
1187155028 X:16713996-16714018 TTCTATGCAAGCAGGAAACTTGG - Intergenic
1187157286 X:16732856-16732878 CCCCATGAGTGCAGGGACCTGGG - Intronic
1187257462 X:17655820-17655842 CTCCATCAAAGCAGGGGCATCGG - Intronic
1190699748 X:52978913-52978935 TTCCATGAAAGTTAGAACCTAGG + Intronic
1191695544 X:63986014-63986036 CCACATGAAGGCAGGAACCCTGG + Intergenic
1192146796 X:68687931-68687953 CTCCAGGAAGGCAGGTACCCAGG + Intronic
1192626828 X:72737542-72737564 CTCCTTGAGGGCAGGAACCATGG + Intergenic
1193806502 X:86002182-86002204 CTCTCTGAAAGCTGGAACCTGGG + Intronic
1195057932 X:101164631-101164653 CTCCATAAAAACAGGTACTTTGG - Intergenic
1199998242 X:153040618-153040640 CTCTGTGACAGCAGGAACCCTGG - Intergenic