ID: 1127952502

View in Genome Browser
Species Human (GRCh38)
Location 15:63823145-63823167
Sequence GAGAGTGGAAAATGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3728
Summary {0: 1, 1: 8, 2: 99, 3: 785, 4: 2835}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127952502 Original CRISPR GAGAGTGGAAAATGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr