ID: 1127957095

View in Genome Browser
Species Human (GRCh38)
Location 15:63863048-63863070
Sequence CCAGCTCCTTGCCAAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127957095_1127957100 20 Left 1127957095 15:63863048-63863070 CCAGCATCTTGGCAAGGAGCTGG No data
Right 1127957100 15:63863091-63863113 GAGCTCAACACCACTCCCCTTGG No data
1127957095_1127957101 21 Left 1127957095 15:63863048-63863070 CCAGCATCTTGGCAAGGAGCTGG No data
Right 1127957101 15:63863092-63863114 AGCTCAACACCACTCCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127957095 Original CRISPR CCAGCTCCTTGCCAAGATGC TGG (reversed) Intergenic
No off target data available for this crispr