ID: 1127959796

View in Genome Browser
Species Human (GRCh38)
Location 15:63882314-63882336
Sequence TACTGGGTAAGGAGAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127959791_1127959796 -7 Left 1127959791 15:63882298-63882320 CCTCTTTCAGGGGCAATACTGGG No data
Right 1127959796 15:63882314-63882336 TACTGGGTAAGGAGAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127959796 Original CRISPR TACTGGGTAAGGAGAAAGGA GGG Intergenic
No off target data available for this crispr