ID: 1127960210

View in Genome Browser
Species Human (GRCh38)
Location 15:63885044-63885066
Sequence TTCTGGAGGCCTAGGGGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127960210_1127960220 14 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960220 15:63885081-63885103 CAGAGAATTCCCACCAGGACCGG No data
1127960210_1127960225 22 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960225 15:63885089-63885111 TCCCACCAGGACCGGGGGGTTGG No data
1127960210_1127960228 26 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960228 15:63885093-63885115 ACCAGGACCGGGGGGTTGGCAGG No data
1127960210_1127960230 27 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960230 15:63885094-63885116 CCAGGACCGGGGGGTTGGCAGGG No data
1127960210_1127960222 16 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG No data
1127960210_1127960223 17 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960223 15:63885084-63885106 AGAATTCCCACCAGGACCGGGGG No data
1127960210_1127960221 15 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960221 15:63885082-63885104 AGAGAATTCCCACCAGGACCGGG No data
1127960210_1127960219 9 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960219 15:63885076-63885098 GCATGCAGAGAATTCCCACCAGG No data
1127960210_1127960224 18 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960224 15:63885085-63885107 GAATTCCCACCAGGACCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127960210 Original CRISPR TTCTGGAGGCCTAGGGGCTC TGG (reversed) Intergenic