ID: 1127960217

View in Genome Browser
Species Human (GRCh38)
Location 15:63885061-63885083
Sequence CTGCATGCCGGACTGCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127960217_1127960220 -3 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960220 15:63885081-63885103 CAGAGAATTCCCACCAGGACCGG No data
1127960217_1127960224 1 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960224 15:63885085-63885107 GAATTCCCACCAGGACCGGGGGG No data
1127960217_1127960230 10 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960230 15:63885094-63885116 CCAGGACCGGGGGGTTGGCAGGG No data
1127960217_1127960223 0 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960223 15:63885084-63885106 AGAATTCCCACCAGGACCGGGGG No data
1127960217_1127960228 9 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960228 15:63885093-63885115 ACCAGGACCGGGGGGTTGGCAGG No data
1127960217_1127960222 -1 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG No data
1127960217_1127960221 -2 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960221 15:63885082-63885104 AGAGAATTCCCACCAGGACCGGG No data
1127960217_1127960225 5 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960225 15:63885089-63885111 TCCCACCAGGACCGGGGGGTTGG No data
1127960217_1127960219 -8 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960219 15:63885076-63885098 GCATGCAGAGAATTCCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127960217 Original CRISPR CTGCATGCCGGACTGCCTTC TGG (reversed) Intergenic