ID: 1127960222

View in Genome Browser
Species Human (GRCh38)
Location 15:63885083-63885105
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127960214_1127960222 8 Left 1127960214 15:63885052-63885074 CCTAGGCCTCCAGAAGGCAGTCC No data
Right 1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG No data
1127960210_1127960222 16 Left 1127960210 15:63885044-63885066 CCAGAGCCCCTAGGCCTCCAGAA No data
Right 1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG No data
1127960217_1127960222 -1 Left 1127960217 15:63885061-63885083 CCAGAAGGCAGTCCGGCATGCAG No data
Right 1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG No data
1127960213_1127960222 9 Left 1127960213 15:63885051-63885073 CCCTAGGCCTCCAGAAGGCAGTC No data
Right 1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG No data
1127960216_1127960222 2 Left 1127960216 15:63885058-63885080 CCTCCAGAAGGCAGTCCGGCATG No data
Right 1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG No data
1127960212_1127960222 10 Left 1127960212 15:63885050-63885072 CCCCTAGGCCTCCAGAAGGCAGT No data
Right 1127960222 15:63885083-63885105 GAGAATTCCCACCAGGACCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127960222 Original CRISPR GAGAATTCCCACCAGGACCG GGG Intergenic
No off target data available for this crispr