ID: 1127960251

View in Genome Browser
Species Human (GRCh38)
Location 15:63885233-63885255
Sequence ATCAGGACCAGGATTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127960240_1127960251 29 Left 1127960240 15:63885181-63885203 CCAGCATTTGCTGTGAGTCCTCA No data
Right 1127960251 15:63885233-63885255 ATCAGGACCAGGATTGTGGGAGG No data
1127960239_1127960251 30 Left 1127960239 15:63885180-63885202 CCCAGCATTTGCTGTGAGTCCTC No data
Right 1127960251 15:63885233-63885255 ATCAGGACCAGGATTGTGGGAGG No data
1127960242_1127960251 11 Left 1127960242 15:63885199-63885221 CCTCAGAAGCGGATGCGCCTCCA No data
Right 1127960251 15:63885233-63885255 ATCAGGACCAGGATTGTGGGAGG No data
1127960243_1127960251 -6 Left 1127960243 15:63885216-63885238 CCTCCAGTTTCCCAGTCATCAGG No data
Right 1127960251 15:63885233-63885255 ATCAGGACCAGGATTGTGGGAGG No data
1127960245_1127960251 -9 Left 1127960245 15:63885219-63885241 CCAGTTTCCCAGTCATCAGGACC No data
Right 1127960251 15:63885233-63885255 ATCAGGACCAGGATTGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127960251 Original CRISPR ATCAGGACCAGGATTGTGGG AGG Intergenic