ID: 1127960326

View in Genome Browser
Species Human (GRCh38)
Location 15:63885693-63885715
Sequence CACTCAGAACAGGTTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127960322_1127960326 -9 Left 1127960322 15:63885679-63885701 CCTGACTACATTCCCACTCAGAA No data
Right 1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG No data
1127960318_1127960326 10 Left 1127960318 15:63885660-63885682 CCTGCTGTGCCCTCCTCTTCCTG No data
Right 1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG No data
1127960319_1127960326 1 Left 1127960319 15:63885669-63885691 CCCTCCTCTTCCTGACTACATTC No data
Right 1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG No data
1127960321_1127960326 -3 Left 1127960321 15:63885673-63885695 CCTCTTCCTGACTACATTCCCAC No data
Right 1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG No data
1127960320_1127960326 0 Left 1127960320 15:63885670-63885692 CCTCCTCTTCCTGACTACATTCC No data
Right 1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG No data
1127960317_1127960326 21 Left 1127960317 15:63885649-63885671 CCTGCATGGCTCCTGCTGTGCCC No data
Right 1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG No data
1127960316_1127960326 22 Left 1127960316 15:63885648-63885670 CCCTGCATGGCTCCTGCTGTGCC No data
Right 1127960326 15:63885693-63885715 CACTCAGAACAGGTTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127960326 Original CRISPR CACTCAGAACAGGTTGCCCC AGG Intergenic
No off target data available for this crispr