ID: 1127965197

View in Genome Browser
Species Human (GRCh38)
Location 15:63918011-63918033
Sequence CAGTGTTTGTTCAACGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 80}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127965189_1127965197 1 Left 1127965189 15:63917987-63918009 CCTCCCCCTGAGCCAGAGCACAA 0: 1
1: 0
2: 5
3: 26
4: 214
Right 1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1127965190_1127965197 -2 Left 1127965190 15:63917990-63918012 CCCCCTGAGCCAGAGCACAATCA 0: 1
1: 0
2: 2
3: 29
4: 200
Right 1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1127965193_1127965197 -5 Left 1127965193 15:63917993-63918015 CCTGAGCCAGAGCACAATCAGTG 0: 1
1: 0
2: 1
3: 14
4: 210
Right 1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1127965191_1127965197 -3 Left 1127965191 15:63917991-63918013 CCCCTGAGCCAGAGCACAATCAG 0: 1
1: 0
2: 2
3: 14
4: 186
Right 1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1127965188_1127965197 13 Left 1127965188 15:63917975-63917997 CCTTGTCTGTCACCTCCCCCTGA 0: 1
1: 0
2: 1
3: 27
4: 351
Right 1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 80
1127965192_1127965197 -4 Left 1127965192 15:63917992-63918014 CCCTGAGCCAGAGCACAATCAGT 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127965197 Original CRISPR CAGTGTTTGTTCAACGGGAC TGG Intronic
900583999 1:3423700-3423722 CAGGGTTTGTTCACCCGGAGTGG - Intronic
902777872 1:18686120-18686142 CAGTGTTTCCTCCACTGGACTGG + Intronic
907835903 1:58107994-58108016 CACAGTTTGTTCAGGGGGACTGG + Intronic
911719565 1:101176469-101176491 CAGTGTTTGTTTCTCAGGACAGG + Intergenic
915361088 1:155286789-155286811 CAGTGTTTATTCAAGGGGGTGGG + Intronic
922514668 1:226198177-226198199 CAGTGTTTGTTGAACCGGCTGGG + Intergenic
1067294010 10:44964211-44964233 CACTGCTTGTTCACTGGGACAGG + Intronic
1068694991 10:59958260-59958282 CAGTGTATTTTCAAGGGGAGAGG + Exonic
1069418048 10:68219357-68219379 TAGAATTTGTTCAACTGGACTGG - Intergenic
1072502598 10:96033136-96033158 CAGTGGTTCTTCAATGGGAGAGG - Intergenic
1073619595 10:105032941-105032963 CAGTTTTTGTTCAAAGGGTATGG + Intronic
1074360347 10:112820535-112820557 CAGTCTTTGTTAAACAGGGCAGG + Intergenic
1074827343 10:117223943-117223965 CAGTGTTAGTTCCACGAGGCAGG + Intergenic
1077026970 11:444497-444519 CAGTGTTTCTGCAACGCAACTGG - Intergenic
1083083247 11:60115023-60115045 CAGTGTTTCTTAAACTAGACAGG - Intergenic
1095750782 12:45708280-45708302 CAGTGTTTGTTGAACTGAACTGG + Intergenic
1096949003 12:55444695-55444717 TAGTGTGTGTTCAAAGGGAGAGG + Intergenic
1098024860 12:66190724-66190746 CAGTGTTTTTTTAACAGGTCAGG + Intronic
1104243624 12:127015918-127015940 CAGTGTTTGCTCAAAGGAACAGG + Intergenic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108671408 13:52692978-52693000 CAGCATTTGTACAACGGAACTGG - Intronic
1116259308 14:42602461-42602483 CAGTGTTTATTTAAATGGACAGG - Intergenic
1116260289 14:42615809-42615831 CAGGGTTAATTCAACAGGACTGG + Intergenic
1116837123 14:49780007-49780029 CAGTGTTTGTTGAAAGGAAAAGG + Intronic
1123066985 14:105623821-105623843 CGGGGTTTGTTGAACGGGTCTGG + Intergenic
1123071006 14:105642548-105642570 CGGGGTTTGTTGAACGGGTCTGG + Intergenic
1123075966 14:105667589-105667611 CGGGGTTTGTTGAACGGGTCTGG + Intergenic
1123090671 14:105740818-105740840 CGGGGTTTGTTGAACGGGTCTGG + Intergenic
1123096303 14:105768582-105768604 CGGGGTTTGTTGAACGGGTCTGG + Intergenic
1127659136 15:61083606-61083628 CTGTGTTTGTTCATCTGGAAAGG + Intronic
1127965197 15:63918011-63918033 CAGTGTTTGTTCAACGGGACTGG + Intronic
1128159654 15:65415281-65415303 CATTGTTTGTTCAACGCAGCAGG - Intronic
1131429605 15:92376243-92376265 CAGTGTTTGTGTAAAGGGACTGG + Intergenic
1139326635 16:66157590-66157612 CAGTGTGTGTACAACTGGAGAGG + Intergenic
1139735881 16:68987781-68987803 CTGTGTTTGTTCAAAGTGAATGG + Intronic
1142223234 16:88865418-88865440 CAGTGTTTCCTCAAGGTGACGGG + Intronic
1143701902 17:8666767-8666789 AATTGTGTGTTCAAGGGGACTGG - Intergenic
1145235949 17:21208570-21208592 CAGTGTTTGCTCAAGGGAAACGG - Intronic
1151114366 17:71717235-71717257 CAGTTTTTGCTCAAGGGGATAGG + Intergenic
1151446952 17:74172727-74172749 CAGTGATTGTTCCACTGAACTGG + Intergenic
1152418791 17:80180766-80180788 GTGTGTTTGTTTACCGGGACAGG + Intronic
1155936142 18:31756469-31756491 CAGTGTTAGTTCAACATGATTGG + Intergenic
1158856264 18:61545512-61545534 CAGTGTTTCTGGCACGGGACAGG - Intronic
1159562705 18:70012241-70012263 CAGTGTCTGTTCACTGGTACTGG + Intronic
1159607081 18:70485807-70485829 CAGTGTTTATTCAAAGAGAAAGG + Intergenic
1161909382 19:7181292-7181314 AAGAGATTGTTCAAGGGGACTGG + Intronic
1164472561 19:28548222-28548244 CAGTGTTTGTTTAATGGCACAGG + Intergenic
932169636 2:69542064-69542086 CAGTGTTTGTTGAATGGAATTGG - Intronic
935200322 2:100851048-100851070 CAGTGTTTGTCCTTTGGGACTGG - Intronic
946350235 2:219146188-219146210 CAGTGTTTATACAAGGGGACTGG - Intronic
947961368 2:234240869-234240891 CACTGTTTATTCAACCGCACAGG + Intergenic
1175543143 20:59760793-59760815 CAGTGTTTCTACTATGGGACAGG + Intronic
1178269197 21:31174355-31174377 CAGCGTTTGTTGAACAGGAAAGG - Intronic
1181564892 22:23729961-23729983 CAGTATTTGTACAAAGGGAAGGG - Intergenic
1184968605 22:47999088-47999110 CAGTGCATGTTCAACAGGAGGGG - Intergenic
955261815 3:57398734-57398756 CGGTGTTTGTTCATCTGGAAAGG - Intronic
963841283 3:150109254-150109276 CAGTGTTTATCCAACGGAATTGG - Intergenic
964152067 3:153538163-153538185 CAGTGTATCTTCAACTGTACTGG + Intergenic
971963354 4:33518065-33518087 AAGTGTTGGTTCAATGGCACTGG + Intergenic
972063360 4:34909560-34909582 CAGTGTTTTTGCAAAGAGACTGG + Intergenic
976179491 4:82385690-82385712 CAGTATTTGTTCATATGGACTGG + Intergenic
976550012 4:86382817-86382839 CTGTTTTAGTTCAACGTGACAGG + Intronic
978138513 4:105291734-105291756 CAGAGTATGTTAAAAGGGACAGG + Intergenic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
978775657 4:112504230-112504252 CAGAGGTAGTTCAACGGGTCTGG - Intergenic
982842815 4:160213531-160213553 CAGTGTTTGTCCAGAAGGACTGG - Intergenic
984144965 4:176048985-176049007 CAGTGTTCCTTCAAGGAGACAGG - Intergenic
994803377 5:104409830-104409852 CAGTGTTTGTTCACAGGGTGAGG + Intergenic
995534124 5:113118789-113118811 GTGTGTTTGTTCATCGGAACTGG - Intronic
1013160235 6:107536544-107536566 CTGTGTTTGTTTAATGGGGCGGG + Intronic
1029180840 7:98700625-98700647 CAGTCTTTGTTCCACGTGTCTGG - Intergenic
1036076915 8:5512515-5512537 CAGTGTTTCTTCAAAAGCACTGG + Intergenic
1037056418 8:14447173-14447195 CAGTTTTTGTTCCATGAGACTGG - Intronic
1040909240 8:52501725-52501747 CAGTGTTTATTTAAAGAGACAGG + Intergenic
1048002030 8:130386436-130386458 CTGTGTTTTTTCATCAGGACAGG - Intronic
1048895473 8:138988689-138988711 CAGAGTTTGATGAAAGGGACAGG + Intergenic
1053406620 9:37882321-37882343 CAGTGTTCGTTCAACATGATTGG + Intronic
1056520444 9:87396273-87396295 CTGTGTTTGTTCAGCTGGAGAGG - Intergenic
1057042844 9:91859926-91859948 CAGTGTGGGCTCAACGGGGCTGG - Intronic
1058607102 9:106734604-106734626 CAATGTCTGTTCAAGGGGAATGG - Intergenic
1059155526 9:111985404-111985426 CAGTGGTTGTTCTTCAGGACAGG - Intergenic
1062084220 9:134640728-134640750 AATTGTTTGTTCAAAGGGAATGG + Intergenic
1192670912 X:73140254-73140276 TAGTGTTTGTTAAAAGGGATGGG - Intergenic
1195774051 X:108383654-108383676 AAATATTTGTTCAACGGCACTGG - Intronic
1196786468 X:119425455-119425477 CAGTGTTTGTACCTCTGGACAGG - Intronic
1199319428 X:146420867-146420889 CTGTGTTTGTTGAACTGAACTGG + Intergenic