ID: 1127965836

View in Genome Browser
Species Human (GRCh38)
Location 15:63922420-63922442
Sequence CAATTCTCAAGCATTTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127965835_1127965836 -9 Left 1127965835 15:63922406-63922428 CCTTCATCACAAATCAATTCTCA 0: 1
1: 0
2: 0
3: 40
4: 307
Right 1127965836 15:63922420-63922442 CAATTCTCAAGCATTTCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 163
1127965834_1127965836 30 Left 1127965834 15:63922367-63922389 CCATAAGGTATGTAGGCAGAAAG 0: 1
1: 0
2: 1
3: 10
4: 148
Right 1127965836 15:63922420-63922442 CAATTCTCAAGCATTTCCCCAGG 0: 1
1: 0
2: 1
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127965836 Original CRISPR CAATTCTCAAGCATTTCCCC AGG Intronic
900030820 1:371479-371501 CAATTATCAGCCATTTCTCCAGG + Intergenic
900051434 1:600153-600175 CAATTATCAGCCATTTCTCCAGG + Intergenic
903652561 1:24930508-24930530 CAAATTTCTAGCATTTGCCCCGG - Intronic
905816520 1:40955048-40955070 AAATTCTCAGGCACTTCCTCTGG + Intergenic
911465221 1:98243579-98243601 TGATTCTCAAGCATTTGTCCTGG + Intergenic
914907808 1:151761192-151761214 CAAATCCCCAGCATTTCCCTAGG + Intronic
916029614 1:160864380-160864402 CAACTCTGAAGAAATTCCCCAGG - Intergenic
919127434 1:193412664-193412686 AAATCCTCAATCATTTTCCCAGG - Intergenic
920984410 1:210872215-210872237 CAATTATTAAGCATTTACCATGG - Intronic
922076760 1:222252946-222252968 AAATTCTCAGGCCTTACCCCAGG - Intergenic
923155707 1:231277396-231277418 CAAGTCTCCAGCTTCTCCCCTGG + Intronic
924875099 1:248094741-248094763 CAATCATCAATCATTCCCCCTGG + Intronic
1071057070 10:81524333-81524355 CAACTCTCAGGCATTTGCACAGG - Intergenic
1071402614 10:85290401-85290423 AAATTTGAAAGCATTTCCCCTGG + Intergenic
1071958938 10:90789248-90789270 AAATTCTCAAGCAATTCTCAAGG + Intronic
1077039057 11:509977-509999 CCATTCTCGCTCATTTCCCCGGG + Intergenic
1080813865 11:35734621-35734643 TAACTCTCAAGCCTTTCCCAAGG - Intronic
1081748951 11:45494120-45494142 CGATTTTCCAGAATTTCCCCAGG - Intergenic
1086845495 11:91744641-91744663 CAATTCATGATCATTTCCCCAGG + Intergenic
1089454481 11:118618084-118618106 GAATTCTGAAGCATTTCCTGTGG + Intronic
1091762523 12:3096582-3096604 CTAATCTCATCCATTTCCCCAGG + Intronic
1093242015 12:16688486-16688508 CAATTTTCATGCAACTCCCCTGG + Intergenic
1093701904 12:22230946-22230968 CAATTCTGATGCACTTCCCAGGG + Intronic
1094754773 12:33455204-33455226 AAATTATCAGGCATTCCCCCAGG - Intergenic
1097297595 12:57984023-57984045 AAATTACCAGGCATTTCCCCAGG + Intergenic
1097602110 12:61705956-61705978 CATTTCTAAAACAGTTCCCCAGG - Intergenic
1098573114 12:72011574-72011596 CCATTCTCTAGCATTTTCCCTGG + Intronic
1098612724 12:72480996-72481018 CTATTATTCAGCATTTCCCCAGG + Intronic
1100553301 12:95667764-95667786 CCAGTTTCAAGCATTTCTCCTGG - Intronic
1101224143 12:102670917-102670939 CATTTATCAAGCAGTTCCTCAGG - Intergenic
1101559992 12:105847861-105847883 AAATTCTCAAGCTTCTCCCCAGG - Intergenic
1101788012 12:107903134-107903156 CAATTTTCAAGGATTGCCTCAGG - Intergenic
1102224417 12:111217776-111217798 CATTTCCCAAGCATGTCCCGTGG - Intronic
1111721869 13:91956177-91956199 CAATACTCAAGCATGCCACCTGG + Intronic
1114769444 14:25411758-25411780 CAGTTCTCAAGCCTTATCCCTGG + Intergenic
1115019765 14:28661949-28661971 CAATTCTCTAACAATTCCCTAGG + Intergenic
1116089345 14:40284916-40284938 CACTTCTCAACCATTTAACCTGG + Intergenic
1116547605 14:46189173-46189195 AAATTTTCAAGCATTTACACAGG + Intergenic
1117144534 14:52823623-52823645 CAATTCTCATATATTTACCCAGG + Intergenic
1117464923 14:55983295-55983317 GAATTCTCCTGCATTTTCCCAGG - Intergenic
1122349454 14:101078947-101078969 CAGTTCAGAAGCATTTTCCCTGG - Intergenic
1125773073 15:42185075-42185097 CCATTCCCAGGCATTTGCCCAGG + Intronic
1127342526 15:58062932-58062954 TAATTCTGGAGCATTTCCACTGG + Intronic
1127918995 15:63478425-63478447 GGATTCACAAGCATTTCCCAAGG - Intergenic
1127965836 15:63922420-63922442 CAATTCTCAAGCATTTCCCCAGG + Intronic
1128522590 15:68385705-68385727 CATTTCTGCAGCATTTCCACCGG - Intronic
1128709554 15:69861462-69861484 TCATTCTCAAACATTTACCCTGG + Intergenic
1129992060 15:79974006-79974028 CACTTCTCCAGGAATTCCCCTGG + Intergenic
1131893858 15:97004458-97004480 GAACCCTGAAGCATTTCCCCAGG - Intergenic
1135128378 16:19830602-19830624 CAATTCTGAAGTCTGTCCCCAGG + Intronic
1135881841 16:26265204-26265226 CACTTCTCAAGTATTTCCAAAGG + Intergenic
1137485999 16:48891394-48891416 GACTTCTCAAGCATCTTCCCAGG - Intergenic
1138226297 16:55298263-55298285 CTATTCACCAGCATCTCCCCAGG + Intergenic
1139527336 16:67525011-67525033 CAATTCTCCAGCTTTTGCTCTGG + Intronic
1141870510 16:86782298-86782320 CCATTCCTAAGCATATCCCCTGG - Intergenic
1143992504 17:10978255-10978277 CTATTCTCTAGCAATTACCCCGG + Intergenic
1144443100 17:15301566-15301588 CAATACTCAATCTCTTCCCCAGG - Intergenic
1145022007 17:19439580-19439602 CAAGTCTTAAGTATCTCCCCTGG + Intergenic
1149257412 17:54842237-54842259 GAATTCTCAAGCATTTACCTTGG + Intergenic
1151941818 17:77297255-77297277 CAGTTCTCCAGCAGTTCCCCAGG - Intronic
1152948793 17:83213928-83213950 CAATTATCAGCCATTTCTCCAGG - Intergenic
1152995132 18:399542-399564 CCATTCCCCAGCATATCCCCAGG - Intronic
1156287152 18:35708003-35708025 CATTTATCAAGCATTTACTCTGG + Intronic
1160820875 19:1057175-1057197 CAATCCTCAAGACTTTACCCAGG - Intronic
1164420386 19:28086452-28086474 TAATTCTCCAGCAGTTCCTCTGG - Intergenic
925589098 2:5492800-5492822 CACTTCTCAAGCCCTTCTCCTGG + Intergenic
926297902 2:11581853-11581875 CAATTCACAAGATTTTCACCAGG - Intronic
926468626 2:13223855-13223877 CTATTCTCAAGCATTTGCTCTGG - Intergenic
929716557 2:44316680-44316702 CAATTCTCAACCCTTTTCTCAGG - Intronic
929746202 2:44661698-44661720 AAACTATCAAGCACTTCCCCAGG + Intronic
929861706 2:45683896-45683918 CAATTCTCAATCATTTCTTGTGG + Intronic
930682378 2:54270775-54270797 CTAGTCTCCAGAATTTCCCCAGG - Intronic
933687423 2:85154208-85154230 TAATTCTCAAGTATTTTCCTTGG - Intronic
934562993 2:95322891-95322913 CACTCCTCAAACACTTCCCCAGG + Intronic
934679049 2:96269439-96269461 CAATTCCCAAGCACTCCCCCAGG - Intronic
934909864 2:98241713-98241735 CAGTTCTCAAGCACATCCCATGG + Intronic
935507686 2:103926499-103926521 CAATTGTCATGAATTTCCCTTGG + Intergenic
937164536 2:119799698-119799720 TAATTCCAAAACATTTCCCCTGG + Intronic
937264122 2:120605463-120605485 CAATAGTCAAGCATGGCCCCTGG - Intergenic
942279222 2:174343813-174343835 CAATTCTCAGGCCTTTTCGCTGG - Intergenic
942545713 2:177061614-177061636 CAATCCTCAGGCAGTTCCACCGG + Intergenic
943091632 2:183382438-183382460 CTATTCTCCAGAATTTCCTCAGG - Intergenic
945012601 2:205481106-205481128 TAATTCTCAAACCATTCCCCAGG - Intronic
946108458 2:217392716-217392738 CACTTCTCTAGCATTTTGCCAGG + Intronic
947445932 2:230162596-230162618 CAAACCTCAAGTATTACCCCAGG - Intergenic
947487640 2:230567158-230567180 CCATCTTCAAACATTTCCCCAGG - Intergenic
1173678329 20:44857528-44857550 CAATTCACAAGCAACTCCCTAGG - Intergenic
1176908049 21:14528376-14528398 AAATTCTCAAGAATTTCCCCAGG + Intronic
1177358711 21:20041229-20041251 TCATTCTTAAGCATTTACCCAGG + Intergenic
1177902147 21:26929992-26930014 CAGTTCTCACACACTTCCCCCGG + Exonic
1178738951 21:35178669-35178691 CATTTCTCATGCTTTTGCCCAGG + Intronic
1179375285 21:40845332-40845354 CAATGCTCATGCATTTCTTCTGG + Intronic
1183089568 22:35512194-35512216 CAATTCTCATCTATTTCCCAAGG - Intergenic
949485246 3:4531786-4531808 CAAATCTCAGGCATCTCCTCTGG + Intronic
951180412 3:19652898-19652920 CATTTCCCAAGCATTTCCTTTGG + Intergenic
952110007 3:30111542-30111564 AAATTCTCAGGCCTTGCCCCAGG - Intergenic
952652245 3:35739991-35740013 CAATTCTCAAGCATTTTCTGGGG + Intronic
952820542 3:37482230-37482252 CAATTCTCCAGCATCTGCCTGGG - Intronic
952873398 3:37921782-37921804 CAGTTCTCCAGCCTTGCCCCAGG - Intronic
955184880 3:56705410-56705432 CAATTCTCTAGAATTTTGCCTGG - Intergenic
958060656 3:88475761-88475783 CAACTGTCAATCATTTCCCTTGG - Intergenic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
962926711 3:140000250-140000272 CAATTCTAAAGTACTACCCCAGG - Intronic
964537208 3:157736454-157736476 CAATTCTTTGGAATTTCCCCTGG - Intergenic
972350388 4:38231214-38231236 GATTTCCCAAGCATTTACCCCGG + Intergenic
975373278 4:73612960-73612982 CTTTTCTCACCCATTTCCCCTGG + Intronic
976103208 4:81587942-81587964 CAATTCTCTCCCCTTTCCCCAGG + Intronic
978088208 4:104681533-104681555 GAATTCTCAAGCTTTTTCACAGG + Intergenic
978240598 4:106511368-106511390 CAATACTCAAGCTTTGCCTCAGG + Intergenic
979466998 4:121051453-121051475 TAATTTACAAGCATTTCCACAGG - Intronic
980412982 4:132447193-132447215 CAAGTCTCAAGCCTTACCCAAGG - Exonic
980851402 4:138387603-138387625 CAATTTTCCAGCATTGCTCCTGG - Intergenic
981705844 4:147658438-147658460 AAAATCTCAACCCTTTCCCCAGG - Intronic
982624691 4:157751807-157751829 CAATTTCATAGCATTTCCCCAGG + Intergenic
983396520 4:167204469-167204491 TAAGTGTCTAGCATTTCCCCTGG - Intronic
985538590 5:477539-477561 CAGGTCTCAAGGCTTTCCCCGGG - Intronic
988196675 5:28013681-28013703 GAATTCTCAAATGTTTCCCCTGG - Intergenic
989561187 5:42853325-42853347 CAAGTCTCAAGCATTTTAGCAGG - Intronic
990504772 5:56433439-56433461 GACTTCACAAGCATTTCCACTGG - Intergenic
990964037 5:61425347-61425369 CATTTGTAAAGCATTTCCACTGG + Intronic
991359962 5:65809569-65809591 CAATTTTCAAGCATTTGCGATGG - Exonic
991546429 5:67786668-67786690 CATGTCTCAAGCTTTTCCTCTGG + Intergenic
991658032 5:68922620-68922642 TCATTCTCATGCAATTCCCCTGG + Intergenic
992247527 5:74841645-74841667 CAATTTTCCAGCATATCCACAGG + Exonic
993576593 5:89609929-89609951 TAATATTCAAACATTTCCCCTGG + Intergenic
993826993 5:92701883-92701905 GAATTCTCAAGAATTTCTCTAGG - Intergenic
994809735 5:104499718-104499740 CAAATCTCAATAATTTCCTCAGG + Intergenic
995092925 5:108200629-108200651 CAATAACCAAGCATTTCCTCTGG + Intronic
995480110 5:112584940-112584962 CCATTCTCCTGCATTTCCCTGGG - Intergenic
996473096 5:123883154-123883176 CAAGCCTGAAGCATTTCCTCTGG - Intergenic
996554238 5:124761489-124761511 CAATTTTCAAGAACTTGCCCAGG - Intergenic
997244471 5:132335239-132335261 CTACTCTCAAACATTTTCCCTGG + Intronic
997815040 5:137008571-137008593 CAATTCTCTAGTATTTCCTTTGG - Intronic
998331447 5:141331395-141331417 CAATCCTCCAGCATTTACTCAGG + Exonic
1000569230 5:162891401-162891423 CAACTCTAAATCATTACCCCAGG + Intergenic
1002743000 5:181447389-181447411 CAATTATCAGCCATTTCTCCAGG - Intergenic
1003795714 6:9600702-9600724 CAATTCTAGAGCATTTTCCAAGG + Intronic
1004101358 6:12615460-12615482 CAATTCCTAAGCCTTTCCCTGGG - Intergenic
1008606553 6:53145673-53145695 AAATTCTCAAGCATTTCTGAGGG - Exonic
1011031945 6:82932862-82932884 CCATGCTCTAGCATGTCCCCTGG - Intronic
1012057306 6:94429477-94429499 CACTTCACAAGCATTTCCTCTGG - Intergenic
1015728623 6:136325160-136325182 CAGCTCTCAATCATGTCCCCTGG + Intergenic
1016717943 6:147255568-147255590 CACTGCTCAAGCAATTTCCCAGG + Intronic
1018366430 6:163124617-163124639 GAAATGTCCAGCATTTCCCCAGG + Intronic
1019248100 6:170722814-170722836 CAATTATCAGCCATTTCTCCAGG - Intergenic
1020024665 7:4890622-4890644 CAATTCTGTTGAATTTCCCCCGG + Intergenic
1021402289 7:20223008-20223030 CAATTCTCAGGAATTTCCTCAGG + Intergenic
1024378776 7:48670081-48670103 CATTTCTCCAGCATATCCACAGG - Intergenic
1029915873 7:104209030-104209052 CAATTCAAAAGCATTTGCCCAGG + Intergenic
1034816516 7:154176641-154176663 CAAATCTCAAGCCTTTGTCCTGG + Intronic
1035500000 8:84919-84941 CAATTATCAGCCATTTCTCCAGG + Intergenic
1036468428 8:9025779-9025801 CAAATCTCAAACATTTCTTCTGG - Intronic
1038891112 8:31725164-31725186 CAATTCACTAGCCTTTCTCCAGG + Intronic
1046973423 8:120247695-120247717 CAATTCTATAGCCTTTCACCGGG - Exonic
1052137615 9:24934246-24934268 CAATTCTCAAAATTTTCACCTGG + Intergenic
1053036848 9:34833343-34833365 CAATTCCAAAGCAGTACCCCAGG - Intergenic
1053425990 9:38010532-38010554 CTTTTCTCAAGCTTTTCCCTCGG + Intronic
1055556199 9:77476197-77476219 AAAATCTGAATCATTTCCCCAGG - Intronic
1056557727 9:87703756-87703778 CCATTCTCAATCATTTCTGCTGG - Intronic
1058697824 9:107574633-107574655 CAGTTCTAATGCATTTGCCCAGG + Intergenic
1058790884 9:108444477-108444499 CAATTCCCAAGCCTTTTCCCTGG - Intergenic
1059727004 9:117018674-117018696 GAAATATCAAGCATTTCCCAGGG - Intronic
1060255485 9:122025783-122025805 CAATTTTTAAGCATTCACCCAGG + Intronic
1203608882 Un_KI270748v1:78424-78446 CAATTATCAGCCATTTCTCCAGG - Intergenic
1186126467 X:6419854-6419876 CATTTCTCAAGAAGTTCCCTTGG - Intergenic
1186926654 X:14340450-14340472 TAATTCTCCAGCAGTTCCTCTGG + Intergenic
1187398954 X:18942510-18942532 CAAAGCTCACGCATTTCCACTGG + Intronic
1188436204 X:30161413-30161435 GAATTCAGAAGCATTTCCCAAGG - Intergenic
1190328001 X:49218555-49218577 CAATCCTCAGGCATTGGCCCTGG + Intronic
1191615724 X:63167634-63167656 CATTGCTCAAGCATTTTACCAGG + Intergenic
1191620574 X:63211289-63211311 CATTGCTCAAGCATTTTACCAGG - Intergenic
1193370990 X:80697079-80697101 TAAATTTGAAGCATTTCCCCAGG - Intronic
1193720273 X:84977627-84977649 CAATGCTCCAGCATTGCCTCTGG - Intergenic
1196227845 X:113187992-113188014 CTATTCTCAATGATTTCACCAGG + Intergenic
1196432562 X:115642398-115642420 CAGTTCACAAGCATTTCCCTTGG + Intronic
1196686100 X:118511850-118511872 CAGTTCACAAACATTTCCCTTGG - Intronic
1201950795 Y:19561708-19561730 CAATTTTAAAGCATTTCTGCAGG + Intergenic