ID: 1127965844

View in Genome Browser
Species Human (GRCh38)
Location 15:63922448-63922470
Sequence CCCCTTCTGCAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 1, 2: 2, 3: 70, 4: 447}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127965844_1127965854 19 Left 1127965844 15:63922448-63922470 CCATCCTCCCTCTGCAGAAGGGG 0: 1
1: 1
2: 2
3: 70
4: 447
Right 1127965854 15:63922490-63922512 CTCTAATTGTTTTAACAGCTTGG 0: 1
1: 0
2: 1
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127965844 Original CRISPR CCCCTTCTGCAGAGGGAGGA TGG (reversed) Intronic
900485375 1:2920341-2920363 CCCCATCTGCAGTGAGCGGAGGG - Intergenic
900590955 1:3459599-3459621 GGCCCTCTGGAGAGGGAGGACGG + Intronic
900602182 1:3507684-3507706 TCCCTGCTCCAGTGGGAGGAAGG + Intronic
901417195 1:9125493-9125515 CCCCCTTTACAGAGAGAGGAGGG - Intronic
901497079 1:9628548-9628570 CCCCTGCCGTGGAGGGAGGATGG + Intergenic
901705784 1:11071955-11071977 TCCCTTCTGCTGAGGGATGGTGG - Intronic
901717544 1:11168575-11168597 AGCCTTCTGCAAAGGGTGGAAGG - Intronic
901868099 1:12120903-12120925 CCCCTTCTGCACATACAGGAGGG + Intronic
901870951 1:12138977-12138999 CTGCTTCTGCAGAGGGTGGGTGG - Intronic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
903149080 1:21392642-21392664 CTCCTGCTGCCTAGGGAGGAAGG - Intergenic
903606721 1:24580325-24580347 CCCCGTCTGCAGAGGCAGCCAGG - Intronic
903684445 1:25120518-25120540 CGCCTTGTGCAGAAGGAGGAGGG - Intergenic
904593093 1:31626200-31626222 GCCCTTCTCAAGGGGGAGGAGGG - Intronic
905124450 1:35707486-35707508 CCCCTGCTGGAGACGGAGGTTGG + Intergenic
905172907 1:36119531-36119553 CCCCTCCTGCAGCGGCAGCAGGG - Intronic
905380162 1:37556267-37556289 CCTCTTCTGGGGAGGGATGAAGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905887005 1:41496836-41496858 CCCCTTCTCCACATGGAGGCTGG + Intergenic
906735343 1:48120678-48120700 GACTTTCTGGAGAGGGAGGATGG + Intergenic
907159597 1:52360601-52360623 CAGCTTCCGCAGAGGGAGAATGG - Intronic
907682734 1:56579174-56579196 CACCTTCTGCAGTTGGAGGCAGG - Exonic
908848793 1:68352443-68352465 CCACTTCTGAAGAGGAGGGAAGG + Intergenic
909237465 1:73171843-73171865 CCCTTTCAGCAGAAGGAGGAAGG - Intergenic
909623134 1:77687627-77687649 CCCCGTCTGCGAAGTGAGGAGGG + Intergenic
910103179 1:83600094-83600116 CACCTTCTTCACAAGGAGGAAGG + Intergenic
911146178 1:94554621-94554643 CCCCATCTGGACAGGGAGGGAGG - Intergenic
912238686 1:107881594-107881616 GCCCTTCTGAAGAGGGAGAGAGG - Intronic
912498923 1:110108960-110108982 GCCTCTCTGCAGAGGGAGCAGGG - Intergenic
912958205 1:114171197-114171219 CCCCTTGTGTTGAGGGAGGGAGG - Intergenic
913195792 1:116454959-116454981 CTCATTCAGCACAGGGAGGAAGG - Intergenic
914827272 1:151145363-151145385 CACCTTCCTCAGAGGGAGCAGGG + Intronic
915035733 1:152922465-152922487 CACCTCCTGCAGAGGGAAGATGG - Intergenic
915172995 1:153991129-153991151 CCTCTTCTGGAGAGGGATGAAGG - Exonic
915508347 1:156371606-156371628 CCCCTTCTGCCTAGGGTGGGTGG - Intronic
915523770 1:156464029-156464051 CCCATTCTCCAGAGGGAGGGAGG - Exonic
915532641 1:156511988-156512010 CTCCTTCTGTAGAGGATGGAAGG - Intergenic
917317595 1:173741695-173741717 CCTCTTCTGGAGAGGGATGAAGG - Intronic
917468897 1:175308980-175309002 CACCTTCTTCACAGGGCGGAAGG - Intergenic
917470467 1:175322194-175322216 CACTTTCTGCAAAGGTAGGAGGG - Exonic
918682654 1:187374284-187374306 TCCCCTCTCTAGAGGGAGGAGGG - Intergenic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
919961287 1:202472075-202472097 CCTCTTCTGGAGAGGGATGAAGG + Intronic
920234778 1:204495253-204495275 CCCCTTCCAGAAAGGGAGGAAGG - Intergenic
920734017 1:208514756-208514778 CCACTACTGCAGAGGGGTGAGGG + Intergenic
920836721 1:209517893-209517915 CTCCTGCTGGAGAGGCAGGAAGG - Intergenic
921185970 1:212669835-212669857 CTCATCCTGCAGAGGGAGGATGG - Intergenic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
923090255 1:230735243-230735265 CCCCGACTGCAGCGGGAGAAGGG + Intergenic
923191247 1:231622876-231622898 CCCCTTCTGTAGTGGTAGTATGG - Intronic
923891084 1:238215500-238215522 CCCCATATGTTGAGGGAGGAAGG - Intergenic
924837465 1:247666862-247666884 ACCCTTGTGAAGAGAGAGGATGG + Intergenic
1063355577 10:5395470-5395492 TCCCATCTGCAGAGGGTGAAAGG + Exonic
1063479937 10:6366590-6366612 CACCTTATGCAGAGGGAGAAGGG - Intergenic
1067106846 10:43372242-43372264 GTCCTTCTGCAGTGGGAGGGAGG - Intronic
1067456906 10:46425559-46425581 GGCCTTCTGGAGAGGGAGGCAGG - Intergenic
1068423081 10:56821654-56821676 TCCCCTGTGCAGAGGGAGGGGGG - Intergenic
1068594471 10:58888018-58888040 CCCCTTCTGCCATGTGAGGAAGG - Intergenic
1068714458 10:60172993-60173015 CCCATTCTGTAGAAGGAAGATGG + Exonic
1070312124 10:75281556-75281578 CCCCAGCTGCAGATGGAGGTGGG + Intergenic
1070504197 10:77098764-77098786 CCCCTTCCAGAGAGGAAGGAAGG - Intronic
1072015554 10:91342876-91342898 CCCCATGTGTGGAGGGAGGAGGG - Intergenic
1072308543 10:94131851-94131873 GCTCTTCTGCAGAGAGATGAAGG - Intronic
1072787829 10:98296249-98296271 TCCCTGCAGGAGAGGGAGGAAGG + Intergenic
1073131077 10:101189672-101189694 TCCCTTCTGCAGAGCAGGGATGG + Intergenic
1073293699 10:102425652-102425674 CCCTTTGTGCAGAGGGTGGGTGG - Intronic
1073642550 10:105267784-105267806 AGCCTTATTCAGAGGGAGGAAGG + Intergenic
1075634484 10:124021006-124021028 ATCCTCCTGCTGAGGGAGGAGGG + Intronic
1075715672 10:124553840-124553862 CTCCTTCTGCAGACAGAGGAGGG - Intronic
1075938488 10:126365590-126365612 CACCTTCTTCACAGGGAGGCAGG + Intronic
1076269228 10:129136314-129136336 CCCCCTCTGCAGAGGAAGAAAGG - Intergenic
1076755256 10:132567225-132567247 CACATTCTGCAGAAGCAGGAAGG + Intronic
1076820775 10:132938500-132938522 CCCCTTCTCCGGGGGGGGGACGG - Intronic
1077214776 11:1390709-1390731 CCCATTGTGCCGCGGGAGGAGGG + Intronic
1077391127 11:2301092-2301114 CTCCCTCCGCAGAGGGAGGGAGG + Intronic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1080128524 11:28766320-28766342 CCTCTTCTTAAGAGGAAGGAAGG - Intergenic
1080582357 11:33654539-33654561 TCCCTTCTAGGGAGGGAGGATGG - Intronic
1080937871 11:36882500-36882522 CCCCTCCTGCAAAGGGAGGCAGG + Intergenic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1081296667 11:41398546-41398568 CCCCTTTTGAAGAAGGAAGAGGG + Intronic
1081775285 11:45671969-45671991 CTCCTCCCGCAGAGGGAGGAGGG - Intergenic
1081852160 11:46281378-46281400 CCCCTTAGCCAGAGGAAGGAGGG - Intronic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083014978 11:59443860-59443882 TCCCTTCAGCAGAGGGCCGATGG + Exonic
1083273615 11:61584869-61584891 CCCCTTCTGTAGGGGCTGGAAGG - Intergenic
1083378297 11:62243956-62243978 CAGCTTCTGCAGAGCCAGGAAGG + Intronic
1083616345 11:64028414-64028436 TCCACGCTGCAGAGGGAGGAGGG + Intronic
1083749266 11:64752547-64752569 CCCCTTCTGTGTTGGGAGGAGGG - Intronic
1084289515 11:68152777-68152799 CCCGTGCTGCAGAGAGGGGAAGG - Intergenic
1084769239 11:71331930-71331952 CCCCTCCTGTAGAAGGAGAATGG + Intergenic
1084888005 11:72223391-72223413 CCCCTCCAGCCGAGGGCGGAAGG - Intergenic
1085187724 11:74590682-74590704 CCAGTTCTGAAGTGGGAGGATGG - Intronic
1085637548 11:78170151-78170173 GCCCTTCTTAAGAGGGTGGAGGG + Intergenic
1088812486 11:113400941-113400963 CCCCCTCTGGAGATGGAGGGAGG + Intergenic
1088893271 11:114060466-114060488 CCCCTTTTGCAGGGGAGGGAGGG + Intronic
1088952436 11:114585187-114585209 CCAGTTCTGCAGGTGGAGGATGG + Intronic
1088952438 11:114585225-114585247 CCAATTCTGCAGGTGGAGGATGG - Intronic
1089236842 11:117036009-117036031 CCTTTTCTGGAGAGGGATGAAGG + Intronic
1089721266 11:120425158-120425180 TCCCATCTGCACAGGGAGAAGGG + Intronic
1090076360 11:123582287-123582309 CCCCTTCTGGAGGGGGTGGATGG - Intronic
1090231446 11:125109368-125109390 TTGCCTCTGCAGAGGGAGGAAGG + Intronic
1090593643 11:128297230-128297252 GGCTTTCTGCAGAGGGAGGAGGG + Intergenic
1090662059 11:128889968-128889990 CCCCCTCTACAGAGAGAAGAGGG + Intergenic
1091750200 12:3017574-3017596 GCTCTTCTGAACAGGGAGGAGGG - Intronic
1091780547 12:3211875-3211897 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1091994496 12:4982580-4982602 CCCCTGCTTCAGAGGGAGCCAGG - Intergenic
1092106926 12:5927899-5927921 GCCCTTCTGAACAGGGGGGAGGG + Intronic
1093435335 12:19129736-19129758 CCGCGGCTGCCGAGGGAGGAGGG - Intronic
1095395131 12:41754190-41754212 CCCCTTCTGCCAAATGAGGATGG + Intergenic
1095485383 12:42679082-42679104 CCTCTTCTGGGGAGGGATGAAGG + Intergenic
1096182344 12:49557752-49557774 CCCCTTCCTCAGAAGGAGGAGGG - Exonic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096526206 12:52211831-52211853 ATGCTCCTGCAGAGGGAGGAGGG + Intergenic
1098670835 12:73228928-73228950 CACCTTCTTCATAGGGAGGCAGG + Intergenic
1101013171 12:100472224-100472246 CCCCTTCGGCACAAGGAAGAGGG - Intergenic
1101549338 12:105747621-105747643 CTCCTTCTGCCCTGGGAGGAAGG + Intergenic
1101777478 12:107807399-107807421 GCTCTTCTTCAGAGGGATGATGG + Intergenic
1102734835 12:115150240-115150262 CCCCTTCTGCTGTTTGAGGACGG - Intergenic
1102776597 12:115524988-115525010 TCACCTCTGTAGAGGGAGGAGGG + Intergenic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1103044198 12:117721812-117721834 CCCTTTAAGCAGAGGGAGGTGGG + Intronic
1103124589 12:118410474-118410496 TCCCTTCTGTAGAGGGACCAAGG + Intronic
1103560085 12:121789036-121789058 GCCCATCTGCAGAGGCTGGATGG - Intronic
1103936491 12:124480203-124480225 CTCCTCCTGCAGCGGGAGTAGGG - Intronic
1104678056 12:130729258-130729280 CCCCTGCTGGAGGTGGAGGAAGG - Intergenic
1104753336 12:131253699-131253721 CCCCATTTGATGAGGGAGGATGG + Intergenic
1104936156 12:132365448-132365470 CCACTCCTGGAGAGGGAGGAAGG + Intergenic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1107328531 13:39271858-39271880 CCCCTTCTGGAGAAGGGAGATGG - Intergenic
1107525943 13:41231357-41231379 TGCCTTCTGCAGATTGAGGAAGG - Intronic
1107631952 13:42351423-42351445 CCCCCTATGCAGAGGGAGAAGGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108183596 13:47866351-47866373 CCACTTCTGGAGGGAGAGGAAGG - Intergenic
1108245571 13:48509571-48509593 CCCCTTCAGAATTGGGAGGAGGG - Intronic
1108678125 13:52755739-52755761 CCCCTTCTGCCGTGAGTGGAAGG - Intergenic
1109024638 13:57142531-57142553 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109025625 13:57149101-57149123 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109026615 13:57155674-57155696 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109027607 13:57162245-57162267 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109028593 13:57168810-57168832 CCCCTCCTGCAGAGAGAGGCCGG + Exonic
1109207939 13:59502134-59502156 CCCTTTCAGCAGAGAGAGGTGGG + Intergenic
1110655013 13:77987275-77987297 CACCATGTGCAGGGGGAGGAAGG - Intergenic
1110888260 13:80666221-80666243 CACCCTCTGCAGATAGAGGAGGG + Intergenic
1113042218 13:106116784-106116806 ACCCTTCTGAAGGTGGAGGAAGG - Intergenic
1113113397 13:106848645-106848667 GCCTTTCTGCAGAGGGTGGGGGG - Intergenic
1113420083 13:110164547-110164569 CCCCATCTGGAGCGGGAGGCAGG + Intronic
1113510253 13:110848388-110848410 CCCCTTCTTCAGAGGGCGGCAGG + Intergenic
1113828624 13:113276639-113276661 CCCCTTCTGCAGCTGGTGCAAGG - Intergenic
1115008480 14:28515615-28515637 CACCTTCTTCACAGGGAGGCAGG - Intergenic
1115664375 14:35532022-35532044 CCCCTTTTCCAGAGAGAGAAAGG - Intergenic
1116030791 14:39568755-39568777 CACATTTTGCAGAGGGAGAAGGG + Intergenic
1118213875 14:63790001-63790023 CTCATTCTACAGAGGGAGGGTGG - Intergenic
1119158147 14:72430457-72430479 TCTCTTCTGCAGACAGAGGAGGG + Intronic
1119635478 14:76269852-76269874 CGCATTGTGGAGAGGGAGGAAGG - Intergenic
1121027697 14:90628603-90628625 CGCCTTCTGCACAGTCAGGAGGG + Intronic
1121236779 14:92397473-92397495 CCCCTGTTACAGAAGGAGGAAGG + Intronic
1122859644 14:104576806-104576828 CCCCTACGGCAGAGGGAGCTGGG + Intronic
1122952983 14:105056158-105056180 CTCCCTCTGCCCAGGGAGGAAGG - Exonic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1123904828 15:24911083-24911105 CCTCTTCTGGAGAGGGATGAAGG + Intronic
1125097497 15:35871447-35871469 CCCCTTCTGCACAGGGCCTAAGG + Intergenic
1125678850 15:41517972-41517994 CTCCATCTTCAGAGGAAGGAAGG - Intronic
1126166680 15:45659504-45659526 CCCAGGCTGCAGAGGGAGCATGG - Intronic
1126668900 15:51098259-51098281 AACCTTCAGCAGTGGGAGGAGGG + Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128256533 15:66201306-66201328 CACATTCTGCAGGAGGAGGAAGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1131066205 15:89436409-89436431 CCCCTTCAGGAAAGGGAGCAGGG + Intergenic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1132199632 15:99942469-99942491 CCCTTTCTGGGGAGGGGGGAAGG + Intergenic
1132540566 16:506826-506848 CCCCTGCTGCAGAGTGGAGAGGG + Intronic
1132543992 16:524738-524760 GCCCTTCAGCAGAGGCAGGATGG - Intergenic
1132544021 16:524833-524855 GCCCTTCAGCAGAGGCAGGCTGG - Intergenic
1132558431 16:582815-582837 CCCCGTCTGCAGAGAGAGGGTGG - Intronic
1134066716 16:11233114-11233136 CCCCCCATGAAGAGGGAGGAGGG - Intergenic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134502039 16:14776883-14776905 CCCCTGCAGGCGAGGGAGGAAGG + Intronic
1134578522 16:15352010-15352032 CCCCTGCAGGCGAGGGAGGAAGG - Intergenic
1134724066 16:16405534-16405556 CCCCTGCAGGCGAGGGAGGAAGG + Intergenic
1134943363 16:18306335-18306357 CCCCTGCAGGTGAGGGAGGAAGG - Intergenic
1136287191 16:29251493-29251515 GCCCTTCTGCAGAAGGAGCTCGG - Intergenic
1136398409 16:30005209-30005231 CCCCTGCTGCAGATGGCGGTGGG + Exonic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1137447749 16:48542205-48542227 CCCCTTTTGCGCAGGGTGGAAGG + Exonic
1138239009 16:55411447-55411469 CCTCTCCTGCAGGGGAAGGACGG + Intronic
1138417783 16:56881113-56881135 CCACTCCTGCATAGGGAGCAGGG - Intronic
1138451418 16:57095268-57095290 TCCCTTCTGGACAGGGAGGTGGG - Intronic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139339808 16:66261045-66261067 CACCTCCTGCAGGAGGAGGAAGG + Intergenic
1139392778 16:66615630-66615652 CCCACTCTGCAGTGGCAGGAAGG + Exonic
1140696874 16:77543421-77543443 CCCTGTCTGTAGAAGGAGGAAGG + Intergenic
1141961172 16:87410478-87410500 CCCATTTTGCAGGGGCAGGAAGG - Intronic
1142092801 16:88224126-88224148 GCCCTTCTGCAGAAGGAGCTCGG - Intergenic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1142606028 17:1081486-1081508 CCCAGTGTGCAGAGAGAGGATGG - Intronic
1142867523 17:2799765-2799787 CTGCCTCTGGAGAGGGAGGAGGG + Intronic
1143379692 17:6488302-6488324 GCCAGTCTGCAAAGGGAGGAAGG - Intronic
1144326767 17:14190037-14190059 CCTCTTCTGAAATGGGAGGAAGG + Intronic
1144475648 17:15586901-15586923 CCTCTTCTGAAATGGGAGGAAGG + Intronic
1144730438 17:17522917-17522939 GCACTTGGGCAGAGGGAGGAGGG - Intronic
1145063536 17:19747255-19747277 GGCTTTCTGCACAGGGAGGAGGG + Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145795448 17:27652975-27652997 CCCATTTTGCAGAGGGAAGGGGG - Intergenic
1145809883 17:27758306-27758328 CCCCTTTTACAGAGGGAAGGGGG - Intronic
1146635487 17:34501310-34501332 CCCCTGCAGCAGCAGGAGGAAGG + Intergenic
1147561924 17:41514568-41514590 CCCCTTCGGAATAGGGAGGAAGG - Intronic
1147702076 17:42402595-42402617 ACCCCTCTGCCGAGGGAGGTTGG - Exonic
1147705196 17:42421423-42421445 TCCCTTCAGCAGGGAGAGGAAGG + Intronic
1148564835 17:48626676-48626698 CCCTTCCTGCAGCGGGAGGGGGG - Intronic
1148641201 17:49189083-49189105 CTCCTTGTGCAGTGTGAGGAGGG - Intergenic
1149028835 17:52061693-52061715 CACCTTCTTCACATGGAGGAAGG - Intronic
1149645208 17:58235907-58235929 CCCCCTTTGGAGAGAGAGGAGGG - Intronic
1151285646 17:73109094-73109116 ACCCTTCTGCATCAGGAGGAAGG + Intergenic
1151355869 17:73558124-73558146 CGCCTTCTGCTGAGGCAGGAGGG + Intronic
1152003678 17:77663485-77663507 TCCCTTCTGCAGACCGAGGCTGG + Intergenic
1152032849 17:77854583-77854605 CACCTTCTGCTGAGGGGGGCGGG - Intergenic
1152571002 17:81121248-81121270 CTGCTTCTGCAGAGAGCGGAAGG + Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152798979 17:82322365-82322387 CTTCTTCTGCAGGGGGAGGAAGG + Exonic
1153540919 18:6153664-6153686 CCCCATGTGTTGAGGGAGGAAGG + Intronic
1155166743 18:23237916-23237938 CCCCGCCTGCTGTGGGAGGAGGG + Intronic
1156351267 18:36303336-36303358 CCCCATCTGCACAGAGAGCATGG - Intronic
1157592659 18:48844868-48844890 CGCCCTCTGAAGTGGGAGGAAGG - Intronic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1159373337 18:67558878-67558900 CCCCTTTTGGAGAGATAGGATGG + Intergenic
1159960895 18:74555232-74555254 ACCCTCCTGCAGCAGGAGGAAGG - Intronic
1160209276 18:76862569-76862591 CTGCTTCTGCTAAGGGAGGATGG - Intronic
1160365320 18:78319629-78319651 CTCCTTCTGCAGGTGGAGGATGG + Intergenic
1160600202 18:80006721-80006743 TCCCTTGTGCAGAGTGAGGGGGG + Intronic
1160846278 19:1167592-1167614 ACCCTTCTCCAGCTGGAGGAGGG - Intronic
1160894634 19:1396728-1396750 CCCCTCCTGGGGCGGGAGGAGGG + Intergenic
1160968337 19:1756243-1756265 CCCCTTCTGCAGAGCAAGCAAGG + Intronic
1161085370 19:2332740-2332762 CCCGGCCTGCACAGGGAGGAGGG - Intronic
1161487209 19:4542885-4542907 CCCACTCTGCAGAGGGAAGCGGG - Exonic
1161568550 19:5017095-5017117 TTCCCTGTGCAGAGGGAGGAAGG + Intronic
1162471812 19:10876679-10876701 CCCCCTCTGCACAGGGAAAATGG - Intronic
1163552344 19:17972611-17972633 CCCCTCCTGCCCAGGCAGGAGGG + Intronic
1164109299 19:22140184-22140206 CTCCTGATGCAGAGGGAGGCTGG + Intergenic
1164264217 19:23597361-23597383 TCTCTTCTGGAGAGGGATGAAGG - Intronic
1164326012 19:24192406-24192428 CACCTTGTGCACAGGGAAGATGG - Intergenic
1165100704 19:33436890-33436912 CCCCTAGTCCACAGGGAGGAGGG + Intronic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1165938454 19:39403345-39403367 CCCCTGGTTCCGAGGGAGGAGGG + Intergenic
1166032805 19:40145774-40145796 CCACTTTTGGAGAAGGAGGAGGG - Intergenic
1166775067 19:45307468-45307490 CCTCTTCTGCAGACGCAGGCGGG + Exonic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167065632 19:47183768-47183790 CCCCTCTTGCCGAGGGAAGATGG - Intronic
1167220930 19:48197505-48197527 CGCCTTCTGAAGAGAGAGGGAGG + Exonic
1167495939 19:49818743-49818765 CTCCTTGTTCTGAGGGAGGAGGG + Intronic
1168182316 19:54670721-54670743 CCCTTTCTGTAGGAGGAGGATGG - Intronic
1168639776 19:58023300-58023322 CCCCTGCTTCACAGGTAGGAAGG + Intergenic
925173406 2:1766590-1766612 CCCAGCCTGCAGAGGGAGCAGGG + Intergenic
925177856 2:1797806-1797828 CCCCTTCCGCAGAGAGTGGCAGG + Intronic
925253888 2:2465733-2465755 CCACTTTTGCAAAGGCAGGAAGG - Intergenic
925277596 2:2661502-2661524 AGCCTCATGCAGAGGGAGGACGG + Intergenic
925814578 2:7735200-7735222 CCCCTTCTGCAGGGGGCAGGTGG + Intergenic
926645227 2:15283508-15283530 CACCTTCTTCACAGGGAGGCAGG - Intronic
927183951 2:20468721-20468743 GCCCTTCTACAGGGGGAGGAAGG + Intergenic
927216352 2:20669785-20669807 CCCCTTCGGCAGAGCGAAGTTGG + Intronic
927318917 2:21720109-21720131 CCCCTTCTGCAGAAGGGAGCTGG - Intergenic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
927715913 2:25352734-25352756 CTGCTTCTCCAGAGGGAAGAGGG + Intergenic
927758124 2:25725109-25725131 CCCCTTCTCAGGAGGGAGGTGGG + Intergenic
928361451 2:30665174-30665196 CCCCTCCAGCAGATGGTGGAGGG + Intergenic
928886687 2:36157289-36157311 CCCTTTCTGCCAAGTGAGGAAGG - Intergenic
929820393 2:45268942-45268964 CCCCCTTTGCAGGGTGAGGATGG - Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930253400 2:49061037-49061059 CCCCTTCTTCTGAGGGATCAAGG + Intronic
931462367 2:62460290-62460312 CAACTGCTGCAAAGGGAGGAGGG - Intergenic
931665523 2:64607617-64607639 CCCTTTCTGCAGAGGGACAAAGG + Intergenic
932124688 2:69133106-69133128 CCCCTTCTGCAAAGCGAAGCTGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932309656 2:70729304-70729326 ACCCTGAGGCAGAGGGAGGAAGG - Intronic
933089534 2:78103971-78103993 CCCCTTCTGCTGGTGGAGGGTGG - Intergenic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
936025211 2:109026501-109026523 CCCTTGCTTCAGAGGGAAGAGGG - Intergenic
936937247 2:117850207-117850229 CCCCTCCTGATGAGGGAGGGAGG + Intergenic
937274085 2:120673126-120673148 TCCCTTCTGCAGAGAAAGGCAGG - Intergenic
938058446 2:128233776-128233798 CCACCTTTGCACAGGGAGGAAGG - Intergenic
938467075 2:131531223-131531245 CACCTTCTGCAGAGTGAGCCGGG + Intronic
939095713 2:137831126-137831148 CCACTTCTGCACATGGACGATGG - Intergenic
940218818 2:151329190-151329212 AGCCTTCTGCAGAAGAAGGAGGG - Intergenic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
943283104 2:185963207-185963229 TCCCCCATGCAGAGGGAGGAAGG + Intergenic
943807617 2:192141681-192141703 CCCCATCTTTAGAGGCAGGAAGG + Intronic
944132021 2:196357218-196357240 CTCTGTCTGCACAGGGAGGATGG - Intronic
945041457 2:205746557-205746579 CCAGCTCTGCTGAGGGAGGAGGG - Intronic
945306571 2:208265075-208265097 CCCCTTCCTCAGAGAGATGAGGG + Intronic
946335297 2:219031653-219031675 CTCCTTCTGCAGTGTGAGGCGGG + Exonic
947034569 2:225837664-225837686 CCCCTTCTCGTGAGTGAGGATGG - Intergenic
948017891 2:234704957-234704979 CAGCTTCTGCAGAGGGGGCAGGG + Intergenic
948137246 2:235645680-235645702 CCCTTCCTGCAGAGGGAGGTGGG + Intronic
948379389 2:237542138-237542160 CCCCAGCTGCTGTGGGAGGAGGG + Intronic
948442589 2:238004885-238004907 CTCCCTCTGGAGATGGAGGAAGG + Intronic
948469459 2:238167820-238167842 CCACCTCTGGAGAGGGTGGAAGG - Intronic
948529229 2:238593460-238593482 CCCCGGCTGCTGGGGGAGGAGGG - Intergenic
948602764 2:239116686-239116708 GCTCTTCAGCAGAGGCAGGATGG - Intronic
948672814 2:239579350-239579372 CGCCCTCTGCAGAGGGACGAGGG + Intronic
948952862 2:241265814-241265836 CCCTTTCTAGAGAGGGAAGACGG - Intronic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1168895472 20:1320737-1320759 GCACTGCTCCAGAGGGAGGAGGG + Intronic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1170905244 20:20509530-20509552 CCCCTTCTGCAGAGGGAATCAGG + Intronic
1171035267 20:21708538-21708560 CCCCTGCAGGAGAGAGAGGACGG - Exonic
1172107745 20:32526936-32526958 GCCCCTCTGCAGGGTGAGGAGGG + Intronic
1172124466 20:32617083-32617105 TCCCTACTGCAGGGAGAGGAGGG + Intergenic
1172149383 20:32779694-32779716 CCCCAGCTGGTGAGGGAGGAGGG + Intronic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1172406023 20:34689897-34689919 CCCCTTCTGCAGAATCTGGATGG - Intergenic
1172714321 20:36951548-36951570 CCCCTTCCGCAGAGGCAGACTGG - Exonic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173526366 20:43735917-43735939 CCCCTGCTGAAGGGGCAGGAGGG - Intergenic
1173758584 20:45539684-45539706 CCCCTTCTGCTAAGGGAGCCTGG - Intronic
1173871289 20:46343729-46343751 AGCCTTCTGCAGGGGGAGGTGGG - Intergenic
1174064165 20:47852746-47852768 CCCTGTCTACAGAGGGAGGAGGG + Intergenic
1174170719 20:48616640-48616662 CCCGTGCTGCAGTGGGAGCAGGG - Intergenic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1174330714 20:49815103-49815125 CCCTGTCTGCACGGGGAGGATGG - Exonic
1175296820 20:57914202-57914224 TCACCTCTGCAGAGGGATGATGG - Intergenic
1175696407 20:61106137-61106159 CCCCTCCTGCAGTGGGCAGAAGG - Intergenic
1175875800 20:62228628-62228650 CCCCGTGTGCTGGGGGAGGAAGG + Intergenic
1176192441 20:63818421-63818443 TCAGTTCTGCAGAGGGAGGGTGG + Intronic
1176243143 20:64084223-64084245 CCCGCCCTGCGGAGGGAGGAGGG + Exonic
1176851778 21:13923786-13923808 TCCCTACGGCTGAGGGAGGAAGG + Intergenic
1177292177 21:19127953-19127975 GCTCTTCAGAAGAGGGAGGAGGG + Intergenic
1179169188 21:38959544-38959566 ACTCTTCTTCAGAGGGAGCAGGG + Intergenic
1179450539 21:41465674-41465696 CCCCTTGTGGAGAGGTAGGCTGG + Exonic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1180057921 21:45368572-45368594 CTTATTCTGCACAGGGAGGACGG + Intergenic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1181628940 22:24140372-24140394 TCCCCTCTGCTCAGGGAGGACGG - Intronic
1181636043 22:24175362-24175384 CCCCTGCTGGAGAGGATGGAGGG + Intronic
1181851051 22:25750224-25750246 CGCCTTTGGGAGAGGGAGGAAGG + Intronic
1183079341 22:35446652-35446674 GCCCGTCCGCAGTGGGAGGAAGG + Intergenic
1183273298 22:36875519-36875541 CTTCTTCTGTAGAGGGAGGAGGG - Intronic
1183389710 22:37538579-37538601 CCTCTTCTGTAAAGGGGGGAAGG - Intergenic
1183499573 22:38170424-38170446 CACCTTCTGCAGGGGCAGGTGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183931103 22:41236723-41236745 TCTCTTCTGCTGAGGGAAGATGG - Intronic
1184337476 22:43862277-43862299 GCCCTTCTGCCGCGGGAAGATGG - Exonic
1184549587 22:45197370-45197392 CCCAGTCTGCAGGGTGAGGATGG - Intronic
1184553116 22:45216078-45216100 CTCTCTCTTCAGAGGGAGGAAGG + Intronic
1184674949 22:46036458-46036480 CCCCTTCTGCACAGGGAGGAAGG + Intergenic
1184735447 22:46395193-46395215 CCACTGCTGCAGGGGGATGAAGG - Intronic
1184746268 22:46458037-46458059 CATCTAGTGCAGAGGGAGGAAGG + Intronic
1184935392 22:47716851-47716873 GCCCGTGTGCAGAAGGAGGAAGG + Intergenic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
1185196125 22:49470591-49470613 CCCCAACTGCGGAAGGAGGACGG + Intronic
949893739 3:8753502-8753524 CAGCTTCTGCTGAGGGAGGTAGG - Intronic
950554513 3:13687146-13687168 CTCCTTGTGTGGAGGGAGGACGG + Intergenic
952733154 3:36661097-36661119 TCCCTTTTCCAGATGGAGGAGGG + Intergenic
953199068 3:40761565-40761587 CCTCTTCTGGAGAGGGATGAAGG - Intergenic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
958998876 3:100938845-100938867 CCCCTCCTGCAGTGGTATGATGG + Intronic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
959574632 3:107921311-107921333 CCCCGGGTGCAGAGGCAGGATGG - Intergenic
959804269 3:110532167-110532189 TCCATTATGCAGATGGAGGAAGG - Intergenic
960721244 3:120626405-120626427 CTCTTTCTTCAGAGGAAGGAAGG - Intergenic
961308329 3:125975468-125975490 CCCCTTCTTCTGAGGGAAGGAGG - Intronic
961623207 3:128240682-128240704 CCCATTCTGCAGAGAGAGCAAGG - Intronic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
962070456 3:132028492-132028514 ACCCTTCTGCTGAGGGGGAAGGG + Intronic
962148712 3:132869949-132869971 CCCATACCTCAGAGGGAGGATGG - Intergenic
962434820 3:135356790-135356812 CTCCTTGGGCAGAAGGAGGAAGG - Intergenic
963541675 3:146598773-146598795 TCCTTTCTGCAGATGGAAGATGG + Intronic
965416366 3:168398687-168398709 TCCTTTTTGCAGAGGGAGTAAGG + Intergenic
966119409 3:176505927-176505949 TCCCTTGTACAGAGGGAGGAGGG + Intergenic
966120633 3:176515254-176515276 TCCCTCATACAGAGGGAGGAGGG + Intergenic
966878165 3:184335377-184335399 CACCTTCTCTAGAGGGAGCAGGG - Intronic
968332928 3:197887097-197887119 AACCCTCTGCAGAGGTAGGAAGG + Intronic
968648202 4:1750166-1750188 CCCACTCTGCAGAGAGAGGAGGG + Intergenic
969122324 4:4919524-4919546 TCCCGTCTGCACAGGGAGGCAGG - Intergenic
969355864 4:6625260-6625282 CCCCTTCTGCCATGTGAGGACGG - Intergenic
971026526 4:22594216-22594238 CCTGTTCTGGAGAGGGATGAAGG - Intergenic
972909435 4:43796849-43796871 ACCCTTCTGCAGTGGCAGCATGG + Intergenic
973384388 4:49495486-49495508 TCCCTACGGCTGAGGGAGGAAGG + Intergenic
974223243 4:59003465-59003487 TCCCCCATGCAGAGGGAGGAGGG - Intergenic
976409488 4:84696764-84696786 CCCCTTTTGCCCAGGGTGGAAGG + Exonic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
978258234 4:106718553-106718575 CCTCTTCTCAAGAGGAAGGAAGG - Intergenic
980292972 4:130869526-130869548 CCCCACGTGCTGAGGGAGGAAGG + Intergenic
980778719 4:137468969-137468991 GCCCTCCTGTAAAGGGAGGAGGG + Intergenic
981509003 4:145534305-145534327 GCCCTTCTGAAGATGTAGGAAGG - Intronic
981555391 4:145988001-145988023 ACTCTTCTGGGGAGGGAGGAAGG - Intergenic
981573530 4:146178392-146178414 CCCCTGCTGCCGAGGAAGGAGGG + Intronic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984791567 4:183619579-183619601 CCCCTCCTGCAGGGGGAGGGGGG + Intergenic
986399901 5:7370558-7370580 CCCTATCTGCTAAGGGAGGAGGG - Intergenic
987088146 5:14488052-14488074 CCCCTTCTGCAGGGGGCTGCTGG - Exonic
988018767 5:25596555-25596577 CACCTTCTTCATAGGGAGGCAGG + Intergenic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
988536441 5:32073383-32073405 CCCTTTCTGCAGATGAAGGAAGG + Intronic
989558113 5:42820443-42820465 CCCCTTGTGCACTGGGAGAATGG - Intronic
989720804 5:44525806-44525828 ACCCTTCTGCTTATGGAGGAAGG - Intergenic
990304680 5:54482518-54482540 CCCCTCCTACAGATGTAGGAGGG - Intergenic
991718019 5:69469903-69469925 CCTATTCTGGAGAGGGATGAAGG - Intergenic
994944829 5:106374001-106374023 CGCTCTCTGCAGATGGAGGATGG - Intergenic
995444567 5:112228437-112228459 CCCCTTCCACAGAGGCAGAATGG + Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
997520670 5:134523021-134523043 ACCTTTCTGAAAAGGGAGGAAGG + Intergenic
997599655 5:135130635-135130657 CCCTTGCTCCAGAGGGAGGTTGG - Intronic
998548907 5:143057625-143057647 CCAGTTCTGCAAAGGAAGGAGGG - Exonic
999136398 5:149322737-149322759 CCCCTGCTGACTAGGGAGGAAGG + Intronic
999926139 5:156380392-156380414 CCCCTTCTGTTGTAGGAGGAAGG - Intronic
1001278994 5:170372453-170372475 CAACCTCTGCAGAGGGAAGAGGG - Intronic
1001308023 5:170589977-170589999 CCCATTTTGCAGAGGGGGAAAGG - Intronic
1001448839 5:171808390-171808412 CCACCTCTGCAGAGGGATGCGGG + Intergenic
1002782000 6:374122-374144 CTCCTTCTGCTGAGGGATGAGGG + Intergenic
1004190754 6:13461553-13461575 ACCCTGCTGCGGAGGGTGGAAGG - Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1006211896 6:32402954-32402976 CCCCTTCTCCTCAGTGAGGACGG + Exonic
1006788344 6:36682768-36682790 CCCCTTCAGGAGAGGGAAAACGG - Intronic
1007687141 6:43673660-43673682 CCCCTTCAGGAGAGGTAGGAAGG - Intronic
1007810561 6:44482836-44482858 CCTCTTCAGCAGCGGGAGGAAGG + Intergenic
1007988950 6:46234908-46234930 CCCATTCTCAGGAGGGAGGAGGG + Intronic
1008014815 6:46506533-46506555 CACCTCCTGCAAATGGAGGAAGG - Intergenic
1008564234 6:52751574-52751596 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008568548 6:52792853-52792875 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008569921 6:52806619-52806641 CACCTTCAGCAGAGGGAAGTTGG + Intergenic
1008573003 6:52832856-52832878 CACCTTCAGCAGAGGGAAGCTGG + Exonic
1008577382 6:52874066-52874088 CACCTTCAGCAGAGGGAAGCTGG + Intronic
1008579961 6:52897822-52897844 CACCTTCAGCAGAGGGAAGTTGG + Exonic
1010241321 6:73618363-73618385 CCTCTTCTGGAGAGGGATGAAGG - Intronic
1016498477 6:144690671-144690693 CCCAGTCTCCAGAGGGATGAAGG - Intronic
1016989920 6:149922011-149922033 CCCTTTCTAGAAAGGGAGGAAGG - Intronic
1017005203 6:150024473-150024495 CCCTTTCTAGAAAGGGAGGAAGG - Intronic
1017032208 6:150234130-150234152 GCCCTGCTGCAGAGGGAAGTAGG + Intronic
1018512487 6:164540452-164540474 CCCCTGCTCTAGAGGGAGCATGG - Intergenic
1018625512 6:165774670-165774692 CTGCTTCTGGAGAGGGAGGAAGG + Intronic
1018683199 6:166281859-166281881 CCCCAGGTGCAGAGGCAGGAGGG - Intergenic
1018827495 6:167420921-167420943 CCCCTTCCACAGAGGTGGGAGGG - Intergenic
1018982673 6:168612645-168612667 CCCCTTCTGCTGAGTGAGAGGGG + Intronic
1019102856 6:169646221-169646243 CCTCTTCTGTTAAGGGAGGATGG - Intronic
1019367595 7:642960-642982 CCCCTTCTGTAAAGGATGGATGG + Intronic
1019427975 7:986363-986385 TCCATCCTGGAGAGGGAGGAGGG - Intronic
1019501417 7:1366706-1366728 CCCATTCTACAGAGGAAGAACGG + Intergenic
1019531083 7:1503872-1503894 CCCGGGCTGCAGAGCGAGGAGGG + Intronic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019631913 7:2053982-2054004 ACCCTTCTGCAGAGGGAGGCAGG + Intronic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1022942480 7:35253982-35254004 CCCCAGCCCCAGAGGGAGGAAGG - Exonic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1024532791 7:50407194-50407216 CCAGTGCTGCAGAGGCAGGATGG + Intergenic
1025606098 7:63041142-63041164 ACCTTGCTGCTGAGGGAGGACGG + Intergenic
1026116023 7:67496329-67496351 CCCCTTAGTCAGAGGGAGAAGGG - Intergenic
1026542476 7:71292129-71292151 CCCCTTCTGCAGTGGGATTCCGG + Intronic
1026869577 7:73842210-73842232 CCTCCTCTGAAGGGGGAGGAGGG - Intronic
1027001380 7:74657198-74657220 CCCCTTTTGCAGAGCAAGGAGGG + Intergenic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1028692563 7:93670035-93670057 TCTCTTCTGGAGAGGGATGAAGG + Intronic
1028916553 7:96265900-96265922 CCCCTTCTGCCATGTGAGGATGG - Intronic
1029490366 7:100867238-100867260 CCCCTCCTGCCGAGAGGGGAGGG - Exonic
1030679106 7:112415626-112415648 CCTCTACTGCAGAGGGACTAGGG - Intergenic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1032488575 7:132306837-132306859 CCCTTTCTGCAGAATGAGAAAGG - Intronic
1033351204 7:140563585-140563607 GCCTTTCTACAGAGGGAGCAAGG + Intronic
1034098930 7:148435502-148435524 CGGCTCCTGCAGAGGGAGGGAGG - Intergenic
1035847666 8:2882662-2882684 CCCACTCAGCAGAAGGAGGATGG - Intergenic
1036588884 8:10149556-10149578 CCCTTTTTGCAGAGAGAGAAGGG + Intronic
1036778849 8:11631810-11631832 ACCTTGCTGCTGAGGGAGGACGG - Intergenic
1037358959 8:18053445-18053467 GCCCTGCTGCAGAGGTGGGAGGG - Intergenic
1037670806 8:21013610-21013632 CACCTTATCCAGAGGAAGGAGGG - Intergenic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1039877859 8:41602887-41602909 CTCCTGCGGCAGAGGGATGAGGG + Intronic
1039920707 8:41892314-41892336 CTCCTCCTGCTGAGAGAGGAAGG + Intronic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1042118588 8:65459500-65459522 CCCCTATTATAGAGGGAGGATGG - Intergenic
1042387210 8:68190592-68190614 CCACTTGTGGAGAGGTAGGAAGG + Intronic
1042788466 8:72576585-72576607 GTCCTGCTGCAGAGGGAGAAAGG - Intronic
1042820091 8:72921014-72921036 CCCTTTTTGCAGAGCGCGGAAGG + Intronic
1044068605 8:87727428-87727450 CCCCCTGTGTTGAGGGAGGAAGG + Intergenic
1044666837 8:94640844-94640866 CCGCTTCGGGAGGGGGAGGAAGG - Intergenic
1045508532 8:102795423-102795445 CCCCTTTTTGTGAGGGAGGAGGG - Intergenic
1046518078 8:115289026-115289048 CCCATTTTACATAGGGAGGAGGG + Intergenic
1047486364 8:125334561-125334583 CCCCTCCAGCAGGGGGAGGTGGG - Intronic
1048069125 8:131003515-131003537 CCCCTTCTGAAGAGGTTGGCAGG - Intronic
1048243607 8:132768779-132768801 CCCCTTCTGCAGGAGGGAGAGGG - Intergenic
1048432380 8:134382237-134382259 TGCCTGCTGCAGAGGAAGGAAGG - Intergenic
1048791934 8:138112355-138112377 TGCCTTATGCTGAGGGAGGAGGG - Intergenic
1049400850 8:142426586-142426608 CCCATCCTGCAGAGGGGGAAGGG - Intergenic
1049755602 8:144310085-144310107 CCCCTTCTGCACATGGAAAACGG - Intronic
1051411320 9:16792565-16792587 CCCCTTCTGCAGACTGGGAATGG - Intronic
1051618729 9:19031094-19031116 ACCCTACTGCAGGGGCAGGAGGG + Intronic
1055145667 9:72931693-72931715 CCTCTTGTGCAGAGGGAACAGGG + Intronic
1056707610 9:88965416-88965438 CCCCTTCAGCAGTGGGAGGCAGG + Intergenic
1057847908 9:98539545-98539567 CCCCTTCTACAAAATGAGGAGGG + Intronic
1058717868 9:107738660-107738682 CCCTGCCTGCCGAGGGAGGATGG + Intergenic
1058836688 9:108863601-108863623 CACCTTCTGTAGAGGAAGAAAGG - Exonic
1059689642 9:116672669-116672691 CCCATTTTGCAGAGGAGGGAAGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060173325 9:121479279-121479301 TCCCTTCTGCAGAAGGAGGCAGG + Intergenic
1060750079 9:126163160-126163182 CAGCTTCTGGAAAGGGAGGAGGG - Intergenic
1061521427 9:131120546-131120568 GCCCTTCTGCACAGGGAGCGGGG - Exonic
1061646269 9:132004611-132004633 CCCTTCCTGCAGAGTGAGGATGG - Intronic
1062247506 9:135576725-135576747 CCCCTTCTGCTGACGGATGTGGG + Intergenic
1062434875 9:136542509-136542531 CGGCTTCTGCAGAGGGAGAAGGG + Intronic
1062452624 9:136621913-136621935 CATCTGCTGCAGAGGAAGGAAGG - Intergenic
1062633780 9:137479168-137479190 ATCCTGCTGCACAGGGAGGAGGG - Exonic
1185747190 X:2583246-2583268 CCCCTGCTCCAGAGGGGAGAGGG - Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1187764900 X:22630671-22630693 CCCTGTCAGCAGAGGGAGAAGGG - Intergenic
1187916093 X:24153345-24153367 CCCCTGCGGCAAAAGGAGGAAGG - Intronic
1188077508 X:25796874-25796896 CCCCTTAAGCAGAGGGACGTTGG - Intergenic
1188270893 X:28139417-28139439 CTCCTCCTGCAGAGGAAGGGAGG + Intergenic
1190124489 X:47691818-47691840 CACCTTCTTCACAGGGAGGCAGG + Intergenic
1192416643 X:70987054-70987076 CACCTTCTGCACAGGGTGGCAGG + Intergenic
1192841126 X:74857253-74857275 CCTCTCCTGAAGAGGAAGGAAGG - Intronic
1192849813 X:74942829-74942851 CCCCATCTGGTGAGGGGGGATGG + Intergenic
1194438212 X:93895136-93895158 CCACTGCTGCAGGGGGATGAAGG + Intergenic
1195626904 X:107013228-107013250 CACCTACTGAAGAGAGAGGAAGG - Intergenic
1195955917 X:110330328-110330350 CCCCTTCTTCCAAGAGAGGAGGG - Intronic
1197630491 X:128852612-128852634 CCCCATCTGCCCAGGGAGCAAGG + Intergenic
1198862661 X:141087819-141087841 CCACTGCTGCTGAGGGATGAGGG - Intergenic
1198900033 X:141499567-141499589 CCACTGCTGCTGAGGGATGAGGG + Intergenic
1200138165 X:153884979-153885001 CCCCTTCTCCAGAAGGAGTGGGG - Intronic