ID: 1127966544

View in Genome Browser
Species Human (GRCh38)
Location 15:63926889-63926911
Sequence CTGGCCAAAAGCTTCCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127966542_1127966544 -8 Left 1127966542 15:63926874-63926896 CCTTGCCACATCTGACTGGCCAA 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1127966544 15:63926889-63926911 CTGGCCAAAAGCTTCCTTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 138
1127966539_1127966544 14 Left 1127966539 15:63926852-63926874 CCTTGGACTCTTCTTTCTATTCC 0: 1
1: 0
2: 8
3: 39
4: 389
Right 1127966544 15:63926889-63926911 CTGGCCAAAAGCTTCCTTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 138
1127966541_1127966544 -7 Left 1127966541 15:63926873-63926895 CCCTTGCCACATCTGACTGGCCA 0: 1
1: 0
2: 2
3: 20
4: 201
Right 1127966544 15:63926889-63926911 CTGGCCAAAAGCTTCCTTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127966544 Original CRISPR CTGGCCAAAAGCTTCCTTGT TGG Intronic
900605390 1:3521449-3521471 CTGGCCAAGGGCTGCCCTGTGGG - Intronic
901884849 1:12215556-12215578 CTGCCCAAATGCTGCCTTTTTGG + Intergenic
904589661 1:31604887-31604909 CTGGCCTAAAACTTTCTTGATGG - Intergenic
906686146 1:47764661-47764683 CCGGCCAAAAGGTTTCTTGGTGG + Exonic
908757366 1:67481165-67481187 CTGGCCAAAAGCATTGTTATTGG - Intergenic
908789713 1:67769672-67769694 CAGGTCAAAAGTTTCCCTGTGGG + Intronic
909668972 1:78166878-78166900 TTGGCCAAGAGCTTCATTGTTGG - Intergenic
914426412 1:147581188-147581210 CTGGGAAAAGGCTTCCTTATTGG + Intronic
915351278 1:155227863-155227885 GTGCCCAAAAGCTGCCCTGTGGG + Intergenic
921368399 1:214397087-214397109 CTAACCAAAAGCTTCCTGGTAGG - Intronic
923256664 1:232227375-232227397 CTGCCCAAAAGCTGTATTGTTGG + Intergenic
924717220 1:246587712-246587734 CAGGTCAAAAGCCTCATTGTGGG - Intronic
1065117793 10:22499078-22499100 CTGGCCACAAGATTCTGTGTAGG - Intergenic
1067228312 10:44389595-44389617 CTGCCCAAAGACTTCCTTGCTGG + Intergenic
1070104039 10:73414903-73414925 CTACCCAAAAGCTTCCTCATGGG + Intergenic
1070497344 10:77036444-77036466 CTGGCAAAATGCTCCCTTGCAGG - Intronic
1072201304 10:93161324-93161346 CTGACCAAAAGATTCCTCTTTGG - Intergenic
1073230642 10:101966635-101966657 CTGCAAAAAAGGTTCCTTGTGGG - Intronic
1073900109 10:108210903-108210925 CTGGCCAAAAATTTCATTTTTGG - Intergenic
1074015282 10:109528306-109528328 CTGGCCAAAGGCTTCATTTCAGG + Intergenic
1076042040 10:127258661-127258683 CTGGACAAATGCTGGCTTGTTGG + Intronic
1077455459 11:2675848-2675870 CTGGCCAACACCTGCCTTCTGGG + Intronic
1078473749 11:11612774-11612796 CTGGCCACAAGCCTCCTTGTAGG + Intronic
1079138544 11:17792174-17792196 CTGGCCAAAAGCTTGGGTTTAGG + Intronic
1080875876 11:36273912-36273934 CTGGCCAAAAGCTTCAACTTGGG + Exonic
1081876128 11:46409586-46409608 TTGGCCAGAACCTTCCTTGTAGG - Intronic
1081966792 11:47174985-47175007 CTGGGAAAACGGTTCCTTGTGGG + Intronic
1084119744 11:67062190-67062212 CTGGCCACCAGCTTCCCTGGTGG + Intronic
1086013322 11:82132827-82132849 CTGGCCAAACTCTTCATTTTAGG + Intergenic
1088741140 11:112768267-112768289 CTGGCCAAAATCTGGTTTGTGGG - Intergenic
1091642311 12:2246734-2246756 CAGGAGAAAAGCTTCCTTGCTGG - Intronic
1099388085 12:82042881-82042903 ATGGCCATAAACTTCCTTCTTGG - Intergenic
1100659846 12:96685268-96685290 CTAGCTAACAGCTTCCTTGTGGG + Intronic
1107600472 13:42007243-42007265 TTGGCCAAAAGTCTCCTTGTCGG - Intergenic
1110746622 13:79061238-79061260 CAGGCCAAAAGCTTCCCTTTAGG - Intergenic
1111097112 13:83531325-83531347 CTGGAGAAAGGCTTGCTTGTTGG - Intergenic
1112487590 13:99834125-99834147 CTGGCCAGAAGGTTACCTGTGGG - Intronic
1113824932 13:113244984-113245006 TTGGCAAAAAGACTCCTTGTTGG + Exonic
1118879808 14:69816422-69816444 TTGGCCAATGGCTTCCATGTGGG - Intergenic
1119946301 14:78698441-78698463 ATGGCCAAAGGCCTCATTGTTGG + Intronic
1202834533 14_GL000009v2_random:67962-67984 CTGGCAAAAATCTTCCTTTAGGG + Intergenic
1127841881 15:62838905-62838927 TTTGCCAAAAGCTGCCTTCTGGG - Exonic
1127966544 15:63926889-63926911 CTGGCCAAAAGCTTCCTTGTTGG + Intronic
1128443726 15:67738346-67738368 CTGGCCAAAGGCCTCCTTCCAGG + Intronic
1128864134 15:71100489-71100511 CTGGCCAACACCTTGGTTGTAGG + Intronic
1131081239 15:89537875-89537897 CTGGCCCATAGCTTGCTTTTAGG - Intergenic
1131220740 15:90581996-90582018 CTGGCCAAAGGCACCCTTGGAGG - Intronic
1131274376 15:90968704-90968726 CAGGCCAAGAGCCTCATTGTAGG + Intronic
1133493980 16:6298624-6298646 TTGACCAAAACCTTCCTTCTGGG + Intronic
1137601971 16:49762399-49762421 CTGGCCACAGGCTTCTGTGTGGG - Intronic
1137935569 16:52631981-52632003 TTGGCCAAAAGGTTTCATGTTGG + Intergenic
1141871242 16:86788255-86788277 ATGGGCACAAGTTTCCTTGTGGG - Intergenic
1142057557 16:88008128-88008150 CTGGGCAAAAGCTACAATGTGGG - Intronic
1142675667 17:1511790-1511812 GTGGCCTAAAGCTGCTTTGTGGG - Intronic
1144364528 17:14529418-14529440 CTGGCCATATGCTTCCTTTCTGG - Intergenic
1144684483 17:17216800-17216822 CTTGGTAAAAGCTTCTTTGTGGG - Intronic
1145856826 17:28167551-28167573 CTGGCCAAATGCATACTTGTAGG - Intronic
1146676921 17:34780114-34780136 CAGGCCCAATGCTGCCTTGTGGG - Intergenic
1147639796 17:41989357-41989379 CTGGGAAAGAGCTTCCTTTTGGG - Intronic
1164118653 19:22245950-22245972 TAAGCCAAAAGGTTCCTTGTGGG + Intergenic
1165018430 19:32901919-32901941 CTGGCCACAAACTTCTTTGATGG + Intronic
1202638161 1_KI270706v1_random:59730-59752 CTGGCAAAAATCTTCCTTTAGGG - Intergenic
927414856 2:22868442-22868464 CTGTGCAAAAGCTTCTTTGGTGG - Intergenic
927877995 2:26671400-26671422 CTGGGCAACAGTTTCCTTGTTGG + Intergenic
928424756 2:31168783-31168805 CTGGCCAAGAGATCCCTTCTGGG + Intergenic
931981088 2:67694871-67694893 CTGGCCACAGGCCTCCTTCTTGG - Intergenic
940391219 2:153134717-153134739 CTGGCACAAAGCTTCCCTGGAGG - Intergenic
940811681 2:158250381-158250403 ATTGCCAAAAACATCCTTGTTGG - Intronic
940967956 2:159861449-159861471 CTGGCCAAAAGTATCCTTATTGG - Intronic
941823150 2:169863005-169863027 CTTGCCAAAGGCTTACTTGTAGG + Intronic
946247979 2:218398114-218398136 CTCGCCACACGCTTCCTTTTGGG + Intergenic
949073257 2:242039336-242039358 CTGATCAAAGGCTTCCCTGTAGG - Intergenic
1170552120 20:17487199-17487221 TTGGCCCAAAGCCTCCTGGTTGG - Intergenic
1172046591 20:32084753-32084775 GTGGTCAAAAACTTCCTTCTGGG + Intronic
1172157278 20:32836585-32836607 CTTGCCAAAAGCCTCTTTTTTGG + Intronic
1179105312 21:38395172-38395194 CTGGTCCAATGCTTCCTTATCGG + Intronic
1180363806 22:11922149-11922171 CTGGCAAAAATCTTCCTTTAGGG + Intergenic
1181307168 22:21923335-21923357 CAGGCCAACAACTTCCTGGTGGG + Exonic
1183955233 22:41376097-41376119 CTGGCCAAAGGCTCCTGTGTTGG + Intronic
1185122260 22:48978702-48978724 CTGGCCAAAACCTTCGTTTAAGG - Intergenic
1185279681 22:49964735-49964757 CTGGCCACAATGTTCCTGGTGGG + Intergenic
951065632 3:18261966-18261988 ATGGCCAACATCTTCCTTGCTGG - Intronic
952622962 3:35368053-35368075 ATGGACAAAAGCATCCTTGCAGG - Intergenic
954197756 3:49006548-49006570 CAGACCTAAAGCTTCCTTGGAGG - Intronic
954613365 3:51957708-51957730 CTGGCCTACTGCATCCTTGTGGG - Exonic
955092173 3:55763373-55763395 ATGGCCATTTGCTTCCTTGTTGG - Intronic
955969517 3:64424028-64424050 CTTGCCAAAATCTTCTTGGTTGG + Intronic
956577885 3:70775380-70775402 CCGGCCAAATCCTTCCTTTTTGG - Intergenic
959000290 3:100956484-100956506 CTGGTCAATTGCTTCCTTGCAGG - Intronic
963103294 3:141625078-141625100 CTGGGCCATACCTTCCTTGTTGG - Intergenic
963471759 3:145750096-145750118 CTGGACAAAAGGTTTTTTGTTGG - Intergenic
963612517 3:147488476-147488498 CAGGCCAGATGATTCCTTGTCGG - Intronic
965765869 3:172129267-172129289 CTGGCCAGAAGCTTTTTTGATGG + Intronic
967425056 3:189317344-189317366 CTGGCAACAAGCTTCCTTTATGG + Intronic
967863009 3:194166992-194167014 GGGGCCAACAGCGTCCTTGTGGG + Intergenic
970471885 4:16387149-16387171 CTGAGCATAAGCATCCTTGTTGG + Intergenic
972713307 4:41620486-41620508 CTGGCCAAATGAATCCTGGTTGG + Intronic
973368384 4:49226077-49226099 CTGGCAAAAATCTTCCTTTAGGG - Intergenic
973392663 4:49569348-49569370 CTGGCAAAAATCTTCCTTTAGGG + Intergenic
974249889 4:59372074-59372096 CTGGAGCAAAGCTTCTTTGTGGG - Intergenic
974476628 4:62389726-62389748 CTGGCCAAAGAATTCCTTGGGGG + Intergenic
979916435 4:126440483-126440505 GGGGCCAAAGGCTTCCTTGGTGG - Intergenic
981781565 4:148436470-148436492 CTGGACTCATGCTTCCTTGTTGG + Exonic
1202765491 4_GL000008v2_random:145588-145610 CTGGCAAAAATCTTCCTTTAGGG - Intergenic
991538446 5:67699615-67699637 CTGCTCAAGAGTTTCCTTGTTGG - Intergenic
992202885 5:74401495-74401517 CTCCCCAAGAGCTTCCTTCTGGG + Intergenic
992518963 5:77528400-77528422 CTGGCCTGAAGCTTCCTTGGTGG - Intronic
995629105 5:114113802-114113824 ATGGCCAAAAACTTCCTCGCAGG + Intergenic
997285262 5:132673348-132673370 CTTGCCAAGGGCTTCCTTATGGG + Intergenic
997426380 5:133805380-133805402 ATGGCACAAACCTTCCTTGTGGG - Intergenic
999728447 5:154456705-154456727 CTGATCAGAAACTTCCTTGTTGG - Exonic
1000254530 5:159525303-159525325 CTTGCCAAAATTTTCCTTCTGGG - Intergenic
1000640486 5:163696512-163696534 CTGGCATACAGCTTCCTTCTAGG + Intergenic
1001083888 5:168686597-168686619 CTGGCCAGAATCTTCTTTCTAGG - Intronic
1001734958 5:173989829-173989851 CAGGCCAAAAGCCTCCGTGAGGG - Intronic
1004287451 6:14335050-14335072 CAGGCCAAAATCTGCATTGTGGG - Intergenic
1007190929 6:40017798-40017820 CTGGACAAAAGTGTCCTTGTGGG + Intergenic
1009477787 6:64115424-64115446 ATGGCCAAAAGGATCCTTCTTGG - Intronic
1013017794 6:106176964-106176986 CTGGCCAACTCCTTCCTGGTAGG - Intergenic
1014239637 6:119001052-119001074 ATGGACAAAACCTTCCTTCTTGG - Intronic
1016376457 6:143425837-143425859 ATGGCCAAGAGCTTCAGTGTAGG - Intronic
1018652256 6:166002339-166002361 CACACCAACAGCTTCCTTGTTGG - Intergenic
1020006594 7:4786619-4786641 CTGTCCAAGAACTCCCTTGTGGG + Intronic
1023240876 7:38146295-38146317 CTGGCTAAATGCTCCCTTTTTGG - Intergenic
1025983801 7:66429674-66429696 CTTACCAAAAGCTGCCTTGAGGG + Intergenic
1026031393 7:66797695-66797717 CTTACCAAAAGCTGCCTTGAGGG - Intronic
1027206975 7:76108226-76108248 CTTACCAAAAGCTGCCTTGAGGG + Intergenic
1027251015 7:76398755-76398777 CTGGTTAACATCTTCCTTGTTGG + Exonic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1036634611 8:10540413-10540435 CTGAAGAAAAGCTTCCTGGTTGG + Intronic
1037612277 8:20486324-20486346 CTGGCTATAAGCTACCTTCTGGG + Intergenic
1039588950 8:38730532-38730554 CATGCCAAAAGCTACCTTATAGG - Intronic
1045189086 8:99865640-99865662 CTGGCAAAGTGCTTCCTTGTTGG + Intronic
1047591758 8:126334651-126334673 CTGGCCATAGACTTGCTTGTGGG + Intergenic
1047657169 8:126990733-126990755 CTGGCCCAAATCTTTCTTTTTGG + Intergenic
1049203324 8:141352136-141352158 CTGGCCCACAGCTTTCTGGTGGG + Intergenic
1053663491 9:40300853-40300875 CTGGCAAAAATCTTCCTTTTGGG + Intronic
1053914001 9:42931394-42931416 CTGGCAAAAATCTTCCTTTTGGG + Intergenic
1054375614 9:64447087-64447109 CTGGCAAAAATCTTCCTTTTGGG + Intergenic
1054521123 9:66075432-66075454 CTGGCAAAAATCTTCCTTTTGGG - Intergenic
1056259112 9:84829970-84829992 CTGGGGCAAAGCTTCCCTGTGGG + Intronic
1057985766 9:99712017-99712039 CTGACCAAAAGAATGCTTGTGGG - Intergenic
1060243115 9:121921782-121921804 CTAGCCCAAGGCTTCCTTGCAGG - Intronic
1061402458 9:130375903-130375925 CTGGCCAGCATCTTCCTTCTGGG - Intronic
1203773028 EBV:59013-59035 CTGGTCAAGAGCTTCCTGGCCGG - Intergenic
1203546236 Un_KI270743v1:130478-130500 CTGGCAAAAATCTTCCTTTAGGG - Intergenic
1187018254 X:15351640-15351662 ATGGCCCATAGCTACCTTGTTGG - Intronic
1194294431 X:92110702-92110724 CTGGCCAGGAATTTCCTTGTGGG + Intronic
1195276956 X:103290846-103290868 TTGGTCCAAATCTTCCTTGTTGG + Intergenic
1196613547 X:117741976-117741998 ATGGCCAACAGGTTTCTTGTGGG + Intergenic
1198964252 X:142210659-142210681 CTGGTCAATAGCTTGCTGGTGGG - Intergenic
1198972155 X:142293836-142293858 ATGGCAAAAAATTTCCTTGTAGG + Intergenic
1199010380 X:142751277-142751299 CTGTGCAAAAGCTTGTTTGTTGG - Intergenic
1199021770 X:142887382-142887404 AGGGCCAAAAGCTTCCTATTGGG + Intergenic
1199347543 X:146759688-146759710 CTGGCCAAACTCTTTCTTCTGGG - Intergenic
1200936494 Y:8742934-8742956 TAGAACAAAAGCTTCCTTGTTGG + Intergenic