ID: 1127966891

View in Genome Browser
Species Human (GRCh38)
Location 15:63929330-63929352
Sequence GCATCCAGGGGAGCAGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127966891_1127966895 -2 Left 1127966891 15:63929330-63929352 CCTGAGGCTGCTCCCCTGGATGC 0: 1
1: 0
2: 0
3: 40
4: 247
Right 1127966895 15:63929351-63929373 GCCTATTCAACCTCAATGCCAGG 0: 1
1: 0
2: 1
3: 7
4: 73
1127966891_1127966898 7 Left 1127966891 15:63929330-63929352 CCTGAGGCTGCTCCCCTGGATGC 0: 1
1: 0
2: 0
3: 40
4: 247
Right 1127966898 15:63929360-63929382 ACCTCAATGCCAGGGTCAGATGG 0: 1
1: 0
2: 2
3: 18
4: 142
1127966891_1127966901 16 Left 1127966891 15:63929330-63929352 CCTGAGGCTGCTCCCCTGGATGC 0: 1
1: 0
2: 0
3: 40
4: 247
Right 1127966901 15:63929369-63929391 CCAGGGTCAGATGGATGAAATGG 0: 1
1: 0
2: 2
3: 26
4: 254
1127966891_1127966897 -1 Left 1127966891 15:63929330-63929352 CCTGAGGCTGCTCCCCTGGATGC 0: 1
1: 0
2: 0
3: 40
4: 247
Right 1127966897 15:63929352-63929374 CCTATTCAACCTCAATGCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127966891 Original CRISPR GCATCCAGGGGAGCAGCCTC AGG (reversed) Intronic
900207179 1:1436539-1436561 GCTTTCAGAGGAGCAGCCTGAGG - Intronic
900323303 1:2095497-2095519 GCATCCACGGGAGGAGGGTCTGG - Intronic
900459084 1:2791735-2791757 GCAGCCAGGGGAGAACCCTTGGG + Intronic
900624173 1:3600631-3600653 GAATCCAGCTGTGCAGCCTCGGG - Intronic
901654239 1:10760217-10760239 GCTTACAGCAGAGCAGCCTCTGG + Intronic
901773903 1:11545985-11546007 TCATCCTGGGAAGCTGCCTCTGG + Intergenic
902214029 1:14923725-14923747 GCGGGCAGGGGAGCAGCCCCGGG - Intronic
902513648 1:16979021-16979043 GGATCCAGAGGAGCCCCCTCAGG - Intronic
906669429 1:47643834-47643856 TCCTCCTGGGAAGCAGCCTCAGG - Intergenic
908260535 1:62336764-62336786 GCTCCCAGGGGAGGAGCCTGGGG - Intergenic
909931654 1:81504624-81504646 GCATGCAGGGGAGACGACTCAGG + Intronic
911684999 1:100765428-100765450 GCATCCAGGGGACAAGCCAAAGG + Intergenic
912474904 1:109929040-109929062 GCAGCATGGGGAGCATCCTCTGG - Exonic
912498638 1:110107320-110107342 GCAGGCAGGGGAGCAGCACCAGG - Intergenic
912806071 1:112758118-112758140 TCACCCAGGAGAGCAGCCTGAGG - Intergenic
915264778 1:154709055-154709077 GCTCTCAGGGGAGCACCCTCAGG - Intronic
917531079 1:175835599-175835621 GCTTCAAGGGTAGCAGCCTTTGG - Intergenic
922107522 1:222525434-222525456 TCACCCCGGGGAACAGCCTCAGG + Intronic
922756705 1:228101014-228101036 ACTTCCACAGGAGCAGCCTCGGG + Exonic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1062959123 10:1559428-1559450 CCACCCAGTGGACCAGCCTCTGG - Intronic
1063198410 10:3764444-3764466 GGATCTGGGGCAGCAGCCTCAGG + Intergenic
1064340227 10:14478811-14478833 GCATCCAGTGGACCTGCCTGGGG - Intergenic
1067448599 10:46367860-46367882 ACATCCAGGAGAGCAGCTCCAGG + Intergenic
1067473783 10:46553516-46553538 ACAGCCAGGCCAGCAGCCTCTGG + Intronic
1067588771 10:47492905-47492927 ACATCCAGGAGAGCAGCTCCAGG - Intergenic
1067635897 10:48000996-48001018 ACATCCAGGAGAGCAGCTCCAGG - Intergenic
1068644332 10:59449156-59449178 GCATGCATGGGAGCCACCTCTGG + Intergenic
1069825118 10:71250168-71250190 GCATCCTGGGGAGCAGGGCCTGG - Intronic
1070338403 10:75475146-75475168 CCAACCAGGGGTGCAGCATCAGG - Intronic
1070975988 10:80606027-80606049 GCATACAGGGCAGCAGGCCCAGG + Intronic
1072636823 10:97183769-97183791 GCAACCAGGGTAGCAGCTTCAGG + Intronic
1073428501 10:103471089-103471111 GGCTCCAGGGAAGCAGCATCTGG - Intergenic
1073716562 10:106114756-106114778 GCATCCAGCAGAGCAGCTACCGG - Intergenic
1074535937 10:114328722-114328744 GCCCCCAGAGGAGCAGCGTCAGG - Intronic
1075714356 10:124547598-124547620 GCATCCAGGCCAGGGGCCTCGGG - Intronic
1075738620 10:124679583-124679605 GCGTCCACGGGCCCAGCCTCAGG + Intronic
1076237891 10:128879907-128879929 GCAAAAAGTGGAGCAGCCTCAGG - Intergenic
1076464330 10:130667900-130667922 GGATCCACGGGACCAGCCTTGGG + Intergenic
1076661489 10:132058538-132058560 GTGCCCAGGGGAGCGGCCTCCGG - Intergenic
1076988713 11:257826-257848 GCATTCAGGGTTGCAGGCTCAGG + Intergenic
1077109077 11:854206-854228 CCACCCTGGGGAGCAGCGTCTGG - Intronic
1077372288 11:2188754-2188776 GTATCCAGGACAGCAGCCGCAGG + Intergenic
1077503894 11:2921570-2921592 CCATCCCCGGGAGCAGCCTGCGG + Intronic
1077503908 11:2921613-2921635 CCATCCCCGGGAGCAGCCTGCGG + Intronic
1077503922 11:2921656-2921678 CCATCCCCGGGAGCAGCCTGCGG + Intronic
1077503936 11:2921699-2921721 CCATCCCCGGGAGCAGCCTGCGG + Intronic
1077503950 11:2921742-2921764 CCATCCCCGGGAGCAGCCTGCGG + Intronic
1077503964 11:2921785-2921807 CCATCCCCGGGAGCAGCCTGCGG + Intronic
1077670276 11:4151202-4151224 GGCTCCAGGGGAGAAGCCTGAGG + Intergenic
1079110856 11:17604377-17604399 GCATCCAGTGGAGCGGGCTGGGG + Intronic
1083184078 11:61007552-61007574 ACTTCCAGGGGAGCGGCTTCCGG + Exonic
1083771353 11:64869434-64869456 ACATCCTGGGGAGTATCCTCGGG - Intronic
1084174774 11:67417504-67417526 GGAGCCAGGGAAGCAGCCTGTGG - Exonic
1084481121 11:69420791-69420813 CCAACCTGGGGTGCAGCCTCAGG + Intergenic
1085281621 11:75334731-75334753 GCATCCAGGGGAGCCAGTTCTGG - Intronic
1085405874 11:76261856-76261878 GCAGTCAGGGGAGCAGGCACAGG + Intergenic
1085438071 11:76528355-76528377 GCATCCAGGGTAGCAGAGGCTGG + Exonic
1089170896 11:116510914-116510936 CCATCCAGGGAAGGAGCTTCAGG + Intergenic
1089560661 11:119341564-119341586 GCTTCCAGGTCAGCTGCCTCTGG + Exonic
1092502675 12:9064612-9064634 GCTTCCAGGGCGGCAGGCTCCGG - Intergenic
1094394562 12:29991935-29991957 GCCTCTAGGGGAGGAGCCTTTGG + Intergenic
1096185467 12:49577716-49577738 GCCTACAGAGGAGCATCCTCTGG + Intronic
1096676775 12:53230513-53230535 GCCTCCTGGGGAGCAGGCTGGGG - Intronic
1097199818 12:57268973-57268995 GCAGCCAGAGGAGCAGCATGGGG - Exonic
1099318236 12:81111406-81111428 ACATCCAGGGGAGAGGCCACTGG + Intronic
1100077488 12:90803211-90803233 GCGTCAAAGGGAGTAGCCTCTGG + Intergenic
1101641280 12:106587098-106587120 CCATCAAGGGCTGCAGCCTCGGG - Intronic
1101962290 12:109259152-109259174 GCACCCAGGACAGCACCCTCTGG + Intronic
1102224036 12:111215352-111215374 GCACAGAGGGGAGAAGCCTCAGG + Intronic
1104666199 12:130649309-130649331 GCATGGAGCGGAGCGGCCTCCGG - Intronic
1104949801 12:132434295-132434317 GCACCCACGGGTGCAGCCACGGG + Intergenic
1105426757 13:20301437-20301459 GCATTCACGGGAGCAGGCCCAGG + Intergenic
1106435599 13:29720843-29720865 GGATCCAGGGCAGAAGCCTCAGG - Intergenic
1108545325 13:51487797-51487819 CCATACAGGGTAGTAGCCTCTGG + Intergenic
1109007756 13:56900856-56900878 GCACCCAGGCCAGCAGCCTGGGG + Intergenic
1110300990 13:73927249-73927271 TGATCAAGGGGAGAAGCCTCTGG - Intronic
1113173567 13:107534792-107534814 CCATCCAGAGGAGAAGCTTCAGG - Intronic
1113584790 13:111457898-111457920 GAATGCAGGGGAGCAGCACCAGG + Intergenic
1113952329 13:114078975-114078997 GCATCCTGGGGAGGGCCCTCAGG + Intronic
1115483531 14:33886285-33886307 GCAGCCAGGGACCCAGCCTCTGG - Intergenic
1118594556 14:67425695-67425717 GCCTCCCAGGGACCAGCCTCAGG + Intergenic
1118765034 14:68903963-68903985 GCATCCTGGCTAGCAGCATCTGG + Intronic
1119805894 14:77482277-77482299 ACCTACAGGGGAGCAGCCTGGGG + Intronic
1121315248 14:92957527-92957549 GCCTCCCAGGGAGCAGCCTGTGG - Intronic
1122906016 14:104801842-104801864 GCAGCCAGGGGCCCAGCCACTGG + Exonic
1126665682 15:51074717-51074739 GCAGCCAGGGCAGCACCCTTAGG - Intronic
1127966891 15:63929330-63929352 GCATCCAGGGGAGCAGCCTCAGG - Intronic
1128338070 15:66801107-66801129 GCTTCCAGGGTAGCTGCCTTCGG + Intergenic
1129295314 15:74596929-74596951 GCATGCAGGGGAGACGACTCAGG + Exonic
1129689988 15:77707723-77707745 GCCTCCAGGAGGGCAGACTCAGG + Intronic
1130150693 15:81309330-81309352 GCATTCAGGCCAGCAGCCCCAGG - Exonic
1132292778 15:100714843-100714865 GGAACCACGGGAGCAGCCCCGGG + Intergenic
1132551969 16:557232-557254 CCATCAAGGCCAGCAGCCTCAGG + Intergenic
1132555036 16:568617-568639 GCAGCCTGGGAAGCAGACTCAGG - Exonic
1132802925 16:1763062-1763084 GCCTGGAGGGGAGGAGCCTCAGG - Intronic
1134825494 16:17281168-17281190 GCATCCAGGGGAGCGGCTGAAGG + Intronic
1135424304 16:22324710-22324732 GCATCCTGGGGAGCACTGTCAGG + Intronic
1135544166 16:23354647-23354669 GCCTCCAGGGGAGCTGCATCTGG + Intronic
1136043615 16:27599268-27599290 GCATCCAGAGGAGCAGTTTCTGG - Intronic
1136367842 16:29817033-29817055 GCCATCAGGGGAGCAGCCCCGGG - Intronic
1138335846 16:56252297-56252319 GCATCTAGGGGGCCAGCCTTGGG - Intronic
1138533982 16:57650083-57650105 GCCTCTTGGGGAGCGGCCTCTGG + Intronic
1142077506 16:88128664-88128686 GCGTCATGGGGAGCAGGCTCAGG - Intergenic
1142292118 16:89198022-89198044 GCCGACAGGGGAGCAGCCTGGGG - Intronic
1142331102 16:89454596-89454618 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331111 16:89454629-89454651 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331120 16:89454662-89454684 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331129 16:89454695-89454717 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331138 16:89454728-89454750 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331146 16:89454761-89454783 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331154 16:89454794-89454816 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331163 16:89454827-89454849 ACACCCAGGGGAGCAGCTTGAGG - Intronic
1142331171 16:89454860-89454882 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331179 16:89454893-89454915 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331193 16:89454959-89454981 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331201 16:89454992-89455014 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331209 16:89455025-89455047 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331215 16:89455058-89455080 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331223 16:89455091-89455113 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331231 16:89455124-89455146 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331239 16:89455157-89455179 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331245 16:89455190-89455212 GCACCCAGGGAAGCAGCTTGAGG - Intronic
1142331252 16:89455223-89455245 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331259 16:89455256-89455278 GCACCCAGGGGAGCAGCTTGAGG - Intronic
1142331265 16:89455289-89455311 GCACCCAGGGAAGCAGCTTGAGG - Intronic
1142331272 16:89455322-89455344 GCACCCATGGGAGCAGCTTGAGG - Intronic
1142711051 17:1724432-1724454 GCATCTCTGGGAACAGCCTCCGG + Intronic
1142956995 17:3529157-3529179 GTACCCTGGGGAGGAGCCTCAGG - Intronic
1143140963 17:4741578-4741600 ACGTGCAGGGGGGCAGCCTCTGG - Exonic
1143260789 17:5596866-5596888 GCCACCAGGGGGTCAGCCTCTGG - Intronic
1143558281 17:7676148-7676170 GCCACGGGGGGAGCAGCCTCTGG + Exonic
1144996176 17:19270752-19270774 GCAGCCTGGGCAGCAGCCTAGGG - Intronic
1145902480 17:28497724-28497746 GCTGCCACGGGAACAGCCTCTGG + Exonic
1145960079 17:28882103-28882125 ACATCAAGGTGAGCAGCCTGAGG - Exonic
1146823177 17:36000841-36000863 GCATCCAGGGCAGGAGTCACGGG - Intronic
1146947738 17:36885185-36885207 CCATCCAGAGAAGCAGCGTCAGG - Intergenic
1146968321 17:37052035-37052057 TCATGCAGGGGAGCAGCCTGCGG - Intronic
1147159664 17:38562760-38562782 GGGTCCAGGGGAGCAGGGTCTGG - Intronic
1147524679 17:41210473-41210495 GCAGCCAGGCTAGAAGCCTCAGG - Intronic
1148792098 17:50178949-50178971 CCATCCAGTACAGCAGCCTCAGG + Intergenic
1148860350 17:50601319-50601341 GCATCCCGGGGACCAGGATCTGG - Intronic
1148876913 17:50693602-50693624 GCCTCCAGAGGAGCAGCTGCAGG - Exonic
1151143313 17:72016164-72016186 GAATCCTGGGGAGCAGACTGAGG - Intergenic
1151605220 17:75131402-75131424 GCACCCTGGGGAGGAGCCTTTGG - Intronic
1152067787 17:78121139-78121161 GCCTCCTGGCCAGCAGCCTCTGG + Exonic
1152178249 17:78801932-78801954 TCACCCAAGGGAGCAGACTCGGG + Intronic
1153967193 18:10192613-10192635 CCATCCAGGGCAGCAGGCTCTGG - Intergenic
1154251784 18:12750920-12750942 GAATCCCTGGGAGCAGCCTTAGG - Intergenic
1154299709 18:13182448-13182470 GGGTCCAGGGGAGCAGCCGCAGG - Intergenic
1155289863 18:24330224-24330246 ACATCCAGGGGAGCAGTCGGAGG - Intronic
1158581783 18:58690473-58690495 CCATCCAGGGGAGGAGGCTCTGG - Intronic
1160022585 18:75191984-75192006 TTTTCCAGGTGAGCAGCCTCAGG + Intergenic
1160449822 18:78954995-78955017 CCAGGCAGGGGAGCAGCCTGTGG + Intergenic
1161007319 19:1943046-1943068 GCATGCAGGGGAGCCGGGTCTGG + Intronic
1161213459 19:3080541-3080563 GCACCCAGGGCTGCAGGCTCTGG - Intergenic
1161633855 19:5374669-5374691 GCATCCCACAGAGCAGCCTCTGG - Intergenic
1162806221 19:13139235-13139257 GAACCCAGGGGAGCAGACTGGGG + Exonic
1163554654 19:17985096-17985118 CCATCCAGGGAAGCAGCTTGGGG + Intronic
1164807772 19:31130032-31130054 GAAACCAGGGGACCACCCTCAGG - Intergenic
1165355291 19:35300235-35300257 GCATCCAGGTCAGCAGCGGCGGG - Exonic
1165705852 19:37975764-37975786 GGAGTCAGGGGTGCAGCCTCTGG + Intronic
1166783713 19:45355375-45355397 ACTTCCAGGGGAGCACCCTTAGG + Intronic
925237665 2:2293557-2293579 GCTTCCAGGTGAGGGGCCTCAGG + Intronic
925328753 2:3042454-3042476 GGTCCCAGGGGAGCCGCCTCGGG - Intergenic
925923129 2:8651283-8651305 GCGCACAGTGGAGCAGCCTCAGG + Intergenic
926554980 2:14346726-14346748 GCCTCCATGGGAGCATCTTCAGG + Intergenic
928195835 2:29215920-29215942 GCACCCACGCCAGCAGCCTCGGG + Intronic
928596238 2:32861855-32861877 ACTTCCAGGGGAGCAGCCCCTGG + Intergenic
930880446 2:56264338-56264360 GCAGCCAGGGGAGCAGTTTTGGG - Intronic
932332694 2:70906870-70906892 GCTTCAAGGGAAGCAGGCTCGGG - Intronic
933977175 2:87520847-87520869 GCATGTAGGGGAAGAGCCTCAGG + Intergenic
934519156 2:95008486-95008508 GCAGTGAGGGGAGCAGGCTCTGG + Intergenic
934650942 2:96091156-96091178 GCATGAAGGGCAGTAGCCTCTGG - Intergenic
935125616 2:100220011-100220033 GCTTTAAGGGGAGGAGCCTCTGG - Intergenic
936316642 2:111429958-111429980 GCATGTAGGGGAAGAGCCTCAGG - Intergenic
936516725 2:113185774-113185796 GGCTCCAGGGGAGGAGCCCCAGG + Intronic
937095657 2:119233786-119233808 GCAGCCCGGGGAGCAGCTCCTGG - Intronic
937236106 2:120432732-120432754 GCATCCAAGGGGGCAGTCGCAGG + Intergenic
937587468 2:123570339-123570361 GCTTCCAGGGAAGCAGTCCCTGG - Intergenic
941192832 2:162407659-162407681 GCATCCTGAGGAGCAGTGTCAGG + Intronic
945946484 2:216000408-216000430 GCATCCTGGGGACAAGCCACAGG - Intronic
947670709 2:231933824-231933846 TGAGCCAGGGGAGCAGCCTGTGG - Intergenic
948865489 2:240772795-240772817 GCTTCCAGGGGAGCCGTCTCTGG + Intronic
948874037 2:240818057-240818079 GCACCCAGGGGGGCAGCACCCGG + Intronic
948996566 2:241583157-241583179 ACATCCAGGGTAGCAACCGCAGG - Intergenic
949054004 2:241914753-241914775 GCCTCCTGGGGAGCAGCCTGGGG + Intergenic
1168815938 20:737068-737090 GGAGCCAGGGAAGCAGGCTCGGG + Intergenic
1169379781 20:5096432-5096454 GAATCTAGGAGAGAAGCCTCAGG + Intronic
1171487961 20:25497462-25497484 GCAGACAGCGGAGCCGCCTCTGG - Intronic
1172209526 20:33187116-33187138 GGACCCCGGGGCGCAGCCTCAGG + Intergenic
1173584976 20:44175670-44175692 TCATCTGGGGCAGCAGCCTCTGG - Intronic
1174085781 20:48006300-48006322 GCACCCAGGGCTGCAGACTCCGG + Intergenic
1174133117 20:48359788-48359810 GTCTCCAGGTGAGCAGGCTCTGG - Intergenic
1175331241 20:58165970-58165992 GAATCCTGGGAAACAGCCTCTGG - Intergenic
1175397817 20:58678992-58679014 GCATCCCTGGATGCAGCCTCTGG + Exonic
1175704724 20:61168204-61168226 GAAGCCTGGGGAGCTGCCTCGGG - Intergenic
1176016921 20:62938464-62938486 GCCTCCAGGCGCGCGGCCTCAGG + Intronic
1178877712 21:36425470-36425492 GCCTCCAGGGGAGCTGACTCAGG + Intergenic
1179061924 21:37987185-37987207 GCAACCTGGAGGGCAGCCTCAGG - Intronic
1179568709 21:42265222-42265244 GCATCCAGTGCAGCAGCCCCGGG + Intronic
1179613479 21:42566911-42566933 GCATGCATAGGAGCAGCCTGAGG - Intronic
1179890490 21:44332875-44332897 GAAGCCAGGGGAACAGCCTCTGG + Intronic
1179996127 21:44975290-44975312 GTACTCAGGGGAGCAGCCTTGGG - Intronic
1180986158 22:19904869-19904891 GGGGCCAGGGGAGCAGCCCCGGG + Intronic
1181165669 22:20981793-20981815 GCAGCCCGGCGAGGAGCCTCTGG - Intronic
1181428061 22:22856640-22856662 GCCTCCAGGGAAGGGGCCTCGGG + Intronic
1183286908 22:36972207-36972229 CCCTTCAGGGCAGCAGCCTCAGG + Intergenic
1183354391 22:37350593-37350615 GCCTCCAGGGGACCAGGCCCGGG - Intergenic
1183430969 22:37765584-37765606 GCCTCCAGAGGAGAAGGCTCAGG - Intronic
1184791573 22:46703523-46703545 GCAACCTGGGGAGCAGCCTGGGG - Intronic
1185248731 22:49788074-49788096 GCACCCAGGGCCGCAGCCTTTGG - Intronic
950142322 3:10623869-10623891 GCTTCCAAGGGAGAAGCCTTGGG + Intronic
950311599 3:11963307-11963329 GAATCCAGAGAAGCAGCATCTGG - Intergenic
950496701 3:13338149-13338171 TCAGACAGGGCAGCAGCCTCAGG - Intronic
951541146 3:23783258-23783280 GCAAGCAGGGGAGCAGGCACTGG + Intergenic
954384818 3:50238457-50238479 GCAGCCAGGGGTGCAGGGTCTGG + Intronic
956605739 3:71071266-71071288 GCATCCAGGTGAGCAACCCTGGG + Intronic
961636836 3:128338573-128338595 AAATCCCAGGGAGCAGCCTCAGG + Intronic
964000229 3:151762281-151762303 GCAGCCAGGGGAGTAGCATGTGG - Intergenic
965820030 3:172676038-172676060 GCATGCAGGGGAGCAGCAGTTGG - Intronic
968612928 4:1565188-1565210 GCTTGCAGGGGAGTGGCCTCGGG - Intergenic
969504909 4:7579541-7579563 GAATCCAGGAGAGCAGCCAAAGG - Intronic
970244143 4:14040937-14040959 GCATCCATGGGAGAAATCTCAGG - Intergenic
981097598 4:140797912-140797934 ACATCCAGAGTAGAAGCCTCTGG + Intergenic
981938377 4:150257065-150257087 GCTTGCAGGGAAGCAGCCGCTGG - Exonic
983784429 4:171714935-171714957 GCCCCCAGGGCAGCAGCCTTAGG - Intergenic
985587130 5:746287-746309 GCACCCTGGGGAGCTGCCTGTGG + Intronic
985632074 5:1018940-1018962 GCATCTAGGGGAGCAGCAGGTGG + Intronic
985888857 5:2700404-2700426 GCATCCAGGAGAGCCACCTGTGG + Intergenic
986458106 5:7940663-7940685 GCCTCCAGAGGAGGAGGCTCAGG - Intergenic
987099711 5:14581565-14581587 GTTTCCCGGGGAGCAGCCTCAGG + Intergenic
990008716 5:50969994-50970016 TCGCCCAGAGGAGCAGCCTCAGG - Intergenic
991506848 5:67334104-67334126 TCATCCATGGGAGCTGCATCGGG + Intergenic
1003675949 6:8204398-8204420 AAATCCAGGGGAGCAGCAGCTGG - Intergenic
1004408592 6:15359359-15359381 GAATCCAGAAGAGCAACCTCTGG - Intronic
1005249290 6:23926439-23926461 GGGTCCAGGGGAAGAGCCTCAGG + Intergenic
1006116738 6:31779658-31779680 GCATCCTCCGGGGCAGCCTCTGG + Exonic
1006452206 6:34111774-34111796 GTGTCCCGGGGGGCAGCCTCTGG - Intronic
1006924106 6:37644726-37644748 GGATGCATGGGAGCTGCCTCTGG - Intronic
1007745105 6:44038849-44038871 CCATCCCAGGGAGCAGCCTGGGG - Intergenic
1007769400 6:44180774-44180796 CCATCCTGTTGAGCAGCCTCTGG - Exonic
1011847028 6:91578691-91578713 GAGTTCAAGGGAGCAGCCTCAGG + Intergenic
1012523297 6:100146462-100146484 GCCTCCAGGTCTGCAGCCTCTGG - Intergenic
1017753354 6:157509306-157509328 GCATCCAGATGAGGAGTCTCAGG + Intronic
1017972701 6:159327043-159327065 GCTACAAGGAGAGCAGCCTCTGG + Intergenic
1018081448 6:160262482-160262504 GCCTCCAGGGGAGGAGTCTGGGG + Intronic
1018804682 6:167249546-167249568 GCCTTCAGCCGAGCAGCCTCAGG - Intergenic
1018825988 6:167408264-167408286 GCCTTCAGCCGAGCAGCCTCAGG - Intergenic
1019035163 6:169048484-169048506 GCTTCCAAGGGAGGAGCCTCAGG + Intergenic
1019995665 7:4722876-4722898 GCATCCAGGTGAGGTGCCTGTGG + Intronic
1020226579 7:6285118-6285140 GCTGCCAGGGGAGGAGCCCCAGG - Intergenic
1022396534 7:29992070-29992092 GCCTCCAGGGGAGCAGCGTAGGG - Intergenic
1024095792 7:45981389-45981411 GGAGCCCCGGGAGCAGCCTCTGG + Intergenic
1024271053 7:47641721-47641743 GAAGCCAGGCGAGCAGGCTCAGG + Intergenic
1026269224 7:68821932-68821954 GCTTCCATGGTAGCAGCGTCAGG - Intergenic
1030337908 7:108345546-108345568 GTATTCAGAGGAGCAGCCTTTGG + Intronic
1032545038 7:132734655-132734677 GCATACAGACGAGCAGGCTCTGG - Intergenic
1033873234 7:145783805-145783827 CCATCCAGGGGAGCAAACTGTGG - Intergenic
1034210566 7:149358875-149358897 GCTCCCAGGGCAGCAGGCTCCGG + Intergenic
1035386287 7:158475179-158475201 GCTCCCAGAGGAGCAGCCTGTGG + Intronic
1035731185 8:1854360-1854382 GCAGGCAGGGGTGCAGCCTCAGG + Intronic
1039957756 8:42220359-42220381 GCATCCTGGGGGCCATCCTCAGG + Intergenic
1040453146 8:47568508-47568530 GCATCCAGGGGCAAAGTCTCTGG + Intronic
1043346768 8:79307152-79307174 GCATTCACTGGGGCAGCCTCAGG + Intergenic
1047205910 8:122802914-122802936 GGATGCAGGGGAGCATTCTCGGG - Intronic
1049602965 8:143516395-143516417 CCACCCTGCGGAGCAGCCTCAGG - Intronic
1051915898 9:22207421-22207443 GCAGCCATGGGAGCATCCACCGG + Intergenic
1053015606 9:34660317-34660339 GCAGCCAGAGGTGGAGCCTCAGG + Exonic
1054313534 9:63556258-63556280 GCATGCAGGTGAGCAGGCACAGG + Intergenic
1054808305 9:69413298-69413320 GGAGCCAGGTGGGCAGCCTCCGG - Intergenic
1056926315 9:90837729-90837751 GCTTCCACGAGGGCAGCCTCAGG + Intronic
1060220744 9:121762884-121762906 CAATCCAGGGTAGCAGCCCCAGG - Intronic
1060881555 9:127121714-127121736 CCATCCAGTGCAGCAGCCCCTGG + Intronic
1061329151 9:129881359-129881381 GGATCCTGGGAAGCAGCCTCTGG + Exonic
1062280839 9:135750970-135750992 GCAGGCAGGTGAGCAGCTTCAGG - Exonic
1062341004 9:136094068-136094090 CCATCCCGTGGAGCTGCCTCCGG - Intronic
1062375329 9:136259428-136259450 AGAGCCTGGGGAGCAGCCTCGGG - Intergenic
1062479445 9:136744613-136744635 GTGTCCACCGGAGCAGCCTCGGG - Intronic
1187521001 X:20013993-20014015 GGATCCAGGAGACCAGCCTGTGG - Intronic
1189606102 X:42679727-42679749 GCATAAAGGGGAGCTGCCTCAGG + Intergenic
1189792689 X:44618937-44618959 GTTTCCTGGGGAGCAACCTCTGG - Intergenic
1192034241 X:67545917-67545939 GAGTCCAGGGGAACAGCTTCGGG + Exonic
1194916992 X:99719332-99719354 GCAGCCAGAGGCGCGGCCTCTGG + Intergenic
1199773329 X:150989243-150989265 GCATCCAGGAGACCAGCAGCAGG - Exonic
1199954967 X:152735246-152735268 GCATCCAGGTGAGAAGCCTGAGG + Exonic
1200230985 X:154443863-154443885 GCAGCCAGGGGACCAGCGTTGGG + Intergenic
1201078049 Y:10201022-10201044 GCATCCAGGGGACCATCACCAGG - Intergenic