ID: 1127972829

View in Genome Browser
Species Human (GRCh38)
Location 15:63975137-63975159
Sequence AGCCCCAGTGGAGCACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 182}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127972829_1127972841 26 Left 1127972829 15:63975137-63975159 CCAGCATGTGCTCCACTGGGGCT 0: 1
1: 0
2: 0
3: 34
4: 182
Right 1127972841 15:63975186-63975208 AAGATCTCAGGAAGGGTTCTAGG 0: 1
1: 0
2: 2
3: 16
4: 180
1127972829_1127972839 18 Left 1127972829 15:63975137-63975159 CCAGCATGTGCTCCACTGGGGCT 0: 1
1: 0
2: 0
3: 34
4: 182
Right 1127972839 15:63975178-63975200 CAAAGGGAAAGATCTCAGGAAGG 0: 1
1: 0
2: 2
3: 54
4: 337
1127972829_1127972836 14 Left 1127972829 15:63975137-63975159 CCAGCATGTGCTCCACTGGGGCT 0: 1
1: 0
2: 0
3: 34
4: 182
Right 1127972836 15:63975174-63975196 GGCCCAAAGGGAAAGATCTCAGG 0: 1
1: 0
2: 6
3: 12
4: 161
1127972829_1127972832 -7 Left 1127972829 15:63975137-63975159 CCAGCATGTGCTCCACTGGGGCT 0: 1
1: 0
2: 0
3: 34
4: 182
Right 1127972832 15:63975153-63975175 TGGGGCTGAAATAAAGCCATGGG 0: 1
1: 0
2: 2
3: 30
4: 261
1127972829_1127972833 1 Left 1127972829 15:63975137-63975159 CCAGCATGTGCTCCACTGGGGCT 0: 1
1: 0
2: 0
3: 34
4: 182
Right 1127972833 15:63975161-63975183 AAATAAAGCCATGGGCCCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 238
1127972829_1127972831 -8 Left 1127972829 15:63975137-63975159 CCAGCATGTGCTCCACTGGGGCT 0: 1
1: 0
2: 0
3: 34
4: 182
Right 1127972831 15:63975152-63975174 CTGGGGCTGAAATAAAGCCATGG 0: 1
1: 0
2: 3
3: 21
4: 205
1127972829_1127972834 2 Left 1127972829 15:63975137-63975159 CCAGCATGTGCTCCACTGGGGCT 0: 1
1: 0
2: 0
3: 34
4: 182
Right 1127972834 15:63975162-63975184 AATAAAGCCATGGGCCCAAAGGG 0: 1
1: 0
2: 0
3: 21
4: 163
1127972829_1127972840 19 Left 1127972829 15:63975137-63975159 CCAGCATGTGCTCCACTGGGGCT 0: 1
1: 0
2: 0
3: 34
4: 182
Right 1127972840 15:63975179-63975201 AAAGGGAAAGATCTCAGGAAGGG 0: 1
1: 0
2: 6
3: 58
4: 770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127972829 Original CRISPR AGCCCCAGTGGAGCACATGC TGG (reversed) Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900803875 1:4754937-4754959 AGCCCCAGTGGGCAAGATGCAGG + Intronic
902337592 1:15762779-15762801 AGCCCCAGGGCAGGACAGGCTGG - Intronic
902924604 1:19687913-19687935 AGACCCAGGGGAGCAGTTGCTGG + Intronic
903642358 1:24868639-24868661 AGCCCCAGGAGATCAGATGCGGG + Intergenic
904289142 1:29472370-29472392 AGTCCCAGTGGACCACAAGTCGG + Intergenic
904428145 1:30444912-30444934 CGTGCAAGTGGAGCACATGCAGG - Intergenic
905467544 1:38166731-38166753 AGCCCATGTGGGGCTCATGCTGG - Intergenic
906511225 1:46411419-46411441 GGCCCCAGAGGGGCACAGGCTGG - Intronic
909076456 1:71054716-71054738 ACCCCACGTGGTGCACATGCCGG + Intergenic
911089434 1:94006788-94006810 GGCCCCAGTCAAGCAGATGCTGG + Intronic
914345642 1:146796239-146796261 AGGCCCAGTGGTCCACAGGCTGG + Intergenic
916809566 1:168293479-168293501 GGCACCAGGAGAGCACATGCTGG - Intronic
917487556 1:175468742-175468764 AGCCACACTGAAGCACCTGCGGG - Intronic
920366174 1:205449483-205449505 AGCCCCAGGGCAACACTTGCTGG + Intronic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
1062839956 10:662432-662454 AGCCCTATTGGCGCACAGGCAGG + Intronic
1065920235 10:30386842-30386864 GGCCCCAGTGGGGCACACGTGGG - Intergenic
1067064707 10:43097230-43097252 GGCCCCAGAGGAGCACCTGTGGG + Intronic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1069676986 10:70255433-70255455 AGCGCGCGTGGTGCACATGCTGG - Exonic
1070164764 10:73889161-73889183 AGGCCCAGTGGCCCACAGGCAGG - Intergenic
1070590147 10:77795404-77795426 TGCCCCAGTGGAGCATCTGGGGG - Intronic
1071476153 10:86026836-86026858 AATCCCAGTTCAGCACATGCTGG + Intronic
1072247583 10:93556905-93556927 AGCCCCAGTGGAGCAGACTCAGG - Intergenic
1074430081 10:113386928-113386950 AGGCCCAGAGGGGCACATGCTGG - Intergenic
1075647363 10:124105176-124105198 AGCCCCTGTTGGGCACCTGCAGG - Intergenic
1076357571 10:129864241-129864263 AGCCCCAGAGCAGCAAAAGCAGG + Intronic
1077551794 11:3203681-3203703 AGCCCCAGGCGAGCGCACGCAGG - Intergenic
1077638399 11:3859377-3859399 AGCCCCAGAGTAGCACAGGCAGG - Intronic
1078930404 11:15908004-15908026 AACCCCTGTGGAGCCCATTCTGG + Intergenic
1079363735 11:19791435-19791457 AGCCCCTGGGGAGCACACGCTGG + Intronic
1079683977 11:23332627-23332649 TGCCCCAGAGAAGCTCATGCTGG - Intergenic
1081456233 11:43225759-43225781 AGCACAAGAGGAGCACAGGCAGG - Intergenic
1082765457 11:57164033-57164055 GTCCTCAGTGGAGCACATGAGGG - Intergenic
1083611378 11:64005976-64005998 AGCCTCGGTGCAGCCCATGCTGG + Intronic
1083652102 11:64209690-64209712 AACCCCACTGCTGCACATGCCGG - Intronic
1083959922 11:66009001-66009023 AGCCCCAGTGAAGCCCCTGGAGG + Intergenic
1084512323 11:69613933-69613955 AGCCCCAGTGTGGCACATTAAGG - Intergenic
1084706648 11:70819776-70819798 ACCCTCAGGGGAGCACTTGCAGG - Intronic
1087615984 11:100487021-100487043 ACCTCCACTGGAGCAGATGCTGG + Intergenic
1087866074 11:103228567-103228589 ACCTCCAGTGGAGCAGGTGCTGG - Intronic
1088249406 11:107849854-107849876 AGGCCCAGTGGAGGGCATGCTGG + Intronic
1089707151 11:120286937-120286959 AGCCACAGTGGACCACAAGCAGG + Intronic
1090450160 11:126798929-126798951 CGCCACAGAGGAGCACATGCAGG + Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1092033000 12:5305505-5305527 GGCCCCAGTGGAGTACATTAGGG - Intergenic
1092530388 12:9339322-9339344 AGCCCCAGGGGAGCAGGGGCTGG + Intergenic
1096454592 12:51774546-51774568 AGTCCCCCTGGAGCAAATGCAGG - Intronic
1097074562 12:56383412-56383434 AACCCCAGGGGAGCTTATGCGGG - Intergenic
1099392380 12:82097514-82097536 ACCTCCACTGGAGCAGATGCTGG - Intergenic
1101544377 12:105697827-105697849 ACCTCCACTGGAGCAGATGCTGG - Intergenic
1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG + Intronic
1104467103 12:128999553-128999575 AGCCCCAGTGGGGCCCCTGCAGG + Intergenic
1107043987 13:35976122-35976144 AGCCCCAAAGGATGACATGCGGG + Intronic
1110748140 13:79079842-79079864 ACCTCCACTGGAGCAGATGCTGG + Intergenic
1113155988 13:107322631-107322653 AGGACCAGAGGAGCACATCCAGG - Intronic
1113376202 13:109766824-109766846 AGTGCCAGTGGGTCACATGCAGG - Intronic
1113418553 13:110151680-110151702 AGCCCCGCTGGAGCCAATGCAGG - Intronic
1118083842 14:62393559-62393581 AGCCCCTGGGCACCACATGCAGG + Intergenic
1121668756 14:95692137-95692159 GGCCCCAGTGAAGCCCATCCAGG - Exonic
1122466178 14:101935079-101935101 AGCCTCGGTGGAGCAGATGTAGG - Intergenic
1122832295 14:104405012-104405034 AAGCACAGTGGACCACATGCTGG - Intergenic
1123768224 15:23502916-23502938 AGCCCCAGTGGACCACCTTATGG + Intergenic
1126678114 15:51179201-51179223 TGCAGCAGGGGAGCACATGCAGG - Intergenic
1126889647 15:53190724-53190746 AGCCCCAGTGGAAAACATCTTGG + Intergenic
1126977366 15:54198471-54198493 ACCTCCAGTGGAGCAGATGCTGG + Intronic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1129976430 15:79826232-79826254 AGCAGAAGTGGAGCTCATGCAGG - Intergenic
1130331454 15:82925365-82925387 AGACCCAGGGGACCACATGGAGG - Intronic
1131032475 15:89197731-89197753 GGCCCCTGTGGAGGACAGGCAGG + Exonic
1132711226 16:1268885-1268907 AGCCACAGTGGAGCCCAGGGCGG + Intergenic
1134236721 16:12472184-12472206 AGACCCAGAGGAGCACACACTGG + Intronic
1134443862 16:14315920-14315942 AGCCCCAGTTCCTCACATGCCGG - Intergenic
1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG + Intronic
1137407741 16:48203275-48203297 AGCAGCAGTGGAGCACCTGGAGG + Exonic
1139654527 16:68379246-68379268 GACCACAGTGGAGCAGATGCTGG + Intronic
1139988344 16:70919028-70919050 AGGCCCAGTGGTCCACAGGCTGG - Intronic
1141196596 16:81865673-81865695 TGCCCCAGTGGAGCCCATCCTGG - Intronic
1141196609 16:81865730-81865752 TGCCCCAGTGGAGCTCATCCTGG - Intronic
1141196649 16:81865901-81865923 TGCCCCAGTGGAGCTCATCCTGG - Intronic
1141196664 16:81865958-81865980 TGCCCCAGTGGAGCCCATCCTGG - Intronic
1141196679 16:81866015-81866037 TGCCCCAGTGGAGCCCATCCTGG - Intronic
1141196719 16:81866186-81866208 TGCCCCAGTGGAGCTCATCCTGG - Intronic
1141196732 16:81866243-81866265 TGCCCCAGTGGAGCTCATCCTGG - Intronic
1141196746 16:81866300-81866322 TGCCCCAGTGGAGCCCATCCTGG - Intronic
1141196759 16:81866357-81866379 TGCCCCAGTGGAGCTCAACCTGG - Intronic
1141196772 16:81866414-81866436 TGCCCCAGTGGAGCTCATCCTGG - Intronic
1141196785 16:81866471-81866493 TGCCCCAGTGGAGACCATCCTGG - Intronic
1141196798 16:81866528-81866550 TGCCCCAGTGGAGCTCATCCTGG - Intronic
1141196810 16:81866584-81866606 TGCCCCAGTGGAGCTCATCTTGG - Intronic
1141196822 16:81866641-81866663 TGCCCCAGTGGAGCTCATCCTGG - Intronic
1141196851 16:81866754-81866776 TGCCCCAGTGGAGCCCATCCTGG - Intronic
1143099772 17:4498765-4498787 ACCCCCAGGGCAGCACGTGCGGG + Intergenic
1144791657 17:17862984-17863006 ACTCCCAGTGCACCACATGCCGG + Intronic
1147677590 17:42218772-42218794 CGGCCCAGTGGAGGAGATGCTGG - Exonic
1147688449 17:42300799-42300821 CGGCCCAGTGGAGGAGATGCTGG + Exonic
1151262949 17:72930982-72931004 AGCCCCAGTGCAGCATTTCCTGG - Intronic
1151524161 17:74652384-74652406 AGCCCCAGTGCAGCACAGCCAGG - Intergenic
1152207425 17:78981626-78981648 AGCCCCAGGGGAGCAGATGTTGG - Intergenic
1152773967 17:82188337-82188359 AGCCCACGTGGAGCAGCTGCAGG - Exonic
1154222161 18:12465645-12465667 AGCCTCATGGGAGCAGATGCTGG + Intronic
1155154568 18:23147852-23147874 AGCCCACGTGGGGCACATGCTGG + Intronic
1155779315 18:29811326-29811348 AGCTGCAGTGGAGCACAGCCAGG + Intergenic
1156787094 18:40928526-40928548 AGCTCCAGTGGAACACATGTGGG - Intergenic
1159957012 18:74525903-74525925 AGTCCCTGTGGAGAACTTGCTGG + Intergenic
1161067809 19:2247204-2247226 TGGCCCAGTGGAGCCCAAGCAGG - Intronic
1161767542 19:6215805-6215827 AGCGACAGTGGAGAACGTGCTGG - Intronic
1163394110 19:17049088-17049110 AGTCCCAGTGGAGCACAGATGGG + Intergenic
1167660847 19:50795041-50795063 AGCTCCAGTGGTGCCCCTGCTGG + Exonic
928828529 2:35449347-35449369 ACCACCACTGGAGCACATGTAGG - Intergenic
929175212 2:38968963-38968985 GGCCCCAGTGTAGCACAGGAAGG + Intronic
929466202 2:42146673-42146695 AGTCCCAGTACAGCACATGTAGG - Intergenic
929686385 2:44038811-44038833 AGCCCCAGATGAAGACATGCTGG + Intergenic
930546508 2:52774068-52774090 AGCTTCAGGGGAACACATGCTGG - Intergenic
932431668 2:71679253-71679275 AGCCCCAGTGGAGGGCATGGGGG + Intronic
937398949 2:121564817-121564839 AGCCCCTTTGGAGCATATTCTGG - Intronic
938080167 2:128365711-128365733 AGCCACAGGGGAGCACTTGGAGG + Intergenic
938160831 2:128983182-128983204 AGCCCCAGAGGAGAACAGGCTGG - Intergenic
939288405 2:140162610-140162632 AACCCCTGTGGCACACATGCAGG + Intergenic
941033006 2:160534507-160534529 AGGCACAGTGGAGCACATGTTGG - Intergenic
945223392 2:207507173-207507195 GGACTCAGTGGAGCTCATGCTGG - Intergenic
947460568 2:230300413-230300435 ACCTCCACTGGAGCACGTGCTGG + Intronic
948275583 2:236705562-236705584 GACCCCAGCGGAGCACATGGAGG - Intergenic
948787766 2:240361880-240361902 AGGCCCAGTGGAGCAGGTGCCGG + Intergenic
1171207082 20:23289538-23289560 AGCCCCCTTGGAGCACGTGAGGG - Intergenic
1172708935 20:36904991-36905013 AGCCTCAATGAAGCTCATGCAGG + Intronic
1174840646 20:53898438-53898460 AGCTCCGGTGCAGCACTTGCTGG - Intergenic
1177286649 21:19060107-19060129 AGCAACAGTGGAGCTCATTCTGG - Intergenic
1179979557 21:44889023-44889045 GGCCCAAGTGGGGCAGATGCGGG + Intronic
1180032233 21:45220356-45220378 AGTGGCAGGGGAGCACATGCAGG + Intronic
1180699919 22:17775690-17775712 AGCCCGAGTGAAGAGCATGCAGG - Intergenic
1181587499 22:23861615-23861637 AGCCTCATTGCAGAACATGCTGG + Intronic
1182984453 22:34703168-34703190 AACCCGAGTGGAGCACATGGAGG + Intergenic
1183624879 22:38995830-38995852 ACCCCCAGTGGAGCACAGTTAGG + Intergenic
1184705886 22:46213127-46213149 AGCCCCCTTGGAGGACATTCTGG - Intronic
1185126031 22:49011297-49011319 TGCCACGGTGGAGCACAGGCAGG + Intergenic
950556419 3:13698821-13698843 AGCCCCTCTGGAGCACATCGGGG - Intergenic
950590834 3:13934922-13934944 AGACCCAGCGGGGCACATGAGGG + Intergenic
952776507 3:37051775-37051797 AGCCCAGGTGGGGCACAGGCTGG + Intergenic
954304972 3:49720828-49720850 GGCCCAAGTGGAACAGATGCTGG + Exonic
954861431 3:53694218-53694240 AGCCCCAGTGGAGCCCCCACGGG - Intronic
956426380 3:69139821-69139843 ATCCCCAGTGGAGTACATAGGGG + Intergenic
960093442 3:113665256-113665278 AGCTACAGTGGAGTACATGTGGG + Intronic
961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG + Intronic
961743338 3:129047185-129047207 ACGCCCAGTGCAGCACAGGCCGG - Intergenic
964623348 3:158736357-158736379 AGCCCCAGTGGGGTCCCTGCAGG + Intronic
965199152 3:165634165-165634187 AGCAGCAGTGGAGCACTTGAGGG - Intergenic
966229866 3:177640407-177640429 ACCTCCAGTGGAGCAGGTGCTGG - Intergenic
966289216 3:178334999-178335021 AGCTGCAGTGAAGCACATCCAGG - Intergenic
968280366 3:197472480-197472502 AGGCCCAGGGGAGCCCTTGCTGG + Intergenic
968867381 4:3222094-3222116 ACCCCCAGTGGAGCAGACACAGG - Intronic
968919490 4:3515269-3515291 AGCAGCAGTGGAGCCCAGGCAGG - Intronic
969500169 4:7547741-7547763 AGCCCCAGACAGGCACATGCAGG - Intronic
970032521 4:11692818-11692840 AGTCCCAGTGGATCACCTGCTGG + Intergenic
970614265 4:17753116-17753138 AACCCCAATGGAGCAGATGGAGG - Intronic
974472151 4:62332050-62332072 ACCTCCAGTGGAGCAGGTGCTGG + Intergenic
977614570 4:99073798-99073820 AGCCTCATTCTAGCACATGCTGG - Intronic
981027734 4:140093783-140093805 AGCCCTAATGCAGCACATGATGG - Intronic
985977340 5:3430553-3430575 AGCCCCAGCTGTGCCCATGCTGG + Intergenic
986964696 5:13256575-13256597 AACACCAGTGGAACCCATGCTGG + Intergenic
987109564 5:14672525-14672547 AGACCCAGTGGAACACAGGAAGG - Intronic
989218511 5:38929156-38929178 AGCCTCATTGTAGCACATACAGG - Intronic
995854485 5:116577180-116577202 ACCCCCAGGGGAGCACCTGTGGG + Intergenic
996467802 5:123823684-123823706 AGCCCCAGTGGAGAAGTGGCAGG - Intergenic
996675210 5:126167663-126167685 GGCCCCAGGGCAGCATATGCTGG + Intergenic
998159042 5:139802875-139802897 AATCCCAGCAGAGCACATGCAGG + Intronic
998923335 5:147095300-147095322 AGCCCCAGTGAACCAGATTCAGG + Intergenic
1001559372 5:172659300-172659322 AGCCCCAGGAGAGCACCTGCGGG - Intronic
1002432298 5:179210656-179210678 AGCCTCAGTGGTGCTCAGGCTGG + Intronic
1002792614 6:447137-447159 AGCCCCCATGGAACACAGGCAGG + Intergenic
1003012236 6:2436670-2436692 AGCCCCAGGGGAGGGCAAGCCGG - Intergenic
1006100094 6:31681247-31681269 AGCCGCAGCTGAGCACAGGCGGG - Intronic
1006581536 6:35080419-35080441 AGCCCCAGGCCAGAACATGCAGG + Intronic
1007585620 6:42987337-42987359 AGTCCCAGAGGAGAACATGAAGG - Intronic
1008850737 6:56017979-56018001 AGCCCCAGTAGATCAGATGGAGG - Intergenic
1012869899 6:104659972-104659994 ACCCCCACTGGAGCAGGTGCTGG + Intergenic
1013487746 6:110614300-110614322 AGTCACAATGGAACACATGCAGG + Exonic
1020503443 7:8952858-8952880 AGTACCAGTGGAGTCCATGCTGG - Intergenic
1021489257 7:21200956-21200978 AAACCCACTGAAGCACATGCAGG + Intergenic
1021838589 7:24704521-24704543 AGTCCCAGTGGAGGCCAGGCTGG - Intronic
1022466178 7:30654533-30654555 AGCCCCAGTGCAGCTGACGCAGG - Intronic
1022736786 7:33083665-33083687 AGCCCAAGTGGAGCCTTTGCAGG + Intergenic
1022870282 7:34471369-34471391 GGCCCCAGGGTAGCATATGCTGG + Intergenic
1023034053 7:36115572-36115594 GGCATCAGTGGAGCACAGGCTGG + Intergenic
1023130692 7:37000027-37000049 AGCCTCAGCTGAGCAGATGCTGG - Intronic
1031840681 7:126735825-126735847 AGTCCCATTTGAGCACCTGCAGG + Intronic
1032025100 7:128435007-128435029 AGCCCCACTGGAGCCCATTATGG - Intergenic
1032269069 7:130387458-130387480 AGCCCCAGGGGAACAAATCCTGG + Intronic
1032965552 7:137093361-137093383 AGCTGCAGTGGAGCACAGCCAGG + Intergenic
1034383694 7:150720598-150720620 AGCCCAGGTGGAGCAGCTGCTGG + Exonic
1034901500 7:154910495-154910517 AGCCCAGGAGGAGCTCATGCTGG + Intergenic
1035568610 8:658307-658329 AGGCCCAGTGGAGGCCAGGCTGG - Intronic
1035598875 8:882995-883017 AGCCCGTGTGGAGCACAGGGAGG - Intergenic
1036066213 8:5384219-5384241 AGCCCCGGTTGTGCACCTGCAGG - Intergenic
1038608500 8:29035512-29035534 AGCTAAAGTGGAGCAAATGCAGG + Intronic
1040399400 8:47033469-47033491 ACCTCCACTGGAGCAGATGCTGG - Intergenic
1040524839 8:48212256-48212278 ACCTCCAATGGAGCAGATGCTGG + Intergenic
1042614939 8:70638372-70638394 AGGGCCAGTGGACCACAAGCTGG - Intronic
1043155064 8:76768616-76768638 AGGCACAGAGGAGCAGATGCAGG + Intronic
1047580751 8:126212555-126212577 AGCAGCAGTGGAGCACAGCCTGG - Intergenic
1048068556 8:130998417-130998439 AGCCACAGTGGGCCGCATGCTGG - Intronic
1051360180 9:16275350-16275372 AGGCCCACGGGAGCACATCCAGG + Intronic
1056713276 9:89008804-89008826 AGCTCCAGTTGTGCACATGACGG + Intergenic
1057186566 9:93060375-93060397 AGGCCCAGTGGAGCCCAGGGAGG + Intronic
1057266061 9:93619037-93619059 ACCCCCAGTGTACCACATGGTGG - Intronic
1060259563 9:122062086-122062108 AGCCCCATTGGGGCACACCCTGG + Intronic
1062287858 9:135781080-135781102 AGCCCCAGTGGAGGTGAAGCCGG - Intronic
1062693211 9:137856442-137856464 GGCCCTAGAGGAGCACATGCAGG + Intronic
1188285041 X:28316232-28316254 AGCTCCAGGGTAGCATATGCTGG - Intergenic
1192569022 X:72187302-72187324 AGCCCCAGAGGAGTATCTGCTGG + Intronic
1192900104 X:75487291-75487313 ACCTCCAGTGGAGCAGGTGCTGG + Intronic
1195972766 X:110491642-110491664 ACCTCCAGTGGAGCAGGTGCTGG - Intergenic
1197034600 X:121859012-121859034 ACCCCCACTGGAGCAGGTGCTGG - Intergenic
1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG + Intergenic
1198269822 X:135046234-135046256 AGCCCCACTGGTTCACATGGTGG - Intergenic
1198583804 X:138096735-138096757 GGCCCCAGGGCAGCATATGCTGG - Intergenic