ID: 1127975050

View in Genome Browser
Species Human (GRCh38)
Location 15:63990934-63990956
Sequence CAGGCAGAGGAGTAGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1378
Summary {0: 1, 1: 0, 2: 8, 3: 151, 4: 1218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127975050_1127975059 -6 Left 1127975050 15:63990934-63990956 CCCCCTCCCTACTCCTCTGCCTG 0: 1
1: 0
2: 8
3: 151
4: 1218
Right 1127975059 15:63990951-63990973 TGCCTGGCCAGGCTCCACTGTGG 0: 1
1: 0
2: 4
3: 38
4: 298
1127975050_1127975062 5 Left 1127975050 15:63990934-63990956 CCCCCTCCCTACTCCTCTGCCTG 0: 1
1: 0
2: 8
3: 151
4: 1218
Right 1127975062 15:63990962-63990984 GCTCCACTGTGGAGCCTCTGTGG 0: 1
1: 0
2: 3
3: 27
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127975050 Original CRISPR CAGGCAGAGGAGTAGGGAGG GGG (reversed) Intronic
900009011 1:89002-89024 CAGGCAGAGGAGTAGCAATGTGG - Intergenic
900049901 1:588074-588096 TCGGGAGAGGAGTGGGGAGGAGG - Intergenic
900140532 1:1137780-1137802 GAGGGAGAGGGGGAGGGAGGCGG - Intergenic
900158919 1:1214214-1214236 AGGGCAGAGGAGGCGGGAGGAGG + Intergenic
900214723 1:1475364-1475386 CAGGCAGAGGGGCAGGGCAGGGG - Intronic
900221933 1:1513714-1513736 CAGGCAGAGGGGCAGGGCAGGGG - Intronic
900297195 1:1957729-1957751 CAGGCTGAGCAGGAGGGAGCCGG + Intronic
900419724 1:2550686-2550708 CAGGAAGAGGAGGAGGCAGCCGG + Intergenic
900459296 1:2793915-2793937 GAGGTAGGGGAGTGGGGAGGTGG - Intronic
900540627 1:3200924-3200946 GAGGAAGAGGAGCAGGAAGGAGG + Intronic
900770945 1:4543616-4543638 CAGGCACAGGTGCAGGTAGGTGG - Intergenic
901059427 1:6465313-6465335 CTGACAGAGAAGTAGGGAGCTGG - Intronic
901210181 1:7520222-7520244 AGGGGAGAGGAGGAGGGAGGAGG - Intronic
901453908 1:9352638-9352660 GAGGCAGAGGAGGGAGGAGGAGG - Intronic
901462948 1:9402360-9402382 CAGGCAGAGGTGTAGGGGGAAGG - Intergenic
901475313 1:9485394-9485416 GAGGAAGAGGAGAAGGGAGTGGG - Intergenic
901511488 1:9720175-9720197 CAGGCAGATGAGCAGGGCAGCGG - Exonic
901539266 1:9904602-9904624 CTGGCAGAGAAGTAGGGATAGGG + Intronic
901634619 1:10664828-10664850 CAGGCAGAGGGGTGGACAGGTGG - Intronic
901687800 1:10953765-10953787 CAGGGAGGGGACAAGGGAGGCGG - Intronic
901756197 1:11443012-11443034 AAGGGAGAGGTGGAGGGAGGGGG + Intergenic
901788232 1:11638704-11638726 GAGGGAGAGCAGGAGGGAGGAGG - Intergenic
902105561 1:14033026-14033048 CAGACAGAGGAGCAGGGCAGAGG - Intergenic
902137225 1:14319634-14319656 CAGGCTGTCGAGAAGGGAGGAGG - Intergenic
902258548 1:15206811-15206833 GAGGCAGGGGAGCTGGGAGGAGG - Intronic
902383336 1:16062696-16062718 CATGCAGAGGAAGAAGGAGGGGG + Intronic
902614400 1:17616006-17616028 CAGGCCGAGGCCTGGGGAGGCGG + Intronic
902644435 1:17788643-17788665 CAGCAAGAGGAGTGGGGTGGGGG + Intronic
902654818 1:17859934-17859956 CAGAGGGAGGAGCAGGGAGGTGG + Intergenic
902828655 1:18995470-18995492 CCGGGAGAGGTGGAGGGAGGAGG - Intergenic
903056619 1:20640594-20640616 TGGGCAGAGGAGTAGGGAAGTGG + Intronic
903231273 1:21923714-21923736 CTGGTAAAGGAGTAGGGAGAAGG - Intronic
903573540 1:24323424-24323446 CAGGCAGAGGACTGGGAAGCAGG + Intronic
903738555 1:25544946-25544968 GGGCCAGAGGAGGAGGGAGGCGG - Intronic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
903801640 1:25973019-25973041 CAGGGACAGGAGCAAGGAGGTGG + Intronic
903930040 1:26856777-26856799 CAGGCCTGGGAGGAGGGAGGCGG - Exonic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
904016882 1:27428527-27428549 CAGGTGGAGGGGGAGGGAGGAGG + Intronic
904035861 1:27558198-27558220 CTGGGCCAGGAGTAGGGAGGTGG + Intronic
904239412 1:29134343-29134365 CAGGCGGCGGAGGCGGGAGGCGG + Intergenic
904487822 1:30839361-30839383 AAGGCAGAGGAAGAGGGGGGTGG - Intergenic
904687885 1:32273995-32274017 CTGGCAGAGGGAGAGGGAGGGGG + Intronic
904910019 1:33927767-33927789 CAGGCAGAAGAGAAGGGAGCAGG - Intronic
904921741 1:34013501-34013523 CAGGGAGATAAGTAGGGAGCTGG + Intronic
905037976 1:34929750-34929772 GAGGGAGAGGAAGAGGGAGGGGG + Intergenic
905270661 1:36785482-36785504 CATGCTGATGAGGAGGGAGGAGG + Intergenic
905323089 1:37131560-37131582 GAGGCACAGGGGTAGGGAGCAGG - Intergenic
905510959 1:38519744-38519766 AAGGGAGAGGAGAAGGGAGGGGG + Intergenic
905586075 1:39119680-39119702 CAGGTCCAGGAGCAGGGAGGGGG - Intronic
905655122 1:39682078-39682100 CAGGTAGAGTAGAAGGGATGGGG + Exonic
906180852 1:43817619-43817641 AAGGAGGAGGAGAAGGGAGGAGG - Intronic
906292908 1:44631706-44631728 CAGGCACAGGAGGCGGGAGCCGG + Intronic
906538992 1:46570490-46570512 CAGCCACTGGAGGAGGGAGGTGG + Intronic
906709471 1:47918575-47918597 AAGGAAGAGAAGGAGGGAGGGGG - Intronic
907240713 1:53079464-53079486 CAGGCACAGGAGTAGGTATGTGG + Intronic
907461155 1:54606390-54606412 CAGGCAGGGGAGTGGGGAGGAGG + Intronic
907575085 1:55519071-55519093 AAGAGAGAGGAGGAGGGAGGAGG + Intergenic
908703294 1:66924885-66924907 GAGGCCGAGGAGGAGGGCGGAGG + Exonic
908721040 1:67126255-67126277 CAGGAAGAGGAGCAGGCTGGAGG - Intronic
909075634 1:71047711-71047733 CCAGCAGCGGAGTAGGGCGGCGG - Exonic
910110587 1:83678500-83678522 CAGGGAGAGGAGTAACGAGCTGG - Intergenic
910128516 1:83873823-83873845 CAGGAAGAGGAAAAGGAAGGTGG - Intronic
910134223 1:83947714-83947736 CAGGGATGGGAGTAGGGAGTAGG + Intronic
910206360 1:84752509-84752531 GAGGCAGAAGAGAAGTGAGGGGG + Intergenic
910215392 1:84838818-84838840 TAGTCAGAGGAGCAGAGAGGTGG - Intronic
910332968 1:86097441-86097463 GAGGAAGAGGAGGGGGGAGGAGG - Intronic
910333011 1:86097550-86097572 GAGGGGGAGGAGAAGGGAGGAGG - Intronic
910541073 1:88357860-88357882 CAGAGTGGGGAGTAGGGAGGGGG + Intergenic
910721429 1:90290569-90290591 CGGGGAGAGCAGCAGGGAGGAGG + Intergenic
910745373 1:90568717-90568739 CAGAAAGAGGAGTGGGAAGGTGG - Intergenic
910759556 1:90720245-90720267 CAGGGTGGGAAGTAGGGAGGGGG + Intergenic
911133847 1:94418531-94418553 CAGGCAGAGCAGCAGGAACGCGG - Exonic
911767924 1:101701660-101701682 GAGGGAGGGGAGTGGGGAGGGGG - Intergenic
912280904 1:108312394-108312416 GAGTCAGTGGATTAGGGAGGGGG + Intergenic
912640674 1:111342627-111342649 CAGGCAGAGGCAAAGGGAGGAGG - Intergenic
912797547 1:112701969-112701991 GAGGCAGAGCAGTCAGGAGGTGG - Intronic
913076432 1:115344204-115344226 CAGGTGAAGGAGTAGGGAGAAGG - Intergenic
913083591 1:115413113-115413135 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
913142815 1:115958249-115958271 GTGCCAGAGAAGTAGGGAGGTGG + Intergenic
913450216 1:118987957-118987979 CCGGCAGAGGAGGGCGGAGGAGG - Intronic
914448943 1:147773670-147773692 CAGGAAGAGACTTAGGGAGGTGG - Intergenic
915035309 1:152918732-152918754 AAGGAGGAGGAGGAGGGAGGAGG + Intergenic
915035319 1:152918758-152918780 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
915074510 1:153297430-153297452 CAGGCAGAGGCGGGGAGAGGGGG + Intergenic
915126716 1:153670701-153670723 CGGGCCCAGGAGTGGGGAGGGGG - Intronic
915213747 1:154327273-154327295 CAGGCTGGGGAGTAAGGATGAGG + Intronic
915465614 1:156096208-156096230 CAGGCAGAGGAAACGGAAGGGGG - Intronic
915591317 1:156872284-156872306 CAGGGAGAGGTGTTGGGTGGTGG - Intronic
915597445 1:156903622-156903644 CAGGAAGTGGAGGAGGGAAGGGG + Intronic
915606723 1:156956639-156956661 CACGCAGTGGAGTGGGGAAGGGG + Intronic
915880036 1:159660088-159660110 CAGGAAGAGTAGGAGGCAGGAGG - Intergenic
916077747 1:161212297-161212319 CAGTCAGAGGAGCAGGTATGGGG - Intronic
916412334 1:164559014-164559036 TGGGGAGAGGAGGAGGGAGGAGG - Intronic
916547670 1:165821678-165821700 CAGCCACAGGAGGAGGGAAGGGG + Intronic
917062007 1:171051582-171051604 CTGGCAGAGAGGCAGGGAGGAGG + Intronic
918048834 1:180956940-180956962 AAGGCTGAGGAGTGGGGAGAGGG - Intergenic
918070168 1:181128733-181128755 CTGGCAGAGGAGCAGGGCAGAGG - Intergenic
918095446 1:181330329-181330351 CAGGCAGAGAAGAAGGGGAGAGG - Intergenic
918118570 1:181517612-181517634 GAGGCAGAGGAAAAGGGAGCAGG + Intronic
918142527 1:181731611-181731633 CAGGCACAGGCTCAGGGAGGAGG + Intronic
918202663 1:182281680-182281702 CAGGAAGAGGAGAAGGGAGGTGG + Intergenic
918904877 1:190478649-190478671 CAAGGAGAGGAATAGGGAGAAGG - Intergenic
919058082 1:192595452-192595474 GAGGAGGAGGGGTAGGGAGGAGG + Intergenic
919449336 1:197751873-197751895 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
919465395 1:197918231-197918253 CAGGGAGAGGAACTGGGAGGAGG + Intronic
919555838 1:199051798-199051820 TAGGGGGAGAAGTAGGGAGGCGG + Intergenic
919763355 1:201111944-201111966 GAGGAAGAGGAGGAGGGTGGGGG - Intronic
919777847 1:201205858-201205880 CGGGTATAGGACTAGGGAGGTGG + Intronic
919883547 1:201916642-201916664 CAGGCCGTGGTGTGGGGAGGAGG + Intronic
919907152 1:202085854-202085876 CAGGCAGCAGGGTAGGGAGCAGG + Intergenic
920037899 1:203077350-203077372 GAGGCAGAGGAGGAGAGAAGGGG - Exonic
920205497 1:204288153-204288175 CACACTGAGGAGTAGGGAGAAGG + Intronic
920249770 1:204615798-204615820 CCGTCAGAAGAGTGGGGAGGAGG + Intergenic
920293456 1:204940588-204940610 GAGGCAGAGGGGAAGGGAGAAGG - Intronic
920500364 1:206481443-206481465 GAGGTGGAGGAGCAGGGAGGAGG + Intronic
920646905 1:207810608-207810630 CAGGGACAGGAGTAGGGGAGTGG - Intergenic
920844332 1:209581118-209581140 CAGGCACAGGAGGAGGATGGAGG + Intergenic
921326042 1:213987403-213987425 GTGGCATAGGAGGAGGGAGGGGG - Intronic
921396849 1:214677782-214677804 AAGGGGGAGGAGAAGGGAGGAGG - Intergenic
921672523 1:217941940-217941962 CAATCAGAGGAGCAGGGAGGTGG + Intergenic
922023414 1:221727828-221727850 CAGTGAGAGGGGAAGGGAGGGGG - Intronic
922025356 1:221743474-221743496 CAGGGAGAAGAGTAGGGGGCGGG + Intergenic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922791872 1:228315369-228315391 AGGGCAGTGGATTAGGGAGGAGG + Intronic
922822616 1:228494489-228494511 GAGGCACAGGAGTGGGGTGGGGG - Exonic
922986302 1:229868515-229868537 TAGGCTGAGGAGGAGGAAGGAGG - Intergenic
923523809 1:234757243-234757265 CACCCAGATGAGCAGGGAGGAGG + Intergenic
923674261 1:236065830-236065852 CAGGCGGCAGAGAAGGGAGGTGG + Intergenic
924160470 1:241226514-241226536 CAGGCAGTGTAGTAGGAATGAGG + Intronic
924169708 1:241325791-241325813 CATACAGAGGGGAAGGGAGGAGG + Intronic
924311112 1:242744107-242744129 CAGGCAACAGAGTAGGGAGATGG + Intergenic
924481174 1:244435650-244435672 GAGGAAGAGGAGGATGGAGGAGG - Intronic
924847700 1:247789743-247789765 CAGACAGAGGAGAAGGGACTGGG - Intergenic
1062818971 10:519828-519850 CAAGTAGAGGAGCAGGGGGGAGG - Intronic
1062977615 10:1697120-1697142 CACCCAGATGAGCAGGGAGGTGG - Intronic
1063159445 10:3408713-3408735 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1063159483 10:3408855-3408877 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1063173369 10:3529754-3529776 GAGGAAGAGGAGGAGGGAGGAGG - Intergenic
1063515767 10:6693623-6693645 CAGGCGCAGGAGGAGGGGGGAGG - Intergenic
1064190125 10:13198589-13198611 TAGGCAGAGGAGGAGGGAGTGGG + Intronic
1064272682 10:13879723-13879745 AAGGGAGAGGAGGAGGGAGAAGG - Intronic
1064599247 10:16976446-16976468 CAGCTAGAGGAGTAGGTAGGTGG - Intronic
1064778869 10:18810834-18810856 GAGGGAGAGGGGGAGGGAGGAGG - Intergenic
1064834027 10:19505091-19505113 GAGGCAGAGGAGGAGGAAGAGGG + Intronic
1064887418 10:20125192-20125214 GAAGCAGAGTATTAGGGAGGTGG + Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065652688 10:27909960-27909982 CATGCAGAGGATGAGGGAGATGG - Intronic
1065681792 10:28242849-28242871 CAGGAAGAGGAGGAGGGGAGAGG + Intronic
1065866426 10:29919080-29919102 GAGGCAGAAGAGAGGGGAGGAGG - Intergenic
1067092687 10:43277303-43277325 CAGGCAGGGGAATAGAGAGAAGG - Intergenic
1067343006 10:45419456-45419478 CAGGCAGAGGCCTAGGGGGTGGG + Intronic
1067459347 10:46445922-46445944 CAGGCAAGGCAGGAGGGAGGAGG + Intergenic
1067461542 10:46461970-46461992 CTGGAAGAGGAGCAGGAAGGTGG + Exonic
1067523274 10:47023523-47023545 CAGGCAAGGGAGCAGGCAGGAGG + Intergenic
1067556674 10:47277892-47277914 CAGAGAGAGGGGTAGGGGGGTGG + Intergenic
1067625652 10:47922631-47922653 CTGGAAGAGGAGCAGGAAGGTGG - Intergenic
1067627847 10:47938708-47938730 CAGGCAAGGCAGGAGGGAGGAGG - Intergenic
1068724948 10:60290467-60290489 CCAGAAGAGGAGTAGAGAGGGGG + Intronic
1069567271 10:69472186-69472208 CAGGCAGAGGATGAGGGAAGGGG - Intronic
1069589485 10:69632962-69632984 CAGGAAGAGGAGCAGGATGGAGG - Exonic
1069615102 10:69801845-69801867 GAGGAGGAGGAGGAGGGAGGGGG + Intergenic
1069777763 10:70936759-70936781 AGGGCAGAGGAGGAGGGTGGAGG - Intergenic
1069862115 10:71478291-71478313 CAGGCACAGCAGGAGGGAGGGGG - Intronic
1070165224 10:73892584-73892606 CAGGCAGAGGAGTTGACATGAGG - Intergenic
1070530723 10:77335074-77335096 CAGGCACAGGAGTGTGGAGAAGG + Intronic
1070711888 10:78689055-78689077 CAGGCAGAGGTGGAGGGGAGAGG - Intergenic
1070739685 10:78894548-78894570 CAGGCAGAGGATGTGGAAGGGGG + Intergenic
1070810084 10:79293268-79293290 GAGGTGGAGGAGTGGGGAGGGGG - Intronic
1071498837 10:86189442-86189464 CAGGCAGGGGAGTAATGAGGAGG - Intronic
1071743645 10:88390508-88390530 GGGGCAGAGGAGTAGTGAGCAGG + Intronic
1072090684 10:92124155-92124177 CAGGCAGAGGTGATGGGATGGGG - Intronic
1072241010 10:93495958-93495980 CAGACAGCGGAGTGGGGGGGGGG - Intergenic
1073220517 10:101868577-101868599 TAGGCTGAGGAGGAGGAAGGAGG - Intronic
1073597767 10:104817549-104817571 AAGGGAGAGGAGGGGGGAGGGGG - Intronic
1073931032 10:108577243-108577265 CTGGCAGAGGTGTAGGAAGGAGG - Intergenic
1074428196 10:113370630-113370652 CAGCCAGAGGATTAGGAAGTAGG - Intergenic
1074522861 10:114240374-114240396 CAGACAGAAGAGAAGGGAGGAGG + Intronic
1074608155 10:114994813-114994835 GAGGCAGAGGAGGATGGTGGGGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075077469 10:119360747-119360769 GTGGAAGAGGAGGAGGGAGGAGG - Intronic
1075390759 10:122089601-122089623 CAGCCAAAGGCCTAGGGAGGCGG - Intronic
1075576325 10:123580379-123580401 CAGGGAGAGGGTCAGGGAGGTGG - Intergenic
1075605415 10:123801839-123801861 CAGACAGAGGAGGAGAGAAGAGG - Intronic
1075922508 10:126224938-126224960 CACGTAGAGGAGGAGGGTGGCGG - Intronic
1076133010 10:128026570-128026592 CAGGCAGAGAAATAAGGATGAGG - Intronic
1076346038 10:129779872-129779894 CGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076550158 10:131273030-131273052 CAGACAGAGCAGCAGGGAGTTGG + Intronic
1076676139 10:132148696-132148718 CCTGCACAGGAGGAGGGAGGAGG + Intronic
1076801927 10:132834970-132834992 CGGGCAGAGGAGATGGGTGGGGG - Intronic
1077144231 11:1037542-1037564 CAGGCAGAGGGGCAGGGACTGGG + Intergenic
1077231158 11:1458730-1458752 CAGGCCCAGCAGTAGGGAAGAGG + Intronic
1077272223 11:1686736-1686758 GAGGCAGAGAAGGAGGGAGGAGG - Intergenic
1077278974 11:1733416-1733438 CAGGCAGAGGTGGATGGAGGGGG - Exonic
1077283846 11:1757211-1757233 CTGGCACAGCAGCAGGGAGGGGG + Intronic
1077307040 11:1873086-1873108 CAGGGAGAGGTGGAGGCAGGGGG + Intronic
1077376063 11:2205566-2205588 GAGGCTGGGCAGTAGGGAGGTGG - Intergenic
1077376112 11:2205717-2205739 GAGGCTGAGAGGTAGGGAGGTGG - Intergenic
1077376127 11:2205757-2205779 GAGGCTGAGAGGTAGGGAGGTGG - Intergenic
1077376142 11:2205797-2205819 GAGGCTGGGAAGTAGGGAGGTGG - Intergenic
1077376254 11:2206132-2206154 GAGGCTGAGAGGTAGGGAGGTGG - Intergenic
1077392603 11:2307028-2307050 GAGGAAGAGGAGGAAGGAGGAGG + Intronic
1077394675 11:2315177-2315199 CGGGGAGGGGAGCAGGGAGGGGG - Intronic
1077491714 11:2863863-2863885 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1077575426 11:3379226-3379248 CAATCAGAGGAGTAGGGGCGGGG - Intergenic
1078427270 11:11261938-11261960 CAGTCAGGGGAGACGGGAGGAGG + Intergenic
1078431171 11:11289933-11289955 CAGGCAGAGGAGTCTGAAGAGGG + Intronic
1078473957 11:11614381-11614403 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1078531363 11:12139207-12139229 AGGGCAGAGGAGGAGGGAGGAGG - Intronic
1078934500 11:15939555-15939577 GACCCAGAGGACTAGGGAGGAGG + Intergenic
1079810948 11:24999359-24999381 GAGGAAGAGGAGGAAGGAGGAGG + Intronic
1080229501 11:30003069-30003091 TAGGAACAGGAGCAGGGAGGAGG - Intergenic
1080672630 11:34395170-34395192 CAGCCAGAGGAGTGGGGTTGTGG - Intergenic
1080923997 11:36737280-36737302 CAGGCAGAGACAAAGGGAGGAGG - Intergenic
1080959584 11:37142745-37142767 CAGGCTGTAGAGTAGGGAGAGGG - Intergenic
1081459310 11:43256863-43256885 CAGGCAGAGGCGGGTGGAGGGGG + Intergenic
1081775963 11:45676107-45676129 TGGGCAGTGGAGGAGGGAGGGGG - Intergenic
1081805875 11:45890233-45890255 CAGCCAGAGGAGCTGGCAGGGGG + Intronic
1081913787 11:46718356-46718378 GAGGGACAGGAGTAGGGCGGAGG + Intergenic
1083307621 11:61769389-61769411 GAGGTAGGGGAGGAGGGAGGGGG + Intronic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1083764460 11:64835400-64835422 CAGGCCGAGTGGTAAGGAGGAGG - Exonic
1083828294 11:65215473-65215495 AGGGCAGAGGAGAAGGGAGAGGG - Intergenic
1084040379 11:66539330-66539352 TAGGCAGAGGAGTGCAGAGGAGG - Exonic
1084104267 11:66970801-66970823 AAGGCAGAGAAGCAGTGAGGAGG + Intergenic
1084122371 11:67077280-67077302 CAGGGTGAGGAGGATGGAGGAGG - Intergenic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084529282 11:69717523-69717545 CAGAGAGGGGAGGAGGGAGGAGG - Intergenic
1084557531 11:69883826-69883848 CAGACACAGGAGCAGGGAGCTGG + Intergenic
1084760680 11:71268741-71268763 GAGGAGGAGGAGAAGGGAGGAGG + Intergenic
1084978945 11:72818384-72818406 AAGGGACAGGAATAGGGAGGAGG - Intronic
1085390250 11:76178625-76178647 CAGGCAGAGGTGTGGGGCTGTGG + Intergenic
1085396606 11:76209889-76209911 CAGGCTGGGGGCTAGGGAGGAGG - Intronic
1085459738 11:76686391-76686413 AAGGAAGTGGAGCAGGGAGGGGG + Intergenic
1085702242 11:78755647-78755669 CAGGCTGAGGAGCAGAGAGCAGG - Intronic
1086302934 11:85448917-85448939 AAGGAAGAGGAGGAGGGAGAGGG - Intronic
1086539915 11:87896653-87896675 CAGGCAGAGGAAAACAGAGGAGG + Intergenic
1086896551 11:92319880-92319902 ATGGGAGAGGAGTAGGGATGAGG + Intergenic
1087822274 11:102725846-102725868 CAGGCAGAAGACAAGGGAGAGGG + Intronic
1087848046 11:102995538-102995560 CAGCCACAGAAGTAGGGAGTAGG - Intergenic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1088779547 11:113121133-113121155 GAGACAGAGGATTAGGGGGGTGG + Intronic
1088917201 11:114236644-114236666 CAGACAGAGGGCTAGGGATGAGG - Intronic
1088924418 11:114285794-114285816 CAGGAAGAGGTGAAGGGAGCAGG + Intronic
1089017179 11:115175526-115175548 CAGGAGGGGAAGTAGGGAGGGGG - Exonic
1089048599 11:115526193-115526215 CAGGCAGGGGGGAAGTGAGGTGG - Intergenic
1089083650 11:115798605-115798627 CAGGAAGAGGAGGAGGACGGGGG - Intergenic
1089342496 11:117767962-117767984 CAGGCAGAAGAGGAGTGAGAGGG - Intronic
1089497133 11:118913557-118913579 CAGGGGGAGGGGTAGAGAGGGGG + Intronic
1089499641 11:118924849-118924871 CAGCCAGAGGAGGAGGGCTGGGG + Intronic
1089612534 11:119677484-119677506 AAAGGAGAGGAGGAGGGAGGAGG + Intronic
1089625402 11:119747967-119747989 CAGGAAGAGGAGGAGAGAGGTGG + Intergenic
1089627574 11:119761432-119761454 CAGACAGAGGTGGTGGGAGGGGG - Intergenic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1090627380 11:128618703-128618725 GAGGCTGAGGAGCAAGGAGGAGG + Intergenic
1091636328 12:2199709-2199731 CTGACAGAGGAAAAGGGAGGGGG - Intronic
1091696897 12:2633745-2633767 GAGGCAGAGGAGGAGGAATGAGG - Intronic
1091783226 12:3227070-3227092 CAGGCAGAGGCCCAGGGACGAGG - Intronic
1091797793 12:3307110-3307132 CAGCCAGAGGTGGTGGGAGGCGG + Intergenic
1091800703 12:3322996-3323018 AAGGCAGAGGAAAAGGGAGAAGG + Intergenic
1091818895 12:3459688-3459710 GAAGCAGAGGAGCAGGGAGAAGG + Intronic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1092253280 12:6913261-6913283 CAGGCAGAGGAGTTGGTGGGGGG + Intronic
1092282614 12:7109075-7109097 CCGGCAGAGGAGGAGGGAAGAGG - Intronic
1092285676 12:7128131-7128153 CAGCCAGAGCAGCGGGGAGGAGG - Intronic
1092549129 12:9478630-9478652 CAGGCAGGGGAGGAGGGCAGAGG + Intergenic
1092697253 12:11186572-11186594 CAGCCAGAGGAAAAGGGAGTGGG + Exonic
1092793985 12:12092575-12092597 CAGGCAGGGGAGGGGTGAGGAGG + Intronic
1092986613 12:13851925-13851947 TAGGCAGAGGAGGAGGAGGGTGG + Intronic
1093125252 12:15321712-15321734 CAGGCAGAGGAGGAGGAAGAGGG + Intronic
1093530402 12:20155030-20155052 GAAGAAGAGGAGGAGGGAGGGGG + Intergenic
1093622760 12:21312004-21312026 GAAGAAGAGGAGGAGGGAGGAGG + Intronic
1093844525 12:23952197-23952219 CAGGAAGAGGAGGAGGCGGGAGG + Intergenic
1094164445 12:27427917-27427939 CAGGCAGAAGGGTAGGGAATGGG + Intergenic
1094216944 12:27952439-27952461 CAGGGAAAGGGGGAGGGAGGGGG + Intergenic
1094353301 12:29550463-29550485 CAGACAGAGGAGCGAGGAGGTGG + Intronic
1094503867 12:31043837-31043859 CAGGCAGGGGAGGAGGGCAGAGG - Intergenic
1094795181 12:33963810-33963832 CAGGCAGACAAGTAGGCAGATGG + Intergenic
1095107811 12:38256906-38256928 CAGGCAGACAAGTAGGCAGATGG + Intergenic
1095864784 12:46959582-46959604 CAAGGAGATGAGAAGGGAGGGGG - Intergenic
1095904246 12:47361151-47361173 CAGGCAGTGGGGCAGGGAAGAGG - Intergenic
1095947481 12:47761698-47761720 CAGTCAGAGGAGGGTGGAGGCGG - Intronic
1096101109 12:48970957-48970979 TAGGGAGAGGGATAGGGAGGAGG + Intronic
1096148471 12:49294798-49294820 CTGGCACAGGAGTAGGGAGGAGG - Exonic
1096188306 12:49598579-49598601 CAGGGAGAGGTGAAGGCAGGTGG - Intronic
1096229059 12:49887485-49887507 CAGTCAGAGGGGCAGGGAGGAGG + Intronic
1096229570 12:49889535-49889557 CAGGCACAGCAGCACGGAGGTGG + Exonic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096560792 12:52434351-52434373 CAGGCAGTGGAGAAGACAGGTGG + Exonic
1096595019 12:52689496-52689518 TAGGGGGAGGAGGAGGGAGGAGG + Intergenic
1096675241 12:53222531-53222553 CAGGGAGGGGGGTTGGGAGGAGG + Intronic
1096718908 12:53506940-53506962 GAGGAAGAGGAGAAGGAAGGGGG - Intronic
1096758094 12:53816871-53816893 CAGGCAGAGGAGGCGGGTTGGGG - Intergenic
1096783123 12:54002034-54002056 GGGGCAGAGGAGGAGGGAGGTGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096799680 12:54101901-54101923 AAGGCAGAGGAGGAGGAAGAAGG - Intergenic
1096800413 12:54106871-54106893 CAGGCGGAGGCGGAGGGTGGTGG - Intergenic
1096870810 12:54590926-54590948 GAGGCAGCGGAGGAGAGAGGAGG + Intergenic
1097191230 12:57220535-57220557 CAGGCAGGGGTAGAGGGAGGGGG + Intronic
1097361945 12:58668163-58668185 CTGGCAGGGGAATAAGGAGGTGG + Intronic
1097637644 12:62142244-62142266 CAGGCAGAGCATTAGGGGTGTGG - Intronic
1097821868 12:64135904-64135926 CAGGCTGAGGAGCAAGGAGTCGG + Intronic
1097938395 12:65278541-65278563 AGGGCAGAGGAGGAGGGAGTTGG + Intergenic
1098105897 12:67069049-67069071 CAGGCAGAGGAGCAGGAGAGAGG - Intergenic
1098116547 12:67184739-67184761 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1098916488 12:76261829-76261851 CTGGAAGAGGGGTAGGGAGGAGG + Intergenic
1099435700 12:82642640-82642662 GAGGCAGAGCATTAGGTAGGGGG + Intergenic
1099799705 12:87442117-87442139 CAGGTAGAGGAGCAGGTAGGTGG - Intergenic
1100614441 12:96220185-96220207 CAGGCAGAGGAGCAGTGGTGGGG - Intronic
1100748046 12:97667252-97667274 CAAGCAGAAGAGAAGGGAAGAGG + Intergenic
1100883690 12:99045925-99045947 CAGGCAGAGTATTAGAGAGCAGG + Intronic
1101245736 12:102882979-102883001 GAAGAAGAGGAGGAGGGAGGAGG + Intronic
1101519452 12:105467970-105467992 GACACAGAGGAGCAGGGAGGTGG + Intergenic
1101605999 12:106248009-106248031 CGGGCCGAGGAGGCGGGAGGAGG + Intronic
1101843099 12:108341931-108341953 CAAGTAGAGGAGAGGGGAGGGGG + Intergenic
1102167805 12:110820591-110820613 GGGGGAGAGGAGGAGGGAGGGGG - Intergenic
1102230253 12:111257261-111257283 GAGGAAGAGGAAAAGGGAGGAGG - Intronic
1102255786 12:111414200-111414222 CAGGCAGATGGGAAGGGAGAGGG - Intronic
1102749150 12:115277185-115277207 GAGGAGGAGGAGGAGGGAGGCGG + Intergenic
1102753871 12:115320966-115320988 AAGGCAGGGGAGTTTGGAGGAGG + Intergenic
1102913676 12:116737566-116737588 CAGGGAGAGGGGAAGGAAGGAGG + Intronic
1102919548 12:116781597-116781619 AAGGCAGAGGTGTAGGGGGAGGG - Intronic
1102972295 12:117178781-117178803 AAGGCAGGGGAGTGGTGAGGGGG - Intronic
1103005088 12:117414632-117414654 CAGGAAGAGGAGGAGGAAGGAGG - Intronic
1103411675 12:120716636-120716658 GAGGATGAGGAGGAGGGAGGTGG + Exonic
1103710654 12:122910129-122910151 CACGCAGATAACTAGGGAGGCGG + Intergenic
1103737626 12:123070576-123070598 CAGCCAGTGGAGCTGGGAGGGGG - Intronic
1103967123 12:124646947-124646969 CAGGTAGAAGAGTTGGGGGGAGG - Intergenic
1103983175 12:124750031-124750053 CAGGCAGCGGGGCGGGGAGGGGG + Intergenic
1104017911 12:124972672-124972694 CAGGCCGTGGAGCAGGCAGGCGG + Intronic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1104781277 12:131422095-131422117 CAGGTGGAGGAGGAGGGAGGAGG - Intergenic
1104952248 12:132446506-132446528 CAGGCAGGGGGCTAGGGAGTGGG - Intergenic
1106415624 13:29543696-29543718 GAGGGAGAGGGGTGGGGAGGAGG + Intronic
1106415639 13:29543743-29543765 GAGGAAGAGGGGTGGGGAGGAGG + Intronic
1107445859 13:40469999-40470021 AAGGCAGAGAAGTGAGGAGGAGG + Intergenic
1107588591 13:41880279-41880301 CAGGGGGAGTAGGAGGGAGGGGG - Intronic
1107890061 13:44906260-44906282 CAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1108028792 13:46206689-46206711 CTGGGAGAGAAGTAGGGAGTTGG + Intronic
1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG + Intergenic
1108215670 13:48181850-48181872 CAGACAGGGGAGTATGGAGTAGG - Intergenic
1108709088 13:53015745-53015767 CAGGCAGGGGAAGAGGGTGGTGG - Intergenic
1108954244 13:56132501-56132523 GAGGCAGAGGCTGAGGGAGGGGG + Intergenic
1110356770 13:74575906-74575928 CAGGCCGTGGAGGAGGGGGGAGG + Intergenic
1110778184 13:79433747-79433769 GAGACAGAGGAGGAGGAAGGAGG + Intergenic
1112506926 13:99981133-99981155 GAGGCGGGGGAGTAGGGGGGAGG - Intergenic
1113059325 13:106304666-106304688 CAGACTGTGGAGGAGGGAGGTGG + Intergenic
1113147232 13:107220825-107220847 CAGAGAGAGGAGTGGGGTGGAGG + Intronic
1113159613 13:107365021-107365043 AAGGAGGAGGAGGAGGGAGGGGG - Intronic
1113385290 13:109842788-109842810 CAGGCCCAGGAGTGGGGATGGGG - Intergenic
1113438531 13:110311127-110311149 GAAGCAGAGGAGGAAGGAGGGGG - Intronic
1113467617 13:110523456-110523478 CTGTCAGAGGGGTGGGGAGGTGG - Exonic
1113517240 13:110913344-110913366 CACGCAGAAGCGCAGGGAGGAGG + Intronic
1113665116 13:112136141-112136163 GAGGCAGAGGCCTAGGCAGGAGG - Intergenic
1113708814 13:112450999-112451021 GACGCAGAGGGGCAGGGAGGAGG + Intergenic
1114397764 14:22382505-22382527 CAGGGAGAGGAGTAGGCTGATGG + Intergenic
1114476360 14:22997987-22998009 GAGGCAGAGGTGGAGAGAGGAGG - Intronic
1114525877 14:23366492-23366514 CATGCAGCGGAGTCCGGAGGAGG - Intergenic
1114735577 14:25040280-25040302 GAGGCAGAGGACAAGGGAGGTGG + Intronic
1115027011 14:28757902-28757924 CATGCTGAAGAGCAGGGAGGAGG - Intergenic
1115098285 14:29666406-29666428 CAGGAAGAGGAGAAGAGAGATGG - Intronic
1115162817 14:30414601-30414623 CAAGCAGAGAGGTAGTGAGGTGG + Intergenic
1117878441 14:60281297-60281319 GAGGCAGAGGAGTAGGCAGATGG + Intronic
1118270547 14:64338715-64338737 CAGGGAGAGGAGCCGGGTGGGGG - Intergenic
1118327355 14:64790704-64790726 CAGGCACAGGTGTGGGGAAGGGG + Intronic
1118487581 14:66228393-66228415 CAGGCAGAGGGCTAGGGAATGGG + Intergenic
1118546851 14:66900536-66900558 CAGGAAGGGTAGTGGGGAGGAGG - Intronic
1119067408 14:71542659-71542681 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1119067420 14:71542698-71542720 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1119859099 14:77923870-77923892 CAGGGAGGGGAGCAGGGAGAGGG + Intronic
1119925390 14:78488782-78488804 GAGGGGGAGGAGAAGGGAGGAGG + Intronic
1120306945 14:82782845-82782867 CAGACAGAGGAGGAGGAAGAAGG - Intergenic
1120782845 14:88501585-88501607 AAGGCAGATGAGTGGGAAGGTGG + Intronic
1120932173 14:89859776-89859798 CAGGCAGAGGAGGGGGCATGAGG + Intronic
1120989209 14:90360371-90360393 AAGGGAGAGTAGAAGGGAGGAGG + Intergenic
1121457631 14:94048790-94048812 CAGATACAGGAGTGGGGAGGGGG + Exonic
1121523766 14:94604196-94604218 CAGGAAGGGGAGTAGGAAGGAGG - Intronic
1121539006 14:94711225-94711247 CAGGCGGAGGGGTGGAGAGGGGG - Intergenic
1121787506 14:96673547-96673569 CAGGCAGGGGAGAAGGGGAGGGG - Intergenic
1121928323 14:97949065-97949087 CAGGCAGAGGGGTTGGCAAGCGG + Intronic
1122081151 14:99268821-99268843 GAGGCAAAGGAGAAGAGAGGTGG - Intronic
1122089080 14:99326265-99326287 CAGGCAGAGGAGAGAGGAGAGGG - Intergenic
1122171606 14:99880511-99880533 GAAGGAAAGGAGTAGGGAGGTGG + Intronic
1122545544 14:102520151-102520173 AAGCCAGAGGCGTGGGGAGGGGG - Intergenic
1123474996 15:20582915-20582937 CCGGCAGAGGAGGAGCGGGGCGG - Intergenic
1123709260 15:22974911-22974933 AAGGCAGAAGTGGAGGGAGGTGG - Intronic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124957786 15:34370953-34370975 AAGGAAGAAGAGGAGGGAGGGGG - Intergenic
1125024813 15:35019519-35019541 AAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1125386540 15:39142714-39142736 CTGGCAGAGCAGGAGGAAGGAGG - Intergenic
1125402383 15:39318004-39318026 AAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1125513952 15:40307715-40307737 CAGGCAGAAGGGCAGGAAGGAGG + Exonic
1126473954 15:49046576-49046598 AAGGAAAAGGAGTGGGGAGGAGG + Intergenic
1126962124 15:54008712-54008734 CAGAGAGAGGAGTAGGTATGTGG + Intergenic
1127383774 15:58451208-58451230 CAGGTAGAGCAGTGGGGTGGAGG + Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128511274 15:68315494-68315516 GAGGCAGTGGGGTGGGGAGGTGG - Intronic
1128603113 15:69014641-69014663 CAGGAAGAGGAGGAGTCAGGGGG + Intronic
1128646153 15:69380257-69380279 CAGGCACCGGAGCAGGGAGCAGG - Intronic
1128674725 15:69600164-69600186 CAGGCAGAGGGGTGGGAGGGGGG + Intergenic
1128756125 15:70185219-70185241 GAAGGAGAGGAGGAGGGAGGAGG + Intergenic
1128815038 15:70602192-70602214 GGGGCTGAGGAGTAGGGAAGTGG - Intergenic
1128897835 15:71391990-71392012 CTGGAAGAAGAGTAGGGAGATGG - Intronic
1128971594 15:72111886-72111908 GAGGCAGAGGTGGAGGTAGGAGG - Intronic
1129165245 15:73773575-73773597 GAGGCAGAAAAGGAGGGAGGAGG - Intergenic
1129165618 15:73775487-73775509 GAGGCTGAGGAGTAGGGAGAGGG + Intergenic
1129665627 15:77577986-77578008 CAGGCAGAGATAGAGGGAGGAGG + Intergenic
1129702562 15:77776131-77776153 CAGGGGGAGGAGCTGGGAGGGGG - Intronic
1130226104 15:82059185-82059207 GAGGAAGAGGAGTGGGGAGGAGG - Intergenic
1130373643 15:83308889-83308911 CAGGCAGAGAAGTGGCTAGGTGG - Intergenic
1130461345 15:84159885-84159907 CAGTCTGAGGTGGAGGGAGGGGG + Intergenic
1130721101 15:86386258-86386280 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1130902099 15:88214966-88214988 CGGGCAGAGGAGTGGGGAGCAGG - Intronic
1131058868 15:89392217-89392239 CAGCCAGAGGATTTGGGAGCTGG - Intergenic
1131139825 15:89968115-89968137 AAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1131256994 15:90869660-90869682 CAGGCAGAGGCGGTGGGAAGTGG - Intronic
1131382536 15:91975706-91975728 CAGGTGGAGGCGTAGGAAGGAGG - Intronic
1131457871 15:92597342-92597364 GAGGGAGAGCAGGAGGGAGGTGG + Intergenic
1131499908 15:92952317-92952339 CAGGCTGGGGAGGAGGGAGGGGG + Intronic
1131512626 15:93057643-93057665 CAGGAAGGAGAGGAGGGAGGCGG - Intronic
1131901107 15:97088668-97088690 GAGGAAGAGGAGGAGGAAGGAGG - Intergenic
1131901117 15:97088706-97088728 GAGGAAGAGGAGGAGGAAGGAGG - Intergenic
1131990274 15:98086445-98086467 GAGGGAGAGGAAAAGGGAGGAGG + Intergenic
1132751852 16:1461288-1461310 GAGTCAGAGGAGGAGGGAGGAGG + Intronic
1132783487 16:1641762-1641784 CAGGCTGTGGAGTAGGGTGGCGG - Intronic
1132819734 16:1858467-1858489 GAGGCCGAGCAGTGGGGAGGAGG - Intronic
1132955949 16:2593631-2593653 CAGGCAGATGAGGACGGAGAGGG - Intronic
1132998738 16:2838565-2838587 AAGGCAGAGGAGTTGGAAGGAGG + Intronic
1133102220 16:3486397-3486419 CAGCCTGAGGAGGAGGGAGAGGG + Exonic
1133244607 16:4439763-4439785 CTGGCAGAGGAGGAGTCAGGTGG - Intronic
1133379233 16:5316023-5316045 CAAGGAGAGGAGTAGGGCGGGGG - Intergenic
1133686288 16:8168353-8168375 CAGAAAGTGGAGTGGGGAGGAGG + Intergenic
1133823298 16:9256190-9256212 AAGGCAGATCAGTGGGGAGGGGG - Intergenic
1133883668 16:9806568-9806590 GAGGAAGAGAACTAGGGAGGAGG + Intronic
1134066767 16:11233345-11233367 GAGGCAGCGGAGGAGGAAGGGGG - Intergenic
1134461716 16:14435216-14435238 AAGGGAGAGGAGCAGGAAGGGGG + Intergenic
1134777381 16:16864975-16864997 CAGGGGAAGGGGTAGGGAGGAGG - Intergenic
1134884190 16:17775396-17775418 CAGGAAGATGAATGGGGAGGAGG - Intergenic
1135121712 16:19771862-19771884 GAGGCAGAGGTTTATGGAGGAGG + Intronic
1135146724 16:19969128-19969150 CAGTCAGTGGAGATGGGAGGGGG + Intergenic
1135420435 16:22302206-22302228 CAGGTAGGGGAGTTGAGAGGCGG - Intronic
1135496733 16:22958412-22958434 CAGACAGAGGAGTGGGGAGGAGG - Intergenic
1135636080 16:24076818-24076840 CAGGCAGAGGCATAGGGTGGGGG + Intronic
1135649940 16:24197333-24197355 CAGGAAGAAGATGAGGGAGGTGG + Intronic
1136296872 16:29308891-29308913 CAGGCAGAGGAGACGGGCAGAGG - Intergenic
1136428595 16:30184606-30184628 GAGGCAGAGGTATGGGGAGGAGG + Intronic
1137018284 16:35397189-35397211 CAGGATGAGGGGCAGGGAGGAGG - Intergenic
1137260164 16:46820070-46820092 CATGCAGAGAAATAGGGAGGTGG - Intronic
1137349894 16:47704320-47704342 CTGTCAGAGGGGTGGGGAGGAGG + Intergenic
1137486768 16:48897792-48897814 GATGCTGAGGAGTGGGGAGGAGG + Intergenic
1137581373 16:49635617-49635639 CAAGGAGAGGAGCAGGGAGCAGG + Intronic
1137697128 16:50468844-50468866 CAGAGAGAGGACTAGGGAGCCGG - Intergenic
1138083744 16:54115535-54115557 CAGGCTGTGGGGAAGGGAGGTGG + Exonic
1138126155 16:54440442-54440464 AGGGCGGAGGAGGAGGGAGGAGG - Intergenic
1138250760 16:55500009-55500031 GGGGCAGAGTAGTGGGGAGGAGG - Intronic
1138309552 16:56011693-56011715 AAGGCAGGGGAGTAGGGAGTGGG + Intergenic
1138337848 16:56267137-56267159 CAGGTAGAAGAAGAGGGAGGAGG + Intronic
1139165767 16:64563370-64563392 GAGGAAGAGGAGGAAGGAGGAGG + Intergenic
1139327692 16:66164811-66164833 CAGGGAGGGGAGGAGGGTGGTGG - Intergenic
1139352017 16:66342836-66342858 CAGGAAGAGGAACGGGGAGGTGG - Intergenic
1139425063 16:66874057-66874079 GAGGTAGAGGAGGAGGGAGGAGG - Intergenic
1139443967 16:66985320-66985342 CAGGCAGAGGACAGGGGAAGGGG - Intergenic
1139545837 16:67649178-67649200 GAGGCCCAGGAGTAGGGTGGGGG - Intronic
1139612172 16:68067132-68067154 GAGGGAGGGGAGAAGGGAGGGGG - Intronic
1139613640 16:68076024-68076046 CTGGCAGAGGTGTGGAGAGGGGG + Intronic
1139946282 16:70644735-70644757 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1139946290 16:70644758-70644780 GAGGAAAAGGAGGAGGGAGGAGG + Intronic
1139946298 16:70644781-70644803 GAGGAAAAGGAGGAGGGAGGAGG + Intronic
1139946340 16:70644947-70644969 GAGGAAGAGGAGGAGGAAGGAGG + Intronic
1139972919 16:70787403-70787425 CAGGGAGAGGAGCAGGTCGGAGG + Intronic
1140205913 16:72933315-72933337 CTCCCAGAGGAGTAGGAAGGTGG + Intronic
1140332244 16:74069540-74069562 CAGGCATAGGAGTATGGGGCAGG + Intergenic
1140470543 16:75211758-75211780 AAGGCAGAGGACTTGGGAGCTGG + Intergenic
1140485515 16:75290168-75290190 CAGGCAGAGGACCAAGCAGGTGG - Intergenic
1140830369 16:78745298-78745320 AAGGCAGAGGTGGAGGAAGGCGG - Intronic
1141372456 16:83500509-83500531 GAGGGGGAGGAGGAGGGAGGAGG - Intronic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141772230 16:86096361-86096383 CAGGCAGTGGAGCAGGGATGGGG - Intergenic
1141775670 16:86121462-86121484 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1141995157 16:87632300-87632322 CAGGCAGAGGAGGGTGGGGGAGG - Intronic
1142160445 16:88554812-88554834 CAGCGGAAGGAGTAGGGAGGAGG - Intergenic
1142455324 16:90217962-90217984 CAGGCAGAGGAGTAGCAATGTGG + Intergenic
1142581971 17:948840-948862 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582017 17:948953-948975 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582057 17:949047-949069 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582088 17:949123-949145 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582116 17:949199-949221 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582144 17:949275-949297 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582172 17:949351-949373 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582200 17:949427-949449 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582227 17:949503-949525 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582242 17:949541-949563 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582263 17:949598-949620 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582278 17:949636-949658 CGGGGAGAGGAGGAGGCAGGGGG - Intronic
1142582299 17:949693-949715 CAGGGAGAGGAGGAGGCAGGGGG - Intronic
1142614717 17:1127588-1127610 CCTGGAGAGGAGGAGGGAGGAGG - Intronic
1142849039 17:2695549-2695571 GAGGCAGAGGAGCTGGGTGGGGG - Intronic
1143352385 17:6298220-6298242 CTGGTAGAAGAGGAGGGAGGCGG - Intergenic
1143477030 17:7208694-7208716 CAGCCAGAGGGGTAGGGGAGGGG - Intronic
1143508132 17:7380870-7380892 CGAGCAGAGGAGAAGGGAAGGGG + Exonic
1143512985 17:7405972-7405994 AAGGCAGAGGGATAGGGAGAAGG + Intronic
1143570580 17:7755511-7755533 GAGGAAGTGAAGTAGGGAGGGGG + Intronic
1143583211 17:7838330-7838352 GAGGAGGAGGAGGAGGGAGGGGG + Intergenic
1143764446 17:9128378-9128400 CAGGGAGAGGTGTTGAGAGGTGG + Intronic
1143866292 17:9926247-9926269 CAGGAAGGAGAGCAGGGAGGCGG + Intronic
1144074236 17:11702530-11702552 GAGCCAGAGGAGGAGGAAGGAGG + Intronic
1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG + Intergenic
1144552802 17:16256422-16256444 GAGGCAGAGGAATCGGGAGGTGG - Intronic
1144580468 17:16456179-16456201 GAGGAAGAGGAGGAAGGAGGAGG + Intronic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145252033 17:21301954-21301976 CAGGCAGAGTTGGAGGGTGGGGG + Intronic
1146127126 17:30238489-30238511 CAGGCAGGGGAGCAGGGCGCGGG - Intergenic
1146642265 17:34550327-34550349 CAGGCAGAGCCGTCAGGAGGTGG + Intergenic
1146744193 17:35313714-35313736 CAGGCAGAGCACTTGGGCGGTGG + Intergenic
1147303642 17:39548884-39548906 CAGGCATGGGGGTAGGAAGGAGG - Intronic
1147383860 17:40070705-40070727 CAGGCAGAGGGGAAGGGGAGAGG + Intronic
1147464172 17:40597943-40597965 CAGGCTGGGGAGTAGAGAAGGGG + Intergenic
1147864049 17:43541438-43541460 GAGGCAGATGATTAAGGAGGGGG + Intronic
1147917967 17:43900037-43900059 AAGGAACAGGAGTGGGGAGGAGG + Intronic
1147978374 17:44260543-44260565 CAGGCAGTGGAGGAGTGAGCTGG + Intronic
1148130205 17:45257717-45257739 CCGGCAGAGGAGCAGGAATGGGG - Intronic
1148211706 17:45812804-45812826 CAGGCGGAGAGGGAGGGAGGTGG - Intronic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148395408 17:47304230-47304252 CTGGGAGATGAGCAGGGAGGCGG - Intronic
1148683587 17:49488274-49488296 CTGGCAGGGGAGCAGGGAGGGGG - Intergenic
1148737102 17:49871047-49871069 CGGGGAGAGGAGCAGGGAGGAGG - Intergenic
1148739008 17:49881298-49881320 GAGGGAGGGGAGAAGGGAGGGGG - Intergenic
1148785538 17:50144431-50144453 CAGGCTGTGATGTAGGGAGGGGG - Intronic
1148806392 17:50266185-50266207 CGGGCAGAGGAAGTGGGAGGAGG - Intergenic
1148848961 17:50545242-50545264 CATGCAGAGGAGCAGAGAAGAGG - Intronic
1148988682 17:51646691-51646713 CAGGCAGGGGAGTCTGGAGTAGG - Intronic
1149297216 17:55271894-55271916 CAGTTAGAGGAATAGGGATGGGG - Intronic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1149632843 17:58141787-58141809 GAGGGAGAGGAAGAGGGAGGGGG - Intergenic
1149882951 17:60310991-60311013 TAGGAAGAGTAGTGGGGAGGAGG + Intronic
1149992590 17:61391213-61391235 GAGGCAGAGGAGGAGGAGGGCGG + Intronic
1149992652 17:61391502-61391524 CAGGCAGGGCAGGAGAGAGGTGG + Intronic
1150285995 17:63954484-63954506 CAGGCATGGGGGAAGGGAGGAGG + Intronic
1150644282 17:66968509-66968531 GAGGCAGAGGAGGAGGGTAGGGG - Intronic
1150644302 17:66968563-66968585 GAGGGAGAGGAGGAGGGAAGGGG - Intronic
1150683558 17:67302333-67302355 CATCCAGAGGAGTGGGGAGCAGG + Intergenic
1150890549 17:69144258-69144280 GAGGAAGAGGAGGAAGGAGGAGG - Intergenic
1150926958 17:69542575-69542597 CAGGTAGATGAATAGGTAGGTGG - Exonic
1151046218 17:70922625-70922647 AAAGCAGAGGAGTGGGGAGTGGG + Intergenic
1151278876 17:73056751-73056773 CAGTTAGAGGAGTAGATAGGAGG - Intronic
1151310646 17:73290694-73290716 AAGACAGAGAAGCAGGGAGGCGG + Intronic
1151322442 17:73360005-73360027 CAGGCTGAGAGGTGGGGAGGTGG - Intronic
1151475125 17:74340853-74340875 CAGGCAGGGCTGTAGCGAGGTGG + Intronic
1151557058 17:74851976-74851998 GGGGCATAGGGGTAGGGAGGTGG - Intronic
1151604607 17:75128612-75128634 CGGGCAGGGGAGGTGGGAGGAGG + Intronic
1151635466 17:75344845-75344867 CAGGCGGGGGGGTTGGGAGGGGG - Intronic
1151677982 17:75609644-75609666 GAGAGAGAGGAGGAGGGAGGAGG - Intergenic
1151683481 17:75633867-75633889 GAGGGAGAGGAGGAGGAAGGAGG + Intronic
1151780384 17:76241012-76241034 CATGCAGGGGGGTAGGGAGAGGG + Intergenic
1152000076 17:77639889-77639911 AGGGAAGAGGAGGAGGGAGGAGG - Intergenic
1152000084 17:77639912-77639934 AGGGAAGAGGAGGAGGGAGGAGG - Intergenic
1152013733 17:77736036-77736058 AAGAGAGAGGAGTGGGGAGGTGG + Intergenic
1152043047 17:77917429-77917451 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1152110905 17:78357407-78357429 CAGCCAGGGAAGTGGGGAGGGGG - Exonic
1152124552 17:78438431-78438453 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1152271004 17:79324841-79324863 CAGGCAGAGAAGCAGGAAGAGGG + Intronic
1152291449 17:79442193-79442215 AAGAGAGAGGAGGAGGGAGGGGG + Intronic
1152498240 17:80690212-80690234 CAGCCAGGGGAGTGGGAAGGGGG - Intronic
1152598373 17:81249250-81249272 GGGGAAGAGGAGGAGGGAGGAGG + Intronic
1152626653 17:81390719-81390741 CAGGCAGATGGGTGGGGTGGGGG + Intergenic
1152640722 17:81448184-81448206 CTGGCAGAGCAGGAGGCAGGCGG - Intronic
1152687487 17:81701763-81701785 TAGGCTGAGGACAAGGGAGGTGG - Exonic
1152745053 17:82034686-82034708 CAGGCAGAGGGGCAGGGTGGAGG + Intergenic
1152772913 17:82181121-82181143 GAGGCAGAGGGGCAGAGAGGAGG + Intronic
1152838211 17:82549146-82549168 CACCCAGAAGAGGAGGGAGGTGG - Intronic
1153328568 18:3848287-3848309 GAGGAGGAGCAGTAGGGAGGAGG + Intronic
1153575537 18:6516541-6516563 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1153770502 18:8412044-8412066 AAGGCTGAGGAAAAGGGAGGTGG + Intergenic
1153797108 18:8633916-8633938 AAGGCAGAGCAGTTGGGAGTGGG + Intronic
1154110887 18:11567568-11567590 ATGGCAGAGGAGGAGGGAGAAGG + Intergenic
1155066491 18:22273654-22273676 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1155066575 18:22273870-22273892 AGGGAAGAGGAGGAGGGAGGAGG - Intergenic
1155066591 18:22273919-22273941 AGGGAAGAGGAGGAGGGAGGAGG - Intergenic
1155066600 18:22273945-22273967 AGGGAAGAGGAGGAGGGAGGAGG - Intergenic
1155066614 18:22273984-22274006 AGGGAAGAGGAGGAGGGAGGAGG - Intergenic
1155066623 18:22274010-22274032 GAGGAAGAGGAGGAGGGAGGAGG - Intergenic
1156087841 18:33429340-33429362 AAAGCAGAGAAGGAGGGAGGGGG + Intronic
1156487880 18:37478106-37478128 CAGGGAGAGGAGAGGAGAGGGGG - Intronic
1156526881 18:37776159-37776181 CAGGCAGAGAGGTGGGAAGGAGG + Intergenic
1156696573 18:39774851-39774873 CAGGCAGAGCTGGGGGGAGGAGG - Intergenic
1157190915 18:45580945-45580967 CAGGCTGAGCAGGAGGCAGGAGG + Intronic
1157385934 18:47260204-47260226 GAGGCAGTGGAGAAGGGAAGAGG - Intergenic
1157399263 18:47373459-47373481 TAGGCAGAGGAGTGAGGATGGGG - Intergenic
1158305872 18:56104851-56104873 CAGGGAGTGGAGAAGGGAAGAGG - Intergenic
1158379729 18:56915963-56915985 CAGGCAGTGGATTACTGAGGAGG - Intronic
1158610358 18:58935086-58935108 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610364 18:58935102-58935124 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610370 18:58935118-58935140 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610376 18:58935134-58935156 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610382 18:58935150-58935172 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610388 18:58935166-58935188 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158993938 18:62898007-62898029 GAGAAAGAGGAGAAGGGAGGAGG - Intronic
1159032712 18:63247613-63247635 TAGGCAGAGCACTAGGGAGAAGG + Intronic
1159755653 18:72360826-72360848 CAAGCAGAGTAGTAGTGAGAAGG - Intergenic
1159851631 18:73532848-73532870 GAAGCAGAGGAGAAGGGAAGAGG + Intergenic
1159979941 18:74766209-74766231 CAGGCAGTTGAGAAGTGAGGAGG + Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160087736 18:75794210-75794232 CAGGGAGTGGGGTAGGGAGAGGG - Intergenic
1160287488 18:77558431-77558453 GAGGCAGAGGTGGAGGTAGGGGG - Intergenic
1160335242 18:78032866-78032888 GAGGAAGAGGAGGAGGAAGGGGG - Intergenic
1160448584 18:78946844-78946866 AGGGGAGAGGAGGAGGGAGGTGG + Intergenic
1160659501 19:291528-291550 CGGGGAGGGGAGGAGGGAGGGGG + Intergenic
1160788438 19:912339-912361 CGGACAGAGGAGTTGGGGGGCGG + Intronic
1160804416 19:985735-985757 CAGGAAGAGGAGTCGGGAGCAGG - Intronic
1160829187 19:1095062-1095084 CCGGCAGCGGGGAAGGGAGGGGG - Intronic
1160873779 19:1288112-1288134 CAGGCAGGAGAGGAAGGAGGAGG - Intronic
1160965304 19:1744716-1744738 GGGGAAGAGGAGGAGGGAGGGGG - Intergenic
1160965775 19:1746310-1746332 GAGGGAGAGGAGGAGGGAGATGG + Intergenic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012697 19:1968084-1968106 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161012733 19:1968192-1968214 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161012792 19:1968362-1968384 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161262767 19:3346723-3346745 CAGGCACAGGGGCACGGAGGGGG - Intergenic
1161266339 19:3366463-3366485 GAGGGAGAGCAGGAGGGAGGAGG + Intronic
1161415746 19:4145489-4145511 GAGAGAGAGGAGGAGGGAGGAGG + Intergenic
1161620358 19:5293922-5293944 GAGGGAGAGGAGGAGGGAGAGGG + Intronic
1161642389 19:5432408-5432430 CAGGCAGAGGCCGAGGCAGGCGG + Intergenic
1161643446 19:5437750-5437772 GAGGCAGTGGACTGGGGAGGGGG - Intergenic
1161644675 19:5445722-5445744 GGGACAGAGGAGGAGGGAGGAGG + Intergenic
1161703324 19:5806209-5806231 CAGACAGATTAGTGGGGAGGGGG + Intergenic
1161845640 19:6710584-6710606 GAGAGAGAGGAGTAGGGAGAGGG + Intronic
1161937248 19:7379604-7379626 GGGGCAGAAGAGGAGGGAGGAGG + Intronic
1162078827 19:8206826-8206848 CAGGCAATGGAGGAAGGAGGAGG + Intronic
1162094518 19:8302620-8302642 TGGACAGAGGAGTAAGGAGGGGG + Intronic
1162180765 19:8867301-8867323 CAAGCAGATGAATAGGCAGGAGG + Intronic
1162261836 19:9540249-9540271 AAGGCAGTGGAGTGGGGTGGGGG - Intergenic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1162497399 19:11030913-11030935 CAGGTCGAGGAGAAGGAAGGGGG + Intronic
1163047921 19:14658597-14658619 CAGGCAGAGGGGTGGGCAGGTGG + Intronic
1163153017 19:15425802-15425824 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1163157163 19:15445820-15445842 CAGGCAGGGAAGTTTGGAGGTGG + Intronic
1163171235 19:15532698-15532720 GAGGGGGAGGAGAAGGGAGGAGG - Intronic
1163204906 19:15795216-15795238 TAGGCAGAGAAGAAGGAAGGGGG - Intergenic
1163453988 19:17395232-17395254 CAGGAAGAGGAGGGAGGAGGGGG - Intergenic
1163772029 19:19197070-19197092 CAAGGAGAGGAGTAGGAGGGTGG + Intronic
1164407921 19:27971126-27971148 CAGGCGGAGGTGTTGGGATGGGG + Intergenic
1164501371 19:28823167-28823189 CAGGGAGAAGAGTGGAGAGGGGG + Intergenic
1164650169 19:29885731-29885753 CAGGCTCAGGAGCTGGGAGGGGG - Intergenic
1165112985 19:33513005-33513027 GGGGCAGAGGAGCAGGGGGGTGG - Intronic
1165170303 19:33887589-33887611 GAGGCAGAGTACTAGGGAGCTGG + Intergenic
1165333737 19:35155174-35155196 GGGGCAGAGGAGTAGATAGGAGG - Exonic
1165416034 19:35694092-35694114 AAGGAAGAGGAGGAGGGAGAAGG - Intergenic
1165416042 19:35694121-35694143 GAGGAAGAGGAAGAGGGAGGAGG - Intergenic
1165742158 19:38210881-38210903 CAGGCAGGGGAAGAAGGAGGTGG + Intergenic
1166069005 19:40376961-40376983 CAGGCAGAGGGGTTGGGACCGGG + Intronic
1166106272 19:40599625-40599647 GAGGGAGAGGGGAAGGGAGGAGG - Intronic
1166116976 19:40662312-40662334 CAGGCAGAGGGGTCGGGGCGGGG + Intergenic
1166122328 19:40693129-40693151 CAGGCAGATGAGAATGGAGGTGG - Intronic
1166291505 19:41866520-41866542 CAGGCAGTGGCGTAGGGGGTAGG + Intronic
1166567962 19:43776571-43776593 GAGGCAGAGGAGTAAGAAGGTGG + Exonic
1166581769 19:43906987-43907009 GAGGCAGTGGGGTTGGGAGGGGG - Intergenic
1166604337 19:44127120-44127142 CAGCCAGAGGAGCAGGGGGTGGG - Intronic
1167033611 19:46979651-46979673 AGGGCTGAGGAGGAGGGAGGAGG - Intronic
1167130476 19:47582111-47582133 GAGGGAGAGAAGGAGGGAGGTGG - Intergenic
1167130489 19:47582171-47582193 GAGGAAGAGGAGGAGGGGGGAGG - Intergenic
1167234094 19:48303439-48303461 CAGGCCCAGGAGTTAGGAGGGGG + Intronic
1167293909 19:48638448-48638470 GAGGCAGAGGTGGAGGGAAGGGG + Intronic
1167477665 19:49710297-49710319 CTGCCAGAGGAGGAGGGAAGAGG - Intronic
1167533746 19:50035764-50035786 CAGGCTGAGCATTAGAGAGGTGG + Intronic
1167586992 19:50380867-50380889 CAGGCAGGGGTGGAGGCAGGCGG - Intronic
1167642845 19:50691311-50691333 CAGGAGGAGGAGTAAGAAGGTGG - Intronic
1167686511 19:50960048-50960070 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1167773412 19:51538087-51538109 CAGGCAGAGGATTACTGAAGAGG + Intergenic
1167925857 19:52820643-52820665 GAGGGAGAGGAGGAGGGATGTGG - Intronic
1167925937 19:52821113-52821135 CAGCAAGAGGAGGAGGGAGGTGG + Intronic
1167930043 19:52856632-52856654 GAGGGAGAGGAGGAGGGATGTGG - Intronic
1167930123 19:52857099-52857121 CAGCAAGAGGAGGAGGGAGGTGG + Intronic
1168063266 19:53906035-53906057 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1168141579 19:54391511-54391533 CAGACAGAGGGGTAGGAAGAGGG + Intergenic
1168418693 19:56186281-56186303 GAGGCAGAGGGGTGGGTAGGTGG + Intergenic
925049193 2:798002-798024 CCGGCAGAGAAGGAGGGAAGAGG - Intergenic
925221389 2:2144214-2144236 AGGGCAGAGCAGGAGGGAGGGGG - Intronic
925486009 2:4332024-4332046 CAGGCACAGGTGTAGGGATATGG - Intergenic
925497705 2:4470325-4470347 GAGGAAGAGGAGAAAGGAGGAGG + Intergenic
925659141 2:6184067-6184089 AAGGAAGAGAAGGAGGGAGGAGG + Intergenic
925927614 2:8681732-8681754 GAGGGAGAGGAGGAGGGAGGAGG - Intronic
926126922 2:10277647-10277669 CAGGCAGAGGCAGAGGGAGGAGG + Intergenic
926266846 2:11330902-11330924 AAGAGAGAGGAGGAGGGAGGAGG + Intronic
926327088 2:11794718-11794740 CAGGCAAAGGAGGACGGAGATGG - Intronic
927128201 2:20033206-20033228 CAGGCAGGTAAGTAAGGAGGTGG + Exonic
927187350 2:20491310-20491332 AAGGAGGAGGAGGAGGGAGGGGG - Intergenic
927201984 2:20583618-20583640 GTGGCAAAGGAGTGGGGAGGAGG + Intronic
927681835 2:25144870-25144892 AAGGCAGAGGGGTAGGGAGGTGG + Intronic
927920932 2:26971159-26971181 CAGGCCTAGGAGGAGTGAGGAGG - Intronic
927993022 2:27461552-27461574 GAGGCAGAAGGGTAGGAAGGGGG - Intronic
928114093 2:28533973-28533995 GAGACAGAGGATTAGGGAGGTGG - Intronic
928395839 2:30942721-30942743 CACGCAGAGGAGAAGGGCTGAGG + Intronic
928979838 2:37126466-37126488 AAGGGAAAGGAGTGGGGAGGCGG - Intronic
929474083 2:42227689-42227711 TAGGCAGAGGAGGAGGAAGGGGG - Intronic
929954872 2:46449374-46449396 CAGGCTGTGGATTAGGAAGGGGG - Intronic
929997822 2:46840088-46840110 CAGGCAGACAGGTAGGGATGGGG - Intronic
930088321 2:47514138-47514160 CAGGCAGAGGAGCAGTGTGTGGG - Intronic
930301242 2:49618667-49618689 CAGGCAAAAGAGAAGGGATGGGG - Intergenic
930374749 2:50551090-50551112 GAGGAGGAGGAGGAGGGAGGGGG + Intronic
930531506 2:52594450-52594472 TAGGAATAGGAGTAGGGAGGTGG + Intergenic
931671714 2:64653822-64653844 CAGGCAGCGGAGGAGGAAGCAGG + Exonic
931989163 2:67772179-67772201 CAGGCAGCAGAGTAGGGAGTAGG + Intergenic
932214035 2:69954765-69954787 CCAGCACAGGAGTGGGGAGGAGG + Intergenic
932952444 2:76310055-76310077 CAGGGAGAGGGGTAGGGAGAAGG - Intergenic
933747936 2:85584446-85584468 CAGGCAGAGAAGCCGGGAGCGGG + Exonic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
934579635 2:95427750-95427772 CAGGCAGAGGGGACAGGAGGTGG + Intergenic
934599810 2:95648975-95648997 CAGGCAGAGGGGACAGGAGGTGG - Intergenic
934678444 2:96265996-96266018 GAGGCAGAGGAGGAGGAAGCCGG - Intergenic
934724454 2:96606447-96606469 CAGTCACATGAGGAGGGAGGAGG + Intronic
934778802 2:96955940-96955962 CAGGCAGGGGAAGAAGGAGGTGG - Intronic
934851884 2:97706998-97707020 CCGGGATAGGAGAAGGGAGGAGG + Intergenic
934986756 2:98893096-98893118 CAGGCACAGCAGCAGGGAGCGGG + Intronic
935319332 2:101870615-101870637 CATGCAGAGGAGCAGCGATGTGG - Intronic
935531667 2:104240368-104240390 GAGGATGAGGAGGAGGGAGGAGG + Intergenic
935712830 2:105914237-105914259 CAGGGAAATGAGCAGGGAGGCGG - Intergenic
936350745 2:111710781-111710803 CAGGCACAGAGGAAGGGAGGGGG + Intergenic
936379407 2:111970745-111970767 GAGGAGGAGGAGAAGGGAGGAGG - Intronic
936379413 2:111970764-111970786 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
936533155 2:113290980-113291002 CAGGCAGAGGGGACAGGAGGTGG - Intergenic
936679843 2:114757333-114757355 AAGGAAGAGAAGTAGGGAGAGGG + Intronic
936679849 2:114757345-114757367 TAGGGAGAGGGGGAGGGAGGAGG + Intronic
937061477 2:118983244-118983266 CAGGCAGAGGACAGGGGTGGAGG - Intronic
937217329 2:120321166-120321188 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217335 2:120321182-120321204 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217341 2:120321198-120321220 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217352 2:120321227-120321249 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217358 2:120321243-120321265 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217364 2:120321259-120321281 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937217370 2:120321275-120321297 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
937284752 2:120743278-120743300 CAGGAAGGGGAGCGGGGAGGCGG - Intronic
937869698 2:126778304-126778326 CAGCCACATGAGTTGGGAGGGGG - Intergenic
938070006 2:128303303-128303325 CATGCAGAGGAGCTGGGAGCAGG + Intronic
938676066 2:133635207-133635229 CAGACAGAGGAAAAGGAAGGGGG + Intergenic
939075407 2:137596709-137596731 GAGGAAGAGGAGGGGGGAGGAGG - Intronic
940062098 2:149583600-149583622 CTGGAGGAGGAGTAGAGAGGTGG + Intronic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940792301 2:158042204-158042226 CAGTCAGAGTAGCAGGGAAGGGG - Intronic
940856169 2:158730292-158730314 CAGGCAGAGAAGTAGAGAGAGGG + Intergenic
940945634 2:159615322-159615344 GAAGCAGAGGAGTTGGGAGCTGG + Intronic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941249081 2:163139342-163139364 CAACCAGAGAAGAAGGGAGGGGG - Intergenic
941262318 2:163313275-163313297 CAGGTAGAGGAGTAGGTAATTGG + Intergenic
941265660 2:163358407-163358429 GCTGCAGAGGAGTGGGGAGGGGG + Intergenic
941751687 2:169141311-169141333 AAGGCAGAGGAAGAGGGATGAGG - Intronic
942251861 2:174053969-174053991 CAAGCAGAGCACCAGGGAGGTGG + Intergenic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
942654863 2:178204704-178204726 CAGGCAGAGGAGTGAAGTGGAGG + Intronic
942678336 2:178451223-178451245 CCCGCAGAGGAGCAGCGAGGGGG - Exonic
943174804 2:184457097-184457119 CAGGAAAAGGAGTAGGGATCAGG + Intergenic
943460465 2:188166161-188166183 CAGGCAGGGGTGGGGGGAGGGGG + Intergenic
943890264 2:193277290-193277312 CAGGCGGAGGGGGAGGGAGAGGG - Intergenic
944093652 2:195942464-195942486 GAGGAAGAGGAGGAGGAAGGAGG + Intronic
944547447 2:200812043-200812065 CGGGCAGAGGGAGAGGGAGGCGG + Intronic
944971874 2:205002630-205002652 GAGGCAGAAGAGCAGGCAGGAGG - Intronic
945987528 2:216367309-216367331 AAGGAGGAGGAGGAGGGAGGGGG - Intronic
946003991 2:216507367-216507389 CAGGGGGAAGAGTAGGGACGGGG + Intronic
946148554 2:217748927-217748949 CAGGAAGAGGAGGAGGCAGCAGG - Intronic
947119371 2:226799655-226799677 GAGGAGGAGGAGGAGGGAGGAGG - Exonic
947574205 2:231259525-231259547 CAGGCAGAAAAGTAGCGATGGGG - Intronic
947767769 2:232648500-232648522 CAGGCAGGGATGTAGGGAGAGGG + Intronic
947843148 2:233221759-233221781 CAGGCAGAGGAGATGGGAGAAGG - Intronic
947871998 2:233444438-233444460 CAGGCAGAGAAGCAAGCAGGAGG - Intronic
948041566 2:234905621-234905643 AAGGGAGAGAAGGAGGGAGGAGG + Intergenic
948091918 2:235302139-235302161 GAGGAAGAAGAGGAGGGAGGAGG - Intergenic
948140775 2:235670472-235670494 CCGGCCGAGGAGGAGGGACGCGG + Intronic
948205431 2:236160565-236160587 TAGGCAGAGGAGAAGGAATGGGG + Intergenic
948558550 2:238835222-238835244 GAGGAGGAGGAGGAGGGAGGGGG - Intergenic
948777867 2:240299239-240299261 CAGGCTGAGGAGCCCGGAGGAGG - Intergenic
948790105 2:240372552-240372574 CAGGAAAAGGAGCACGGAGGAGG + Intergenic
948852537 2:240715432-240715454 CAGGCAGGGGATGAGGGTGGCGG + Exonic
948886823 2:240888857-240888879 CAGGCAGGGGAGGAGAGAGAGGG - Intronic
948981018 2:241494839-241494861 CAGGCAGAGGAGAATGCAGGTGG - Exonic
949086805 2:242162688-242162710 CAGGCAGAGGAGTAGCAATGTGG + Intergenic
1168900975 20:1364685-1364707 AAGGCAGAGGAGAATGAAGGAGG - Intronic
1168995486 20:2129807-2129829 CAAGCAGAGGAGGAGGGAGCCGG + Intronic
1169340967 20:4795845-4795867 CAGGAGGAGGAGGATGGAGGGGG + Exonic
1169634135 20:7668326-7668348 TAGGCAGAGCAGAAGGGAGACGG + Intergenic
1169790023 20:9400199-9400221 CAGGCACAGGAGGAGGGTGAGGG - Intronic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1169996351 20:11561608-11561630 AAGGTAGAAGAGAAGGGAGGTGG - Intergenic
1170039163 20:12022321-12022343 GAGGCAGGGGAGGAGGGTGGGGG - Intergenic
1170526094 20:17239450-17239472 TAGGCAGAGGAGAAGGGACAGGG + Intronic
1170545660 20:17433891-17433913 AAGGGAGAGAAGTAGGAAGGGGG - Intronic
1170629207 20:18053964-18053986 AAGGCTGGGGAGAAGGGAGGCGG - Intronic
1170696963 20:18667795-18667817 GAGGCAGAGGCGTGGGGAGAAGG - Intronic
1170851011 20:20004496-20004518 AAGGCAGAGAGGGAGGGAGGAGG + Intergenic
1170944107 20:20874625-20874647 CAGGTAAAGGTGAAGGGAGGAGG + Intergenic
1171023052 20:21603861-21603883 TCGGTAGAGGAATAGGGAGGTGG - Intergenic
1171074690 20:22110624-22110646 GAGGGAGAGGAGTAGGAAAGAGG - Intergenic
1171074693 20:22110642-22110664 GAGGAAGAGGAGGAGGGAGAGGG - Intergenic
1171443768 20:25188300-25188322 AAGGCAGTGGGGTAGGGTGGAGG - Intergenic
1171796039 20:29567471-29567493 CAGGCGGAGGCGGAGGGTGGTGG + Intergenic
1171852188 20:30316672-30316694 CAGGCGGAGGCGGAGGGTGGTGG - Intergenic
1172292144 20:33784157-33784179 GAGGGAGAGGAGTAGGGAGAGGG - Intronic
1172307279 20:33889545-33889567 CAGCCTGAGGAGAAGGCAGGTGG - Intergenic
1172330704 20:34074456-34074478 GAGGGAGAGAAGCAGGGAGGAGG - Intronic
1172355404 20:34276456-34276478 CAGGGAGAGAAATAGAGAGGTGG - Intergenic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172496277 20:35387324-35387346 GAGGCAGAGAAGTAGAAAGGGGG + Intronic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172778609 20:37422772-37422794 CGGGCAGAGGAGGAAGGAGGAGG - Intergenic
1172841054 20:37903044-37903066 GAGGGAGGGGAGGAGGGAGGCGG + Intergenic
1172957270 20:38769831-38769853 GAGGAAGAGGAGTGGGGAGCAGG + Intronic
1172973295 20:38888756-38888778 TGGGCAGAGGAGGAGGGAGGAGG + Intronic
1173106973 20:40146097-40146119 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1173164802 20:40680310-40680332 CTGGCAGAGGAGTATGGTGGTGG - Intergenic
1173465212 20:43275514-43275536 CAGGGAGTGGAGTAGGGGGTGGG - Intergenic
1173529127 20:43755099-43755121 CAGGGAGAGGAGCAGAGATGCGG - Intergenic
1173750089 20:45469810-45469832 CAGGCTGAGGAGGAGGGCGGCGG - Exonic
1174306021 20:49614893-49614915 GAGACAGAGGAGCAGTGAGGAGG + Intergenic
1174406882 20:50308696-50308718 CAGGGAGAGGAGGAAGTAGGGGG + Intergenic
1174653827 20:52152943-52152965 CAGGCAGAGCAGCCGGCAGGTGG - Exonic
1174761416 20:53210405-53210427 CTGGATGAGGAGTTGGGAGGGGG + Intronic
1175219150 20:57407098-57407120 CAGGGAGATGAGCAGGGAAGGGG + Intronic
1175237590 20:57525241-57525263 GGGGAAGGGGAGTAGGGAGGGGG + Intronic
1175425018 20:58858108-58858130 CAGGGAGAGGAGGAAGGATGAGG + Intronic
1176016213 20:62934532-62934554 GAGACTGAGGAGCAGGGAGGGGG - Intronic
1176092639 20:63325795-63325817 GAGGCTGTGGGGTAGGGAGGGGG + Intronic
1176094849 20:63335902-63335924 CAGGAAGAAGAGGAGGGAGAAGG + Intergenic
1176149020 20:63579456-63579478 CAGGCAGGGGAGGGGAGAGGCGG + Intergenic
1176227170 20:64007372-64007394 GAGGCAGAGGGGAGGGGAGGCGG - Intronic
1176301651 21:5101604-5101626 CAGGGAGAGGGGCAGGGACGTGG + Intergenic
1178007611 21:28240653-28240675 CAGGCTGTGGAGGAGGGAGGAGG - Intergenic
1178930838 21:36817537-36817559 CAGGCGGAGGAGCAGGGTGAGGG - Intronic
1179084815 21:38207422-38207444 AAGGGAGAGGAGAAGGGAGAAGG - Intronic
1179133681 21:38661028-38661050 GAGGAAGAGGAGGAGGGAGGCGG + Intronic
1179333809 21:40431294-40431316 TAGGCTGAGGAGGAGGAAGGGGG - Intronic
1179488589 21:41726509-41726531 GAGGAAGAGGAGGAGGAAGGAGG - Intergenic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1179855380 21:44160295-44160317 CAGGGAGAGGGGCAGGGACGTGG - Intergenic
1180102376 21:45594901-45594923 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102408 21:45594998-45595020 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180102421 21:45595031-45595053 CAGGCAGGGGAGTGGGAGGGAGG - Intergenic
1180258742 21:46651548-46651570 CAGGCAGTGGAGGGGGAAGGCGG + Intronic
1180339322 22:11605673-11605695 GAGGCAGAGGAGGAGAGACGCGG + Intergenic
1180635968 22:17263258-17263280 CAGACAGAGCAGTGGGGAGGTGG + Intergenic
1180742813 22:18065491-18065513 CAGGCAGAGGCGGGGGCAGGAGG + Intergenic
1181323050 22:22023309-22023331 CAGTCAGTGGAGCAGGGAAGGGG + Intergenic
1181823468 22:25494151-25494173 CTGGATGAGGAGTAGGGAGAAGG - Intergenic
1181885312 22:26017380-26017402 AAGGGAGAGGAGGAAGGAGGAGG - Intronic
1181886072 22:26023470-26023492 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
1181886085 22:26023508-26023530 GAGGAAGAGGAGGAGGGAGGAGG - Intronic
1181947482 22:26529451-26529473 CAGGGAGGGGAGAAGGCAGGTGG - Intronic
1182257379 22:29048960-29048982 CAGGCAGAGCAGTGGGGAGTTGG + Intronic
1182275641 22:29186870-29186892 GAGGCTGAGGAGTGGGGTGGGGG + Intergenic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182620588 22:31616477-31616499 CAGGCAGTGGAGGCGTGAGGCGG + Intronic
1182931469 22:34178289-34178311 GAGGGGGAGGAGGAGGGAGGAGG - Intergenic
1182931475 22:34178305-34178327 AAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1183056222 22:35307718-35307740 GAGCCAGGGGAGAAGGGAGGGGG + Intronic
1183346680 22:37312006-37312028 CAGGCAGAACTGTGGGGAGGTGG - Exonic
1183467585 22:37987421-37987443 CAGGAAGAGGACTTGGGAGCTGG - Intronic
1183487582 22:38097697-38097719 CAGGCAGGAGAGAGGGGAGGAGG + Intronic
1183625557 22:38999350-38999372 AAGGCAGAAGAGGAGGGAAGGGG - Intergenic
1183685805 22:39360803-39360825 CAGGCAGAGAAGGGGGAAGGAGG + Intronic
1183831953 22:40422929-40422951 CAGGCAGAGGTGTGGGGCTGGGG + Intronic
1183991304 22:41598691-41598713 CAGGCAGAGGGGTCTGGAGCAGG + Exonic
1184151313 22:42640744-42640766 AAGGCTGAGGAGGAGGCAGGGGG - Intronic
1184409315 22:44317507-44317529 GAGGCAGATGAGGTGGGAGGAGG - Intergenic
1184449795 22:44576083-44576105 GAGGAAGAGGAGGAGGGAGGAGG + Intergenic
1184449801 22:44576102-44576124 GAGGTAGAGGAGGAGGGAGGAGG + Intergenic
1184455405 22:44607203-44607225 CAGGCAGGGGCCCAGGGAGGAGG + Intergenic
1184484727 22:44769898-44769920 CAGGCAGAGGGCTAGGGAATGGG + Intronic
1184600224 22:45539095-45539117 GGGGAAGAGGAGAAGGGAGGGGG - Intronic
1184763726 22:46560934-46560956 CAGGGAGAGGAGCTGGGTGGAGG + Intergenic
1184816733 22:46877912-46877934 CAGGCAGAGGGGTAAGGCTGTGG - Intronic
1184881194 22:47305067-47305089 CAGGCCGAGGGTTAGGAAGGTGG - Intergenic
1184900851 22:47445579-47445601 CAGGCAGACAAGTAGACAGGAGG - Intergenic
1184950298 22:47837219-47837241 CAGGAAGAGAAGAAGGCAGGAGG - Intergenic
1185056050 22:48578844-48578866 CAGTGAGAGGTGCAGGGAGGGGG + Intronic
1185089348 22:48757140-48757162 AAGGAGGAGGAGGAGGGAGGAGG + Intronic
1185089360 22:48757179-48757201 AAGGAGGAGGAGAAGGGAGGAGG + Intronic
1185089372 22:48757218-48757240 AAGGAGGAGGAGAAGGGAGGAGG + Intronic
1185099098 22:48828146-48828168 CAGACATCGGAGTTGGGAGGAGG + Intronic
949250090 3:1973161-1973183 GAGGGAGAGGAGGAGGGAGGGGG + Intergenic
949644992 3:6083326-6083348 CAGGCAGAGGAGGAGGGGTGTGG - Intergenic
950453771 3:13080426-13080448 CAGGCAGAGATGCAGGGTGGAGG + Intergenic
950649174 3:14396525-14396547 GAGGCAGAGGAGGAGAGTGGCGG + Intergenic
950700903 3:14745268-14745290 CAGGGAGGGAACTAGGGAGGTGG + Intronic
951318840 3:21220326-21220348 CAGGGAGATGAGTTAGGAGGTGG - Intergenic
951501496 3:23392514-23392536 CAGGAAGAAGAAGAGGGAGGGGG + Intronic
951543471 3:23805545-23805567 AAAGGAGAGGAGTAGGGAGGTGG - Intergenic
952533641 3:34288183-34288205 GAGGTAGAGGAGGAGGGAAGAGG - Intergenic
952855487 3:37767087-37767109 CACGCAAAGGAAGAGGGAGGAGG + Intronic
952927887 3:38335141-38335163 CATGCAGTAGGGTAGGGAGGTGG + Intergenic
952964887 3:38614917-38614939 CAGGGACAGGAGTAAGAAGGTGG + Intronic
953005284 3:38971958-38971980 GAGGCAGAGAGGTAGGGAGGGGG + Intergenic
953070652 3:39516207-39516229 AAGGCAGAGGAGTAGGGCAAGGG + Intronic
953082720 3:39635618-39635640 CACGCAGAGGAGGAGGAAGCAGG + Intergenic
953139461 3:40214032-40214054 GTGGCAGAGGAGTGGGGAAGTGG - Intronic
953230241 3:41058303-41058325 AAGGAGGAGGAGGAGGGAGGAGG + Intergenic
953230252 3:41058334-41058356 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
953661705 3:44895511-44895533 CAGGCAGAGCTGTGGGGAGGGGG + Intronic
953901235 3:46845422-46845444 CAGACAGACGCGCAGGGAGGAGG - Intergenic
954076845 3:48187972-48187994 GAGGCAGAGGAAGAGGGAGCGGG - Exonic
954121846 3:48504235-48504257 CAGGAGGAGGAGGAGGGAGGAGG + Exonic
954290770 3:49648870-49648892 CAGGCAGAGGAATGGGGCAGTGG - Intronic
954326083 3:49864814-49864836 AAGGTAGTGGAGAAGGGAGGAGG + Intronic
954411561 3:50373477-50373499 GAGGCAGGGGAGGAAGGAGGGGG + Intronic
954622728 3:52005186-52005208 TGGGCACAGGAGTAGGCAGGTGG - Intergenic
954634592 3:52064695-52064717 CAGGCAGAGGAGAAGGGGAAAGG + Intergenic
954647631 3:52141228-52141250 CAGGCAGAGCAGCATGGAGTGGG - Intronic
954864478 3:53717375-53717397 CAGGCAGTGGAGGAGGGCAGGGG - Intronic
956080215 3:65549351-65549373 CAGGAAGAGGGGAGGGGAGGGGG - Intronic
956198801 3:66683934-66683956 AAGGAGGAGGAGGAGGGAGGAGG - Intergenic
956741565 3:72279920-72279942 AAGGAAGAGGAGGAGGGAGAGGG + Intergenic
956794348 3:72704455-72704477 CGGGGAGAGGAGTAGGGTTGTGG + Intergenic
956822417 3:72965787-72965809 GGGGTAGAGGAGTAGGGAGGGGG + Intronic
958513005 3:95073326-95073348 CAGGCAGAGGGGGAGTGAAGAGG + Intergenic
958963991 3:100537638-100537660 CAGGAAGAGGAGTAAAGAAGAGG + Intronic
959114141 3:102156003-102156025 AAGGTAGGGGAGTAGGGAGGTGG + Intronic
959398233 3:105868549-105868571 CAGGCCGGGGAGGAGGGAGAGGG - Intronic
959454946 3:106547968-106547990 CAGGCAGTGGGGTAGGGAATGGG - Intergenic
959548807 3:107630388-107630410 CGTGCAAAGGAGTGGGGAGGAGG - Intronic
959920983 3:111868106-111868128 GAGGCAGAGGTGGAGGCAGGGGG - Intronic
960345269 3:116522640-116522662 AAGGGAGGGGAGCAGGGAGGAGG - Intronic
960836437 3:121911453-121911475 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
961064445 3:123862789-123862811 CAAGTAGGGGAGAAGGGAGGTGG - Intronic
961209958 3:125118017-125118039 CAGGCAGACGTGGAGGGAGCGGG - Intronic
961376488 3:126469542-126469564 CAGCCAGGGGTGTGGGGAGGTGG - Intronic
961396797 3:126599235-126599257 CAGGGAGAGGGGAAGGAAGGAGG - Intronic
961418684 3:126782005-126782027 CAGTCAGAGGAGTTGGCGGGTGG + Intronic
961681732 3:128604137-128604159 CCCGCAGAGGAGCAGGGCGGGGG + Intergenic
961835717 3:129657146-129657168 CAGGGAGGGGAGCAGGGTGGTGG + Intronic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
962201441 3:133403862-133403884 CAGGAAGAGGAGCCAGGAGGAGG + Intronic
962205051 3:133427562-133427584 CTGGCTGAGGAGCAGGGAGGTGG - Intronic
962261776 3:133914962-133914984 CAGACTGGGGAGTAGGGAGACGG + Intergenic
962446487 3:135470408-135470430 GAGGCAGGGGTGTAGGGAGAGGG + Intergenic
962744932 3:138390020-138390042 CAAGAAGGGGAGAAGGGAGGAGG + Intronic
962837284 3:139200654-139200676 AAGTTAGAGGAGTAGGAAGGAGG + Intronic
962928275 3:140014725-140014747 TAGGGAGAGGAGCAGGGATGGGG + Intronic
963605607 3:147409983-147410005 GAAGAAGAGGAGGAGGGAGGGGG - Exonic
963733142 3:148991705-148991727 AGGGCGGAGGAGAAGGGAGGCGG - Intronic
963977920 3:151503797-151503819 CAGGTAGAGGGTTAGGGAGAGGG + Intergenic
964163119 3:153669959-153669981 CAGGCAGAGGTGTAAGGACTGGG - Intergenic
964374399 3:156035402-156035424 AAGGAGGAGGAGGAGGGAGGAGG - Intergenic
964416629 3:156454609-156454631 CAGGAAGGGGTGTATGGAGGAGG + Intronic
964525995 3:157615836-157615858 CAGGCACTGCAGTAGGCAGGGGG - Intronic
964922426 3:161913488-161913510 CAGTCATAGAAGTAGGGAGAAGG + Intergenic
965615303 3:170586218-170586240 CAGACAGAGGGGAAGGCAGGGGG - Intronic
966279997 3:178215016-178215038 CATTAAGAGGAGTGGGGAGGGGG - Intergenic
966314508 3:178630684-178630706 CAAGAAAAGGAGAAGGGAGGAGG - Intronic
967531726 3:190555298-190555320 AAGGAAGCGGAGTAGAGAGGAGG - Intronic
967999768 3:195196899-195196921 CAGGCAGAGCAGTTAGCAGGAGG + Intronic
968130241 3:196188912-196188934 CAGGCAGTTGAGCAGGGCGGGGG - Intergenic
968229260 3:196995670-196995692 CAGGAAGAGAAGGAGGGAGCAGG + Intronic
968442156 4:629507-629529 CAGGGAGAGGAGCTGGAAGGTGG - Intronic
968456134 4:700950-700972 CAGGGAGAGGAGCTGGGCGGAGG - Intergenic
968647801 4:1749003-1749025 GAGGGAGAGCAGTGGGGAGGGGG - Intergenic
968698573 4:2044156-2044178 CAGGCAGGGGAGCAGGTACGAGG - Intergenic
969223102 4:5774114-5774136 GAGGCACAGGACTAGTGAGGGGG - Intronic
969244147 4:5921650-5921672 CAGGCAGAGCTGGAGAGAGGAGG + Intronic
969246256 4:5934916-5934938 CAGCCAGAAGTGTAGGGAGCTGG - Intronic
969437772 4:7198657-7198679 CAGGCAGAGGTCAAGGGATGTGG + Intronic
969454843 4:7295027-7295049 GAGGGAGAGGAGGGGGGAGGAGG - Intronic
969494272 4:7516952-7516974 CAACCAGAGGAGGAGGGAGGAGG - Intronic
969509684 4:7610619-7610641 CAGGCAGAGTGGTGTGGAGGGGG + Intronic
969574744 4:8030318-8030340 CAGGCAGAGTGGGAGGCAGGTGG + Intronic
969621268 4:8280103-8280125 CAGGGGGAGGTGTAGAGAGGTGG + Intronic
969998801 4:11343102-11343124 AAGGCAGTGGAGGAAGGAGGAGG + Intergenic
970065380 4:12087758-12087780 CAAGGAGAGGAGTATGGTGGGGG + Intergenic
971405864 4:26320621-26320643 GGGGCCGAGGAGAAGGGAGGAGG - Intronic
971574538 4:28256587-28256609 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
972080948 4:35148104-35148126 TAGGGAGAGGAATATGGAGGGGG + Intergenic
972103137 4:35447464-35447486 AAGGAAGAGGAGGAGGAAGGAGG + Intergenic
972103213 4:35447767-35447789 AAGGAAGAGGAGGAGGAAGGAGG + Intergenic
972103226 4:35447814-35447836 AAGGAAGAGGAGGAGGAAGGAGG + Intergenic
972205351 4:36765479-36765501 GAGACAGAGTACTAGGGAGGAGG + Intergenic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
973029365 4:45316382-45316404 CTGGCAGAGAAGTAGGTAGTAGG + Intergenic
973179669 4:47252097-47252119 CATCCAGAGGAGTAGGAGGGGGG - Intronic
973342034 4:49015283-49015305 TAGAAAGAGGAGTGGGGAGGAGG - Intronic
974779156 4:66528965-66528987 CAGGCAGAGGTGTAGGGCAGAGG + Intergenic
975221589 4:71818705-71818727 CAGGCAGAGAAGGAGGCAAGAGG - Intergenic
975372800 4:73607849-73607871 GAGGAAGAAGAGTAGAGAGGAGG - Intronic
975372814 4:73607902-73607924 GAGGAAGAAGAGTAGAGAGGAGG - Intronic
975372833 4:73607970-73607992 GAGGAAGAAGAGTAGAGAGGAGG - Intronic
975504450 4:75122852-75122874 GAGGAAGAGGAGGAGGAAGGAGG + Intergenic
975665747 4:76733286-76733308 GATGCAGAGGAGGAAGGAGGAGG - Intronic
976011462 4:80494110-80494132 CAGGAAGAAGAGCATGGAGGTGG - Intronic
976258618 4:83124813-83124835 CAGGCAGAGGAGAGGAGAGGAGG + Intronic
976398440 4:84582724-84582746 GAGGCTGAGGAGCTGGGAGGCGG - Intergenic
976678575 4:87730413-87730435 CACCCAGAGGAGTAGTGGGGAGG + Intergenic
976885050 4:89971588-89971610 GAGGAAGAGGAGGAGGGAAGAGG - Intergenic
977827811 4:101554286-101554308 CAGACAAAGGGGTGGGGAGGGGG - Intronic
977848270 4:101791458-101791480 AAGCCAGTGGAGTAGGGAGGTGG - Intronic
977891707 4:102319619-102319641 CAGGGGTAGGAGTGGGGAGGGGG - Intronic
978105907 4:104901595-104901617 CAGGCAGAGGAGCAGAGGAGTGG + Intergenic
978957698 4:114634431-114634453 AAGGAAGAGGAGGAGGGAAGAGG + Intronic
979192085 4:117874269-117874291 CAGGAAGAGGAGAAGGGAGGAGG - Intergenic
980005695 4:127539924-127539946 CAGCCAGAGAAGTTGGAAGGGGG - Intergenic
980970253 4:139560588-139560610 CTGGGAGAGGAGCAGCGAGGAGG + Intronic
980981428 4:139657582-139657604 GAGGAGGAGGAGAAGGGAGGGGG + Intergenic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981318546 4:143365237-143365259 CAGGTAGAGGAAGAAGGAGGGGG + Intronic
981413334 4:144458746-144458768 AAGGCAGGGAAGGAGGGAGGAGG + Intergenic
981738273 4:147975370-147975392 TAGACAGAGCAGTAGGGAGAAGG + Intronic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982106685 4:152017473-152017495 CAGGCTGATGAGCACGGAGGTGG + Intergenic
982112309 4:152068004-152068026 AAGGCCAAGGAGTAGGAAGGTGG - Intergenic
983240001 4:165221530-165221552 GAGGCAGCTGAGTAGGTAGGAGG + Intronic
983906205 4:173184616-173184638 CAGGGAGAGGGAGAGGGAGGGGG + Intronic
984703718 4:182833813-182833835 AGGGGAGAGGAGAAGGGAGGAGG - Intergenic
984703946 4:182834459-182834481 AGGGGAGAGGAGAAGGGAGGAGG - Intergenic
984715388 4:182919684-182919706 CAGGCAGAGGAGGTGGAAGGAGG - Intergenic
984942904 4:184950124-184950146 CAGGCTGCGGAGTGGGGGGGGGG + Intergenic
985011636 4:185588600-185588622 GAGGAGGAGGAGGAGGGAGGAGG - Intronic
985024904 4:185731446-185731468 CAGGCAGGGAGGGAGGGAGGGGG - Intronic
985117389 4:186605405-186605427 GAGGAAGTGGAGTAGGGAGGAGG + Intronic
985548788 5:523040-523062 GAGGCTGCGGAGAAGGGAGGAGG + Intronic
985646622 5:1088039-1088061 CAGGCAGCGGGCTGGGGAGGGGG - Intronic
985649967 5:1102874-1102896 CAGGCAGTGGGGTTGGGTGGGGG - Intronic
986009653 5:3700723-3700745 GAGGAAGAGGAAGAGGGAGGAGG - Intergenic
986283989 5:6346552-6346574 GAGGGAGAGAAGGAGGGAGGAGG + Intergenic
986805539 5:11305364-11305386 AAGGCACTGGAGTGGGGAGGTGG - Intronic
987216909 5:15747102-15747124 CAGAAAGATGAGAAGGGAGGTGG + Intronic
987822829 5:22988018-22988040 GAGGAAGAGGAGGAAGGAGGTGG - Intergenic
989098638 5:37804457-37804479 CAAACAGAGCAGTAGGGAGTAGG - Intergenic
989110378 5:37901745-37901767 CTGGCAAAGGAGTGGGGAGGAGG + Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990352360 5:54931541-54931563 CAGGCAGAGGACAAAGGATGGGG - Intergenic
990549145 5:56855129-56855151 AAGGCAGAGAAGAAAGGAGGAGG - Intronic
990575170 5:57116994-57117016 GAGTCAGAGGAGCAGGGATGGGG + Intergenic
991042255 5:62188225-62188247 CAGGCAGAGTGGGAGGGAGAAGG - Intergenic
991289487 5:65018968-65018990 AGGGCAGAGGAGTGGGCAGGGGG - Intergenic
991971834 5:72148819-72148841 CAGGGAGAGGAGTTAGGAGATGG + Intronic
992004193 5:72461410-72461432 CAGGCAGTGGGGAAAGGAGGGGG + Exonic
992230056 5:74655021-74655043 CAGGCACAGGAGCAGGGACCAGG + Intronic
992417362 5:76564828-76564850 CTGGGAGAGGAGCAGGAAGGAGG + Intronic
992467727 5:77023766-77023788 AAGGGAGAGTAGAAGGGAGGAGG + Intergenic
992869298 5:80990425-80990447 CAGTGAAAGGAGTCGGGAGGGGG + Intronic
993043322 5:82839718-82839740 CAGGGAGAGCAGGAGGGAAGTGG + Intergenic
993212215 5:84966234-84966256 CAGGCAAAGGACTACGGTGGAGG - Intergenic
993386398 5:87267954-87267976 CAGGCAGATGAGAGGGGTGGGGG - Exonic
993613632 5:90084285-90084307 CAGGTAGTGGAGTAGGGGAGGGG + Intergenic
994652400 5:102545211-102545233 CAGCCAGAGGAGTATGGGTGGGG + Intergenic
994732041 5:103503651-103503673 CAGGAAGAGAAGAAGGGAGTGGG + Intergenic
995931844 5:117455563-117455585 CAGGCACAGTAGTAGAGAGGAGG - Intergenic
996398063 5:123032942-123032964 GAGGTAGAGGAAGAGGGAGGAGG + Intronic
997180086 5:131819410-131819432 GAGGCAGAGGGGGAGGGAGAGGG + Intronic
997471762 5:134121080-134121102 CAGGCAGGGCAGTAAGTAGGCGG - Intronic
997554761 5:134786373-134786395 CAGGCAGGGGAAGAGGGAGGAGG - Intronic
998205281 5:140153203-140153225 GAGAGAGAGGAGGAGGGAGGGGG - Intergenic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998367076 5:141638451-141638473 GAGGCAGAGGTGTGGGGAGAAGG - Intronic
998484793 5:142492396-142492418 GAGTAAGAGGAGGAGGGAGGAGG - Intergenic
998549445 5:143063320-143063342 CAGCCAGAGCAATAGGGAGGAGG - Intronic
998590977 5:143477923-143477945 GAGGAGGATGAGTAGGGAGGAGG - Intergenic
998611512 5:143694307-143694329 AAGGAGGAGGAGGAGGGAGGGGG - Intergenic
998773591 5:145573487-145573509 CGGGCAGAGGAAAGGGGAGGGGG - Intronic
999150333 5:149422439-149422461 TGAGCAGAGGAGAAGGGAGGAGG + Intergenic
999246953 5:150160122-150160144 CAGGCAGAGTTGTGGGGTGGGGG + Intergenic
999270931 5:150296034-150296056 CAGGCTGAGTGGTAGCGAGGAGG - Intergenic
999408091 5:151324952-151324974 CAGAGAGAGGAGTCGGGAGGTGG - Intronic
999631979 5:153580772-153580794 CAGGAAGAGGAGCATGGAGTGGG + Intronic
999660387 5:153856519-153856541 CAGCCAGAGAAGAAGGGAGGAGG - Intergenic
999711817 5:154324463-154324485 CAGGCAGAGGAGTGAGGAAGAGG - Intronic
999990462 5:157045423-157045445 TGGGAAGAGGAGTGGGGAGGAGG + Intronic
1001132986 5:169079809-169079831 GGGGAAGAGGAGGAGGGAGGAGG + Intronic
1001412082 5:171519160-171519182 CAGGCACAGGAGCAGGGGTGTGG + Intergenic
1001620013 5:173075830-173075852 GAGGCAGGGAAGTAGGCAGGAGG - Intronic
1001676598 5:173523175-173523197 CAGACAGCAGAGTAGTGAGGGGG - Intergenic
1002061072 5:176626511-176626533 CAGCCACTGGAGCAGGGAGGGGG + Exonic
1002340921 5:178516137-178516159 CGGGAAGAGGGGTAGGGTGGTGG - Intronic
1002375174 5:178783673-178783695 CAGGCACGGGGCTAGGGAGGGGG - Intergenic
1002594312 5:180312175-180312197 GAGGCTGAGGACCAGGGAGGCGG + Intronic
1002675699 5:180910782-180910804 CAGGAGGAGGTGTAGGGAGGAGG - Intronic
1002703347 5:181142859-181142881 CATCCAGAGGAGTCGGGTGGAGG - Intergenic
1002898467 6:1392506-1392528 CTGGGAGAGGAGCAGGCAGGCGG - Intronic
1002917723 6:1542205-1542227 GAGGCAGGGAAGGAGGGAGGAGG + Intergenic
1002925333 6:1602419-1602441 CAGCCAGAGGAGGCTGGAGGAGG - Intergenic
1003264345 6:4552351-4552373 TAGGCTGAGGAGTTTGGAGGAGG - Intergenic
1003406755 6:5832554-5832576 GAGGAAGAGGAGGGGGGAGGGGG + Intergenic
1003524237 6:6884986-6885008 CTGGCAGAGGAGGCTGGAGGAGG - Intergenic
1003590854 6:7435486-7435508 CAGGCAGAGACAAAGGGAGGAGG + Intergenic
1003711996 6:8602781-8602803 CAGCCAGAGGAGCAGGGCAGAGG - Intergenic
1004017408 6:11744664-11744686 CAGGCAAAGAAGCATGGAGGAGG - Intronic
1004633685 6:17446519-17446541 AAGAAAGAAGAGTAGGGAGGTGG + Intronic
1004929577 6:20449255-20449277 CAGGCAGAGTAGATGGGAAGAGG - Intronic
1005027344 6:21476056-21476078 CAGCTAGGGGAGTAGGCAGGGGG + Intergenic
1005826191 6:29632923-29632945 AAGGTGGAGGAGAAGGGAGGGGG - Exonic
1005828650 6:29652472-29652494 CAGGCACAGGAGTACCTAGGGGG - Intergenic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1006029051 6:31165812-31165834 CATGAAGAGGAGTAGGGAGAGGG - Intronic
1006299056 6:33184260-33184282 CAGGCAGAGGAATATGGGGAGGG - Intronic
1006377057 6:33677455-33677477 CAGCCTGAGAAGTAGGGAAGGGG + Intronic
1006593916 6:35179013-35179035 AAGGCAGAGGAGCCTGGAGGAGG + Intergenic
1006804165 6:36777731-36777753 TAGGCAGGGGAGCAGCGAGGAGG - Intronic
1006809289 6:36809704-36809726 AAGGCAGAGAAGGTGGGAGGGGG + Intronic
1006981949 6:38154268-38154290 CAGGCAGAGGAGGGGGCGGGGGG - Exonic
1007107287 6:39292526-39292548 TAGGCAGAGGAGTTGGAATGAGG - Intergenic
1007236291 6:40393118-40393140 GAGACAGAGGAGAGGGGAGGAGG + Intronic
1007258532 6:40545586-40545608 CAGGCAGAGGAAGAGGAAGAGGG + Intronic
1007595135 6:43046464-43046486 CAGACATAGGTGTGGGGAGGTGG + Intronic
1007697044 6:43740566-43740588 AAGGCAGTGGAGTGGGGAGGAGG + Intergenic
1007722208 6:43891707-43891729 CAGGTAGAGGAGCAGGGGAGGGG + Intergenic
1007807276 6:44459723-44459745 CCAGCAGAGGCGTAAGGAGGAGG + Intergenic
1007927635 6:45663201-45663223 CAGGAAGAGGAGGAGGGAGATGG - Intronic
1008453151 6:51676041-51676063 GTGGCAGAGGAGGAGGAAGGAGG + Intronic
1008584553 6:52936990-52937012 GAGGAAGAGGAGGAGAGAGGAGG - Intergenic
1010047980 6:71469795-71469817 AAGGCAAATGAGGAGGGAGGAGG - Intergenic
1010249851 6:73696238-73696260 CACGCAGAGGAGGTGGGCGGCGG - Exonic
1010403959 6:75481485-75481507 CAGGAAGGAGAGCAGGGAGGTGG - Intronic
1011406856 6:87024716-87024738 CAGGCAGAGAATAAGGGTGGGGG - Intergenic
1011484790 6:87830133-87830155 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1011484800 6:87830165-87830187 GAGGAGGAGGAGGAGGGAGGAGG - Intergenic
1011883132 6:92057426-92057448 AAGGCAGAGGTGTTGGGAGGTGG - Intergenic
1012055067 6:94395751-94395773 CAAGGAGAGGAGGAAGGAGGAGG + Intergenic
1012057590 6:94433211-94433233 CAGGCAGGGGACTAGGGGAGGGG + Intergenic
1012599561 6:101078403-101078425 CAGACAGAGAGGTAGGGAGGAGG + Intergenic
1013056584 6:106589173-106589195 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1013480210 6:110546520-110546542 CAGGAAGATGAGGAGGAAGGGGG - Intergenic
1013485062 6:110588991-110589013 CAGACAGAGGACTAGGGAATTGG - Intergenic
1013491937 6:110655993-110656015 CAGGCAGAGGAGTATGAATAAGG - Intronic
1014158173 6:118136125-118136147 CAGGCAGTGGGGATGGGAGGAGG - Intronic
1014179608 6:118370781-118370803 GGGGCAGAGGAGCAGGGAGTTGG - Intergenic
1014207585 6:118672896-118672918 AAAGAAGAGGAGGAGGGAGGAGG + Intronic
1014300683 6:119677711-119677733 GGGGCAGAGGAGAAGGGTGGTGG - Intergenic
1015091570 6:129364911-129364933 CAGGCAGAGCAGGAGGAAGTGGG + Intronic
1015101697 6:129489302-129489324 GAGGCAGAGGACAAGGGAGAAGG - Intronic
1015405652 6:132834306-132834328 CAGAAAGAGGATGAGGGAGGAGG + Intergenic
1015658018 6:135541581-135541603 AAGTCAGAGGAGTAGGGGAGGGG - Intergenic
1016241256 6:141934378-141934400 CAGGCAGAGGTGTAGTGCAGGGG + Intergenic
1016307174 6:142696528-142696550 CAGGCAGAAGAGGAGAGTGGAGG - Intergenic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017557181 6:155583888-155583910 TAGGCAGAGGAGTCTGGAAGTGG + Intergenic
1017665258 6:156713752-156713774 GAGGCAAAGGAGGAGGGAGGAGG + Intergenic
1017965125 6:159257564-159257586 CAGGCCGAGGAACATGGAGGAGG + Intronic
1018451583 6:163913179-163913201 CAGGCAGATGAATATGGAGTGGG + Intergenic
1019079733 6:169422164-169422186 CATGCAGAGGAATAGGTAGGAGG - Intergenic
1019312039 7:367589-367611 CAGCCTGGGGAGGAGGGAGGGGG + Intergenic
1019404839 7:877747-877769 AAGGGAGAGGTGGAGGGAGGTGG - Intronic
1019448978 7:1086707-1086729 CAGGCAGAGGACTGGGGTGCTGG - Intronic
1019491247 7:1314597-1314619 CAGGGAGAGCAGTGGGGAAGAGG - Intergenic
1019494966 7:1333457-1333479 GAGGGGGAGGAGGAGGGAGGAGG - Intergenic
1019517426 7:1446191-1446213 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517435 7:1446210-1446232 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517444 7:1446229-1446251 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517453 7:1446248-1446270 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517483 7:1446335-1446357 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517492 7:1446354-1446376 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517522 7:1446441-1446463 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019543095 7:1560246-1560268 CAGGGACAGGAGCAGGGAGGTGG - Intronic
1019562627 7:1666048-1666070 GAGGAAGAGGAGGAGGAAGGAGG + Intergenic
1020009890 7:4802020-4802042 CAGGTAGAGGAGTGGCCAGGTGG + Intronic
1020794926 7:12667618-12667640 GAGGAAGAGGACGAGGGAGGAGG + Intergenic
1021306835 7:19042645-19042667 CTACTAGAGGAGTAGGGAGGGGG - Intronic
1021952174 7:25785767-25785789 CAAGGAGAGGATGAGGGAGGTGG + Intergenic
1021981388 7:26058980-26059002 TAGGCAGAGGATTAGGAATGTGG + Intergenic
1022318859 7:29269197-29269219 CTGGCAGAGTAGTGGGGAGAGGG - Intronic
1022657262 7:32330947-32330969 GAGACAGAGGAGGAGGGAGGAGG - Intergenic
1022715211 7:32892097-32892119 CCGGCAGAGGAAAAGGGCGGGGG - Intronic
1024232189 7:47371047-47371069 CACGCAGAGAAGTGGGGAGTGGG + Intronic
1024880116 7:54075191-54075213 GAGGCAGAGGAACAGAGAGGAGG - Intergenic
1025087234 7:56033252-56033274 GAGGCAGAGGTGGAGGCAGGTGG + Intronic
1025227830 7:57179667-57179689 AAGGCAGAGGAGGTGGGAAGAGG - Intergenic
1025230956 7:57203172-57203194 GAGGCGGAGGAGGCGGGAGGAGG - Intergenic
1025898183 7:65723154-65723176 CAGGATGGGGAGTGGGGAGGAGG - Intergenic
1026104441 7:67409989-67410011 AAGGCAGAGAGGGAGGGAGGAGG - Intergenic
1026360652 7:69598899-69598921 GCGGCGGAGGAGAAGGGAGGCGG - Intronic
1026482405 7:70790232-70790254 CTGGACGAGGAGTTGGGAGGCGG - Exonic
1027192621 7:76005908-76005930 GAGGAGGAGGAGGAGGGAGGAGG + Intronic
1028382164 7:90211832-90211854 CAGCCAGGGGAGAAGGAAGGAGG - Exonic
1028475094 7:91244626-91244648 AATGCTGAGGAGAAGGGAGGAGG - Intergenic
1028653067 7:93171943-93171965 CAGGCAGGGGACTAGGGAATGGG + Intergenic
1028789293 7:94835173-94835195 CAGGCAGGTGGGTAGGGAGGTGG - Intergenic
1029058122 7:97768081-97768103 CAGGCAGAGGAGGTGGTAGCTGG + Intergenic
1029434379 7:100554141-100554163 TTGACAGAGGAGTGGGGAGGTGG - Exonic
1029463518 7:100710672-100710694 CAGGCAGAAAAGAAGGGAGATGG + Intergenic
1029547125 7:101216515-101216537 CTGGGAGAGGAGTGGCGAGGGGG - Exonic
1029715718 7:102324406-102324428 CAGGCGCAGGAGCAGCGAGGTGG + Intergenic
1030216211 7:107045392-107045414 CAGAGAGCGGAGTAGGAAGGTGG - Intronic
1030316437 7:108119607-108119629 AAGGCAGAGGGGGAGGGAGGTGG + Intronic
1030383603 7:108842093-108842115 AGGGCAGTGGAGTAGGAAGGGGG - Intergenic
1030472457 7:109982275-109982297 CAGGCAGGGGACTAGGGAATGGG - Intergenic
1030509042 7:110460489-110460511 ATGGAAGAGGAGGAGGGAGGAGG + Intergenic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1031955396 7:127937446-127937468 GAGGGAGAGGAGAAGGGAGAAGG - Intronic
1031959732 7:127977917-127977939 CTGGAAGAGGAGGAGGTAGGTGG + Intronic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032492396 7:132333388-132333410 CAGGAAGAGGAAGAGGGAGGTGG + Intronic
1032566684 7:132954107-132954129 CAGGCAGAGGGACAGGCAGGAGG + Intronic
1032957634 7:136989932-136989954 CTGGGAGAGGTGAAGGGAGGTGG - Intronic
1033304163 7:140212287-140212309 CAGGGAGAGGACTAGGGTGGAGG - Intergenic
1033354921 7:140591944-140591966 AGGGGAGGGGAGTAGGGAGGGGG - Intronic
1033733035 7:144196585-144196607 CAGGGAGAGGGACAGGGAGGGGG - Intergenic
1033743887 7:144295165-144295187 CAGGGAGAGGGACAGGGAGGGGG - Intergenic
1033750014 7:144354402-144354424 CAGGGAGAGGGACAGGGAGGGGG + Intergenic
1034219109 7:149430946-149430968 CTGGCTGAGGAGTAGGGTGGCGG - Intergenic
1034350673 7:150412866-150412888 AAGGAAGAGGAGCAGGGAAGGGG - Intergenic
1035326001 7:158066467-158066489 CATACTGAGGAGTTGGGAGGTGG - Intronic
1035497904 8:68581-68603 CAGGCAGAGGAGTAGCAATGTGG - Intergenic
1035857490 8:2992248-2992270 GAGGTAGAGGAGTAGGGAAATGG + Intronic
1035939083 8:3875680-3875702 CTGGCTGAGGTCTAGGGAGGGGG + Intronic
1036017567 8:4802243-4802265 CAGGCAGAGGAAAAGGGAAAAGG - Intronic
1036163068 8:6406830-6406852 CAGGCAGCGGGGGAGGAAGGAGG - Intronic
1036561885 8:9905394-9905416 CAGGCAGATGAATAAGGGGGGGG + Intergenic
1036565378 8:9933826-9933848 CAGGCAGAGGGGGACGGAAGAGG + Intergenic
1036637769 8:10563776-10563798 CAGGCAGAGGGGCAGCGATGGGG - Intergenic
1036746959 8:11416739-11416761 CAGGCAGAAGAGGAGGAAGTTGG - Intronic
1037053797 8:14410218-14410240 CAGGCAGAAGGAAAGGGAGGAGG - Intronic
1037614760 8:20508785-20508807 AAGCCAGAGAAGTAGGGAGCTGG + Intergenic
1037786058 8:21903988-21904010 GAGCCAGAGGAGCTGGGAGGGGG - Intergenic
1037961584 8:23102276-23102298 GAGGCTGAGGAGTAGGTAGGAGG - Intronic
1037969940 8:23164645-23164667 GAGGCTGAGGAGTAGGTAGGAGG + Intergenic
1038399717 8:27274333-27274355 CGGACAGAGGAGTAAGAAGGTGG - Intergenic
1038412354 8:27368316-27368338 CAGGCCAAGGAGCAGGGTGGGGG - Intronic
1038423795 8:27451679-27451701 CAGGGAGAGGAATGGGGTGGAGG - Intronic
1038522442 8:28244721-28244743 CAGGAAGAGGAGGAGGGGAGGGG + Intergenic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1039434049 8:37547471-37547493 CAGGCAGAGGGGCAGGGGAGTGG - Intergenic
1039475095 8:37835466-37835488 CAGTGAGAGGAGGTGGGAGGAGG + Intronic
1039488010 8:37927063-37927085 GAGGGAGAGGGGGAGGGAGGGGG - Intergenic
1039848448 8:41342565-41342587 GAGGCAGAGGAGGAGGGAAAGGG + Intergenic
1040370143 8:46762310-46762332 CAGGCAGAGGAGGTGGTAGCTGG - Intergenic
1040698291 8:50029493-50029515 CAGGAAGAGAAGTGGGGAGGTGG - Intronic
1041170884 8:55141253-55141275 GAGGCAGAGGAGGAGGGAGGCGG - Intronic
1041291157 8:56310091-56310113 GAGGAAGAGGAGGAAGGAGGAGG + Intronic
1041291166 8:56310120-56310142 AAGGAGGAGGAGGAGGGAGGAGG + Intronic
1041291177 8:56310152-56310174 AAGGAGGAGGAGGAGGGAGGAGG + Intronic
1042487633 8:69363916-69363938 AAGGAAGAGGAGCAGGGAGGGGG + Intergenic
1042865013 8:73349388-73349410 CAGGGAGAGAAGCAGGGTGGTGG - Intergenic
1043147747 8:76678174-76678196 CTGGCAGGGGAGCGGGGAGGCGG - Intergenic
1043958725 8:86390718-86390740 GAGGGAGAGGGGGAGGGAGGAGG + Intronic
1044401830 8:91781657-91781679 CAGGCAGAGGAGATGGAGGGGGG - Intergenic
1045015045 8:97994172-97994194 AAAGAAGAGGAGGAGGGAGGGGG + Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045245202 8:100436501-100436523 GAGGCAGGGGAGGAGGAAGGAGG - Intergenic
1045772356 8:105758038-105758060 CAGGCAGAGTAATAGCGAGCAGG + Intronic
1046287627 8:112115349-112115371 CAGGCAGGTGGGTAGGGAGTGGG - Intergenic
1047120214 8:121894779-121894801 GAGGAAGAGGAGTAGGAAGAAGG - Intergenic
1047159002 8:122355498-122355520 TAGCCAGTGGAGTTGGGAGGAGG - Intergenic
1047537683 8:125734488-125734510 CAGGAAGAGGGGAAGGGAGAGGG - Intergenic
1048240008 8:132731954-132731976 AAGCCAGAGGAATTGGGAGGTGG + Intronic
1048394289 8:133999021-133999043 CAGGAAGGGTAGGAGGGAGGAGG + Intergenic
1048755473 8:137733263-137733285 CAGGCAGAGGACTGGGGGAGGGG + Intergenic
1048889432 8:138934481-138934503 GAGGAAGAGGAGGAGGGAGAAGG + Intergenic
1048996376 8:139796103-139796125 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1049125942 8:140787941-140787963 CAGTCACAGGAGTCTGGAGGAGG - Intronic
1049356710 8:142192748-142192770 GAGGGGGAGGAGCAGGGAGGAGG + Intergenic
1049356755 8:142192895-142192917 GAGGGGGAGGAGCAGGGAGGAGG + Intergenic
1049391304 8:142373017-142373039 CAGGCTGAGGGGTAGGATGGAGG - Intronic
1049395567 8:142398569-142398591 GAGGCAGTGGAGTGAGGAGGTGG - Intronic
1049406732 8:142454963-142454985 CATGCAGGGAAGGAGGGAGGAGG - Intronic
1049427546 8:142544146-142544168 GAGCCCGAGGAGTAGGGGGGAGG - Intronic
1049660312 8:143816886-143816908 TAGGCAGAGGGGCAGGGTGGTGG - Intronic
1049692728 8:143969707-143969729 CAGGCCGGGGAGTGGGGAGTGGG + Intronic
1049777719 8:144414154-144414176 CAGGGAGAGGGGTCAGGAGGTGG + Intronic
1049820367 8:144629763-144629785 CAGGAAGAGGAGGAGGGCGCTGG + Intergenic
1052020974 9:23524886-23524908 TAGAGAGAGGAGAAGGGAGGTGG - Intergenic
1052680136 9:31680566-31680588 AAGGAAGGGGAATAGGGAGGAGG + Intergenic
1052916596 9:33928026-33928048 GAGGCAGAGGAGGAGGGTGCTGG + Intronic
1052974445 9:34400875-34400897 CAGGCAGACGAGCTGGGAAGGGG + Exonic
1053124600 9:35569851-35569873 CAGGCAGCTGGGGAGGGAGGAGG + Intergenic
1053240146 9:36488090-36488112 GAGGCAGAGGAGGGGAGAGGAGG - Intergenic
1053434038 9:38063485-38063507 AAGGCAGGGGAGTGGGGAAGAGG - Intronic
1053789978 9:41679954-41679976 CAGGCGGAGGCGGAGGGTGGTGG - Intergenic
1054155160 9:61634803-61634825 CAGGCGGAGGCGGAGGGTGGTGG + Intergenic
1054155875 9:61639788-61639810 AAGGCAGAGGAGGAGGAAGAAGG + Intergenic
1054178317 9:61891643-61891665 CAGGCGGAGGCGGAGGGTGGTGG - Intergenic
1054359523 9:64100260-64100282 GAGGGAGAGGAGGAGGGAGAGGG - Intergenic
1054474953 9:65565911-65565933 CAGGCGGAGGCGGAGGGTGGTGG + Intergenic
1054659212 9:67689181-67689203 CAGGCGGAGGCGGAGGGTGGTGG + Intergenic
1055272672 9:74578893-74578915 CAGGCAGAGGACAAAGGATGAGG - Intronic
1055301464 9:74887439-74887461 GAGGGAGAGGAGTTCGGAGGTGG - Intronic
1055699091 9:78921761-78921783 AAGGCTGAGGAGGAGGAAGGAGG + Intergenic
1056153068 9:83806568-83806590 GAGGCAGAAGAGTAGGCAGATGG + Intronic
1056240098 9:84636734-84636756 GAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1056331175 9:85522592-85522614 CAGGCTGTTGAGTAGGGAAGTGG + Intergenic
1057032118 9:91783903-91783925 CATTCAGAGGACTGGGGAGGAGG - Intronic
1057120073 9:92563769-92563791 GAGGAAGAGGGGTAGGGAGGGGG - Intronic
1057305206 9:93908344-93908366 CAGGCAGGGGGGTAGGTGGGTGG + Intergenic
1057578292 9:96261758-96261780 AAGTCTGAGGAGTAGGGAGATGG - Intronic
1057872400 9:98728345-98728367 CAGGCAGAGGAGCTGGGATATGG - Intergenic
1057884745 9:98821802-98821824 AAAGCAGAGGAGTGGGGAGGGGG - Intronic
1057885591 9:98827301-98827323 GAGGCTGAGGAGGAGTGAGGAGG - Intronic
1057891722 9:98874790-98874812 CTGGAAGAGGAGAAAGGAGGTGG - Intergenic
1058418301 9:104810932-104810954 CAGGCAGTGGAGGGGGCAGGGGG + Intronic
1058746463 9:107996575-107996597 CAGGCAGAGAAGAACTGAGGAGG - Intergenic
1058864568 9:109149694-109149716 CAGGAGGAGCAGTAGGGAAGGGG + Exonic
1059072417 9:111152799-111152821 GAGGCAGAGGAGGAGGAAGGAGG + Intergenic
1059072424 9:111152818-111152840 GAGGCGGAGGAGGAGGGAGGAGG + Intergenic
1059072443 9:111152891-111152913 GAGGTGGAGGAGGAGGGAGGAGG + Intergenic
1059072460 9:111152949-111152971 CAGGAGGAGGAGGAAGGAGGAGG + Intergenic
1059247589 9:112861879-112861901 CACGCTGAGGAGGATGGAGGGGG - Intronic
1059315578 9:113423026-113423048 CAGGCACAGGGCTAGGGATGGGG - Intronic
1059331156 9:113536609-113536631 CAGCCAGAGGCGCAGGGAAGTGG - Intronic
1059446515 9:114341654-114341676 CAAGCAGAGGAGCAAGCAGGCGG - Exonic
1059929088 9:119243207-119243229 CTGTCAGAGGGGTAGGGTGGGGG - Intronic
1060114522 9:120929455-120929477 CAGGCAGGGGACCAGGGTGGGGG - Intergenic
1060168751 9:121443194-121443216 CAGGCAGAGGAGTAGGTGGAAGG - Intergenic
1060180287 9:121529016-121529038 CAGGCAGAGAGGAAGGGTGGAGG + Intergenic
1060234157 9:121850541-121850563 AAGGGGGAGGAGTGGGGAGGTGG + Intronic
1060355725 9:122905294-122905316 GAGGCGGAGGTGGAGGGAGGAGG - Intronic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1061085074 9:128393666-128393688 CTGGCCCAGGAGAAGGGAGGGGG - Intergenic
1061238864 9:129357793-129357815 CAGGCTGGGGAGGAGGGTGGTGG - Intergenic
1061257301 9:129460308-129460330 CAGGCGGGGGAGGAGGGAGGAGG - Intergenic
1061313245 9:129777617-129777639 TGGGAAGAGGAGGAGGGAGGAGG - Intergenic
1061378526 9:130240461-130240483 CAAGGAGAAGAGTAGGGAGTCGG + Intergenic
1061507196 9:131038101-131038123 CAGGCAGAGGAAGAGGGGGCGGG - Intronic
1061520285 9:131113747-131113769 CAGGCAGAGGGGCAGCGAGCTGG + Intronic
1061572398 9:131485843-131485865 CAGACCTAGGAGGAGGGAGGAGG - Intronic
1061680904 9:132242053-132242075 CAGGCAGCCGAGCAGGGTGGCGG - Exonic
1061783209 9:133007912-133007934 AAGGAACAGGAGGAGGGAGGTGG - Intergenic
1061868432 9:133507297-133507319 CAGGCAGGAGTGTGGGGAGGAGG - Intergenic
1061890156 9:133615029-133615051 CAGCCAGATGAGGAGGGAGGTGG - Intergenic
1061930485 9:133830280-133830302 CAGGCACAGGAGTGAGGAGAAGG - Intronic
1061934966 9:133852388-133852410 AAGGCAGAGCAGAAGGGTGGGGG + Intronic
1061967638 9:134025260-134025282 CTGGAGGAGGAGGAGGGAGGAGG - Intergenic
1062074716 9:134579696-134579718 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1062216242 9:135391197-135391219 CATGCAGAGGATGAGGGAGAAGG + Intergenic
1062403534 9:136382861-136382883 CAGGCTCACGAGGAGGGAGGAGG + Intronic
1062464811 9:136676291-136676313 CAGGTAGAGGGGTGGGGAGCCGG - Intronic
1062590335 9:137271799-137271821 CAGGGACAGGAGGAGGGTGGAGG - Intronic
1185610905 X:1393011-1393033 AAGGGAGAGGAGGCGGGAGGAGG - Intergenic
1185648028 X:1628881-1628903 CAGACCGAGGAGAAGAGAGGAGG - Intronic
1185662080 X:1735757-1735779 GAGAAAGAGGAGGAGGGAGGAGG - Intergenic
1185996633 X:4958191-4958213 AAGGAAGAGAGGTAGGGAGGAGG - Intergenic
1186047299 X:5550384-5550406 AAGGCAGAGGGAAAGGGAGGCGG - Intergenic
1186071052 X:5821189-5821211 TAGGCAGAGGAGTAGGATGGGGG - Intergenic
1186239806 X:7554139-7554161 GAGGAAGAGGAGGAGGAAGGAGG + Intergenic
1186246664 X:7622632-7622654 AAGGGAGAGAAGGAGGGAGGAGG - Intergenic
1186655245 X:11605135-11605157 AAGGGACAGGAGGAGGGAGGGGG + Intronic
1186737703 X:12483145-12483167 TAGGCAGAGGAGTAGGTTTGGGG + Intronic
1187365884 X:18665532-18665554 CAGGCGGAGAAGTAGGGGTGGGG - Intronic
1187515021 X:19961045-19961067 AAGGAAGAGGAGGAGGGAGGAGG - Intronic
1187736914 X:22314148-22314170 GAGGAGGAGGAGGAGGGAGGAGG + Intergenic
1187940448 X:24375858-24375880 CAGACAGGGAAGTGGGGAGGGGG + Intergenic
1188600232 X:31954731-31954753 CAGAAATAGGAGTAGGGAGAGGG + Intronic
1189363297 X:40369633-40369655 GGGGCAGGGGAGTGGGGAGGGGG + Intergenic
1189364738 X:40379943-40379965 CAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1189840492 X:45070836-45070858 CAGGCAGAAGAGGAAGGAAGAGG + Intronic
1189911287 X:45812849-45812871 CAGAAAGAAGAGGAGGGAGGAGG + Intergenic
1190058176 X:47194137-47194159 GAATCAGCGGAGTAGGGAGGGGG + Intronic
1190396815 X:49993418-49993440 CCAGGACAGGAGTAGGGAGGGGG + Intronic
1190618807 X:52264926-52264948 CTTGGAAAGGAGTAGGGAGGTGG + Intergenic
1190625809 X:52337455-52337477 CTTGGAAAGGAGTAGGGAGGTGG - Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1191576833 X:62715448-62715470 GAGGCAGAGGAAAAGAGAGGAGG + Intergenic
1191663546 X:63674789-63674811 CAGGCACAGAAGGAGGTAGGGGG - Intronic
1192183213 X:68929313-68929335 CAGGAAGAGGTAGAGGGAGGCGG + Intergenic
1192191725 X:68995288-68995310 GAAGCAGGGGAATAGGGAGGAGG - Intergenic
1192225209 X:69222794-69222816 CAGGCAGTGGTGTACGGATGGGG - Intergenic
1192260630 X:69504331-69504353 CACGGAGAGGAGGAGGGAGCGGG - Intergenic
1192433775 X:71129733-71129755 CTTCCAGAGGAGGAGGGAGGAGG + Exonic
1192436395 X:71145953-71145975 AAGGGGTAGGAGTAGGGAGGTGG - Intronic
1195848563 X:109256222-109256244 TGGGCAGAGGAGTAGCGATGGGG + Intergenic
1196316331 X:114229192-114229214 CTGGCCAAGGAGGAGGGAGGAGG - Intergenic
1196629859 X:117926265-117926287 CAGACAGAGGTGCAGGGAGTGGG + Intronic
1196923008 X:120603914-120603936 CAGGAAGAGAAGAATGGAGGGGG - Intronic
1197018878 X:121661589-121661611 CAGGAAGGGGAGGATGGAGGAGG + Intergenic
1197840161 X:130737783-130737805 CATTCAGAGGAGTAGGGAGTGGG + Intronic
1197892342 X:131279563-131279585 TAGGCTGCGGAGTGGGGAGGGGG - Intronic
1198416883 X:136429380-136429402 CAGGGGCAGGAGCAGGGAGGTGG - Intergenic
1198505477 X:137296989-137297011 CTGGCAGAGGTGTTGGGAGTAGG - Intergenic
1198723215 X:139647493-139647515 CAGGCAGAGGTGTAGGGTTGTGG + Intronic
1198820467 X:140642305-140642327 GAGGCAGAGAAGGAGGCAGGAGG - Intergenic
1198863510 X:141096056-141096078 CAGGCAGACAAGAAGGGAAGGGG + Intergenic
1198899179 X:141491331-141491353 CAGGCAGACAAGAAGGGAAGGGG - Intergenic
1199259230 X:145751479-145751501 CAGGCAGAGAAGCCTGGAGGTGG - Intergenic
1200160352 X:154004630-154004652 CAGCCAGAGCAGGAGGGTGGCGG + Intergenic
1201521039 Y:14873886-14873908 GAGGCTGAGGAATAAGGAGGAGG + Intergenic
1201579039 Y:15492075-15492097 CAGGCAGGAGAGCAGGAAGGTGG + Intergenic
1201731640 Y:17210854-17210876 CAGGCAAAGGAGCTGGAAGGGGG - Intergenic
1202274379 Y:23100269-23100291 GAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1202291648 Y:23320402-23320424 GAGGAGGAGGAGGAGGGAGGGGG + Intergenic
1202377910 Y:24255249-24255271 CAGTCTGAGGTGGAGGGAGGGGG - Intergenic
1202427372 Y:24734020-24734042 GAGGAGGAGGAGGAGGGAGGGGG - Intergenic
1202443419 Y:24936074-24936096 GAGGAGGAGGAGGAGGGAGGGGG + Intergenic
1202492872 Y:25414872-25414894 CAGTCTGAGGTGGAGGGAGGGGG + Intergenic