ID: 1127975492

View in Genome Browser
Species Human (GRCh38)
Location 15:63994018-63994040
Sequence GCTCTCCTTGCCTGAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 233}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127975492_1127975495 1 Left 1127975492 15:63994018-63994040 CCAGGGCTTCAGGCAAGGAGAGC 0: 1
1: 1
2: 2
3: 20
4: 233
Right 1127975495 15:63994042-63994064 GATCTCAGGGACTATCTTCATGG 0: 1
1: 0
2: 0
3: 8
4: 132
1127975492_1127975496 6 Left 1127975492 15:63994018-63994040 CCAGGGCTTCAGGCAAGGAGAGC 0: 1
1: 1
2: 2
3: 20
4: 233
Right 1127975496 15:63994047-63994069 CAGGGACTATCTTCATGGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127975492 Original CRISPR GCTCTCCTTGCCTGAAGCCC TGG (reversed) Intronic
900674613 1:3877034-3877056 GCTCCCCTTTCCTGGAGCCCTGG + Intronic
901112473 1:6809504-6809526 TCTCTCCCTGCCCCAAGCCCAGG - Intronic
902635998 1:17735543-17735565 GCCCTCCTTGCCTTTAGCCTGGG + Intergenic
902841229 1:19075254-19075276 GCTCTCCCTGGCTGCAGGCCAGG + Intronic
903049417 1:20589565-20589587 GCTCTCCCTGCCTGCACCCCAGG - Intronic
903448590 1:23437684-23437706 GCTCCCTCTGCGTGAAGCCCTGG + Intronic
904565158 1:31424475-31424497 CCTCTCTGGGCCTGAAGCCCTGG - Intronic
904698047 1:32341551-32341573 GCTCTCCTTGCCAGCACCTCTGG - Intergenic
906312243 1:44762212-44762234 TCTCTCCTTGGCTGAAGGCAAGG + Intronic
906692896 1:47804406-47804428 GCTCTCCTTCCCTGGGGGCCTGG + Intronic
910124373 1:83824191-83824213 GATCTCTTTGTCTGCAGCCCTGG - Intergenic
910604486 1:89068175-89068197 GTTCTCCTTGCCTGTTGCCTAGG + Intergenic
915093768 1:153444775-153444797 TCTCACCTTCCCTGAAGCCCCGG + Intergenic
915980622 1:160417661-160417683 GCTCTCCATGCCTGGAGAACAGG + Intronic
916196152 1:162225231-162225253 TCTCACCTTTCCTGAAGGCCTGG + Intronic
916452678 1:164936008-164936030 GCTCTCTTTGCCTCCTGCCCAGG - Intergenic
916725071 1:167516297-167516319 GATCTTCTGGCCTCAAGCCCTGG + Intronic
919726447 1:200887791-200887813 GCTCTCCTGGGCTGGACCCCTGG - Intergenic
919878035 1:201884828-201884850 CCTCTTCTTTCCTGAGGCCCAGG + Intergenic
920009572 1:202858095-202858117 GCTCTCCCCGTCTCAAGCCCAGG - Intergenic
922790663 1:228309180-228309202 GGCCTCCTGGCCTGAAGCTCTGG - Exonic
924615110 1:245606100-245606122 GCTCTCCTTGCCTAAGTCCTGGG + Intronic
1063381250 10:5587656-5587678 GCTCACCTAGCCTGAGCCCCTGG + Intergenic
1065759896 10:28972766-28972788 GTTCTCATTGCCTGGAGCACTGG + Intergenic
1066293056 10:34031172-34031194 GCTCTGCTCCCCTTAAGCCCAGG + Intergenic
1067430004 10:46236613-46236635 GCTCTGATTGCCTGAAGGCAGGG - Intergenic
1070058000 10:72953872-72953894 GCTGTCCCTGCCTGCAGCCTCGG - Intronic
1071518615 10:86315345-86315367 GCCCTCCTTGCCTGGGGTCCAGG - Intronic
1073062544 10:100741210-100741232 GGGCTCCCTGCGTGAAGCCCGGG - Intronic
1073543575 10:104331250-104331272 GCTCTCCTACCCTCCAGCCCAGG + Intronic
1074767222 10:116708158-116708180 GCTCTCCCTGCCTGCTGCCTAGG + Intronic
1075112667 10:119599981-119600003 TCTCTCCTTCCCTGATGCCCAGG - Intergenic
1077373798 11:2195792-2195814 GCTCCCCTAGTCTGAAGGCCTGG - Intergenic
1077510457 11:2958136-2958158 ACTCTGCTTGGCTGTAGCCCAGG - Intronic
1081871214 11:46383369-46383391 CTTCTCCTTCCCTGATGCCCGGG + Intronic
1082761470 11:57131003-57131025 CCGCCCCTTGCCTGGAGCCCAGG + Intergenic
1082997010 11:59262799-59262821 GCTCTCCCTGCCTGACCACCAGG - Intergenic
1083115685 11:60457114-60457136 GCTCTCCTTGCCTGATTGCAAGG - Intronic
1083493705 11:63032228-63032250 GCTCTCCTTGTCAGGAACCCGGG - Intergenic
1083642756 11:64154218-64154240 GCTCTCATTCCCCAAAGCCCAGG + Intronic
1083720286 11:64600487-64600509 GCTCCCCTCTCCTGGAGCCCAGG - Intronic
1083722566 11:64610710-64610732 GCTTTCCTTGTCTGGATCCCAGG - Intronic
1084667925 11:70586449-70586471 GCCCTCCTTGCCACTAGCCCCGG - Intronic
1085317398 11:75553905-75553927 GCTCTCCTTGCTTGGGGCCTGGG - Intergenic
1087970219 11:104471765-104471787 TCCCTCCTTCCCTCAAGCCCTGG - Intergenic
1088470983 11:110187380-110187402 GCTCTCTTTGCTTCATGCCCAGG + Intronic
1088735435 11:112724466-112724488 GCTCAGCCTGCCTGCAGCCCGGG + Intergenic
1088806743 11:113359474-113359496 TGTCTCCCTGCCTGGAGCCCTGG + Intronic
1089466793 11:118690799-118690821 GCTCTCCTTCCCTGAGCTCCTGG + Intergenic
1090392846 11:126400600-126400622 GCACTCCTTACATGAAGCCAAGG - Intronic
1090635141 11:128686421-128686443 CGTCCCCTGGCCTGAAGCCCGGG + Intergenic
1090718669 11:129452977-129452999 CCTCTCCTCCCCTGAATCCCCGG + Intergenic
1092115580 12:6000264-6000286 GATCTTTTTGCCTGAAGGCCTGG - Intronic
1093188082 12:16044806-16044828 GCTGTCTTTGCCTGAAGCCAAGG + Intergenic
1094630036 12:32164997-32165019 GCTCTGCTTTGCTGAAGCACAGG + Intronic
1095625050 12:44304568-44304590 GCTCTCCTCTCCTGAAGCAGAGG - Intronic
1096781549 12:53994983-53995005 GGTCTCTCTGCCTGAGGCCCTGG + Intronic
1096964111 12:55611476-55611498 GCTCTGCTTTCCTGAATCCATGG + Intergenic
1097171772 12:57118738-57118760 CATCTCCTTGCTTGAAGCCTGGG - Intronic
1098532738 12:71559074-71559096 TCCCTCCTAGCCTGAAGTCCAGG - Intronic
1098885371 12:75955344-75955366 TCTCTCCTGGCCAGCAGCCCAGG - Intergenic
1100420014 12:94423819-94423841 GCTCTCCTCGACTGAAACACTGG + Intronic
1102236566 12:111297730-111297752 CCTCTCCTTGACTGAGGACCGGG - Intronic
1102741661 12:115213010-115213032 GTTCTCGTTGCCTGATGACCTGG + Intergenic
1102950285 12:117026537-117026559 GCTCTCCTTGACTAAAGCAAAGG - Intronic
1104044794 12:125154162-125154184 GCACTGCTTGCCTGCAGGCCAGG - Intergenic
1104444885 12:128824623-128824645 CCTCTCCAGGACTGAAGCCCAGG - Intergenic
1104567284 12:129896367-129896389 GCTCTCATTCCCTGCTGCCCTGG - Intronic
1104728511 12:131092579-131092601 GCTTCCCATGCCTGAAGCCTGGG - Intronic
1107962119 13:45567876-45567898 GCTCACCTAGCGTGAAGCCAGGG + Intronic
1108109530 13:47053867-47053889 GTTTTCCTTGCCTGGAGCTCTGG + Intergenic
1108258373 13:48632223-48632245 GGGCTCCCTGCCTGAAGACCTGG - Intergenic
1109522003 13:63525819-63525841 GCTGTCCTTGCCTCCAGCTCTGG + Intergenic
1109646385 13:65264085-65264107 GCCCTCCTTGCTTCATGCCCAGG + Intergenic
1110354504 13:74551738-74551760 CCTCTCCCTGCTTGAAGACCTGG - Intergenic
1112494907 13:99896556-99896578 GGTCTCCTTGACCGAAGCCCCGG + Exonic
1113432872 13:110265639-110265661 GATCTCCTTTCCTGAAAGCCAGG - Intronic
1113565238 13:111315810-111315832 CGTCTCCTGGCCTGGAGCCCAGG + Intergenic
1117101266 14:52350710-52350732 GCTCTCCTTGTTTGGTGCCCTGG - Intergenic
1118709908 14:68510496-68510518 GCTCTCCCTGGTAGAAGCCCTGG + Intronic
1118951536 14:70440328-70440350 GCTCCCATTTCCTGAATCCCTGG + Intergenic
1119467025 14:74866302-74866324 GATCTCCCTGACTGAACCCCAGG - Intronic
1119600052 14:75969685-75969707 GCTCTACTTGCATGACGACCCGG + Intronic
1120190473 14:81435909-81435931 ACTCCCCTCGCCTGAAACCCCGG - Intronic
1122133648 14:99620399-99620421 GCACTCCCTGCAAGAAGCCCAGG - Intergenic
1122236082 14:100331282-100331304 GCTCTCCTTGCCTGACCACTGGG + Intergenic
1122347041 14:101067167-101067189 GTGCTCCTTGCCTTCAGCCCTGG - Intergenic
1124856779 15:33396823-33396845 AATCTCCTTTCCTGTAGCCCAGG - Intronic
1125717353 15:41826936-41826958 GCTCTCGTGGCCTGAAGCTGTGG - Exonic
1126025111 15:44438842-44438864 TTTCTACTTGCCTGCAGCCCAGG - Intronic
1126839929 15:52708036-52708058 ACTCTCCTTTCCTGAAGTCCCGG - Intronic
1127863449 15:63013156-63013178 TTTCCCCTTGCCTGAGGCCCAGG + Intergenic
1127975492 15:63994018-63994040 GCTCTCCTTGCCTGAAGCCCTGG - Intronic
1128980074 15:72179532-72179554 GCTCTCCTAGACTGGAGGCCTGG - Intronic
1129251482 15:74311402-74311424 GCTCTCCAGGCCTGAATCCTAGG - Intronic
1130955164 15:88622201-88622223 CCCCTCCCTGCCTGAAGGCCGGG + Intronic
1132342820 15:101088839-101088861 CCTCTCCCTCACTGAAGCCCGGG + Intergenic
1132885214 16:2179430-2179452 GCTCACCTTGCCCCCAGCCCTGG + Intronic
1133455878 16:5942094-5942116 GTTCTTCTTGCCTGATGCCCAGG + Intergenic
1134848466 16:17460989-17461011 AGTCTCCTTGTCTGAAGCACAGG - Intronic
1135415485 16:22265467-22265489 GCTCTCCAAGCCTGGATCCCAGG + Intronic
1137556079 16:49471231-49471253 GTTCTTATTGCCTGAAGCCATGG + Intergenic
1137580822 16:49632494-49632516 GCTCTGCCTGCCTGGAGGCCTGG - Intronic
1137934166 16:52617853-52617875 GCACTCCTTTCCTGAACCCCTGG - Intergenic
1138034486 16:53590662-53590684 GCTCTGCTTTCAGGAAGCCCAGG - Intergenic
1138177014 16:54909615-54909637 GCTCTCCTTGGCCCAAGCCTGGG - Intergenic
1138185366 16:54972632-54972654 GCTCTCCTTGGCCCAAGCCTGGG + Intergenic
1138578931 16:57926947-57926969 GCTCTTGTTGCCTGTTGCCCAGG - Intronic
1140411524 16:74743800-74743822 CCCCTCCTTGGCAGAAGCCCAGG + Intronic
1140927884 16:79600342-79600364 GCGCGCCCTGCCTGCAGCCCGGG - Exonic
1142017193 16:87755937-87755959 GCTCACCTTCCCTGCAGCCCGGG - Intronic
1142312408 16:89321520-89321542 GCACTCCTTGCCAGAGGCCTTGG + Intronic
1143627775 17:8121157-8121179 GCTCTCCATGGCCCAAGCCCCGG - Exonic
1145155197 17:20540960-20540982 GCAGTGCTTGCCTGAAGCTCTGG + Intergenic
1147769607 17:42858419-42858441 CTTCTGCTTGCCAGAAGCCCAGG + Intergenic
1148506056 17:48127942-48127964 GCTTTCTTTTCCTGATGCCCAGG - Intergenic
1150530585 17:65977368-65977390 GCTCTTCTTCCCTGAAGCTTGGG - Intronic
1150830284 17:68512563-68512585 GCTCACCTCGCCTGAGCCCCCGG - Exonic
1151496890 17:74463298-74463320 GCCCTCCTTGCTTCAAGCTCAGG + Intergenic
1151886767 17:76927192-76927214 ACGTTCCTTGCCTGGAGCCCTGG - Intronic
1151967828 17:77440867-77440889 GATCTCCATGCCTGCAGGCCTGG + Intronic
1152112605 17:78365582-78365604 GCCCTCCTCGGCTGCAGCCCTGG + Intergenic
1152351325 17:79785471-79785493 GCCCACCTTGCCTTCAGCCCTGG + Exonic
1152822157 17:82442855-82442877 GCGCGCCTGGCCTGATGCCCTGG - Exonic
1154338657 18:13485449-13485471 GCTCTCCATGTCTGCAGGCCAGG + Intronic
1154472376 18:14717007-14717029 CCTCTCCTTGGCTGCAGCACCGG + Intergenic
1156370674 18:36468939-36468961 CCTCTCCTTCCCTGAGCCCCAGG - Intronic
1158082157 18:53605373-53605395 GCTCTGCTTGCCAGAAGCCAAGG - Intergenic
1158690910 18:59659663-59659685 GCTCTGCTTCCCTGAGACCCAGG - Intronic
1160530334 18:79558747-79558769 GCACCCCATGCCTGAAGCTCAGG - Intergenic
1161233337 19:3186387-3186409 GCTCTCCTTGCCTAGCGCCCAGG + Intronic
1162440763 19:10690741-10690763 GCTCTGCTGGCCTGAGCCCCAGG + Exonic
1163302413 19:16456364-16456386 CCACGCCTGGCCTGAAGCCCAGG - Intronic
1166745850 19:45141571-45141593 GTTCTCCTGGCCTGAGGGCCAGG - Intronic
1168304063 19:55424851-55424873 GCTCTGCTGGCCTGAGTCCCAGG - Intergenic
1168526240 19:57090778-57090800 GCACTCATTCCCTGAATCCCGGG + Intergenic
927068246 2:19495661-19495683 GCTCTTCTCGCCTTATGCCCTGG + Intergenic
927826175 2:26311624-26311646 CCTCTCCCTGGCTGAAGGCCCGG + Exonic
929780192 2:44952390-44952412 CCTCTCCCAGCCTGATGCCCTGG + Intergenic
930754936 2:54964463-54964485 GCTCTCATTGCCTTTAGGCCTGG + Intronic
931800249 2:65751088-65751110 GATCTCCTTGTCTTAATCCCTGG - Intergenic
932080482 2:68709880-68709902 GCTCTCTTTGCCTCCACCCCAGG - Intronic
935892517 2:107694498-107694520 ACTCTTCTTGCCTGAAGCCCAGG - Intergenic
939673120 2:145038104-145038126 GATGTCCTTGCCTGAAGCCTTGG - Intergenic
944541367 2:200756928-200756950 GCTCACTTTCCCTGAAGCTCAGG - Intergenic
945506432 2:210647100-210647122 CCTCTCCTTGGCTGCAGCCTTGG - Intronic
946682681 2:222233616-222233638 GCTCTTCCTGCCTGTAGCCCTGG - Intronic
947525610 2:230875066-230875088 GCTGTCCTGGCCTGCAGACCTGG - Intronic
948055749 2:235008246-235008268 GCTCAGCCAGCCTGAAGCCCTGG + Intronic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948291142 2:236825844-236825866 CCTCTCCTTCTTTGAAGCCCTGG + Intergenic
948999080 2:241602061-241602083 ACTCTCCTTGCCTGCAAGCCGGG + Intronic
1171034912 20:21706694-21706716 GGTCTCCTTGCTTGTAGTCCCGG - Exonic
1171333018 20:24357933-24357955 GCTCCCCTTCCCTGAGGCCCAGG + Intergenic
1172195252 20:33087099-33087121 CCTCTCCTTGCCTGGACCCTGGG - Intronic
1173819381 20:46010786-46010808 GCTCTCCCAGCCTGGCGCCCTGG - Intronic
1176510740 21:7745588-7745610 TCTCTCCCTGCTGGAAGCCCAGG - Intronic
1176802115 21:13440892-13440914 CCTCTCCTTGGCTGCAGCACCGG - Intergenic
1178644853 21:34376117-34376139 TCTCTCCCTGCTGGAAGCCCAGG - Intronic
1178780493 21:35598635-35598657 TCTCCTCTTGCTTGAAGCCCGGG + Intronic
1178954481 21:37010165-37010187 GCTTTGCTTGCCGGGAGCCCTGG - Intronic
1179308591 21:40176857-40176879 TCTCTCCCTGCCAGAAGGCCAGG - Intronic
1179800795 21:43810724-43810746 GTTCTCATTGCATGGAGCCCTGG + Intergenic
1181904320 22:26181437-26181459 AATTTCCTTTCCTGAAGCCCTGG - Intronic
1182112697 22:27734599-27734621 GGTCTCCTTTCCTGCATCCCTGG + Intergenic
1183453196 22:37907416-37907438 GCTCTCTCTGCCTTGAGCCCTGG + Intronic
1184192942 22:42907145-42907167 GCTCAGCTTGGCTGGAGCCCAGG + Intronic
1184453416 22:44596199-44596221 TCTCTCCTTGCCAGAAGTCGGGG + Intergenic
1185199336 22:49492062-49492084 GCTCACCTGGCCTGGACCCCAGG + Intronic
1185251263 22:49802784-49802806 GCTGTCCTTTCCAGGAGCCCTGG + Intronic
950183978 3:10933830-10933852 GCTCTCCTGGCCTCAGGCCCAGG - Intronic
950363654 3:12467970-12467992 GATCTCCTTGCCTTCAGGCCAGG + Intergenic
950479732 3:13236927-13236949 GCTCTGCTTGTCTGAGGCCGAGG + Intergenic
950696021 3:14701797-14701819 GCTCTCTTTTCCTGGAACCCGGG + Intronic
952190682 3:31020026-31020048 GCTTTCCTTTCCTGACTCCCAGG + Intergenic
952879345 3:37973627-37973649 GACCTCCTTGCCTGCTGCCCAGG + Intronic
953212013 3:40884481-40884503 GCTCATCTTGCCTGCTGCCCAGG + Intergenic
953745618 3:45571734-45571756 GTTCTTCTTGCCTGCTGCCCAGG - Intronic
953790166 3:45941286-45941308 GCTCTCCTTACCTGAAGACCTGG - Intronic
954118051 3:48478139-48478161 GCTGTCCTGCCCTGAGGCCCAGG - Intronic
957063571 3:75502193-75502215 GTTCTACTTGCCTGGAGCTCTGG + Intergenic
961289799 3:125837172-125837194 GTTCTACTTGCCTGGAGCTCTGG - Intergenic
961412231 3:126730700-126730722 CCTCTCCTTGCCTGAAGCCCTGG + Intronic
963218190 3:142774602-142774624 GCTATTCCTGCCTGAAGCACTGG + Intronic
965955448 3:174363546-174363568 GTTCTGCTTGGCTGAAGCTCAGG - Intergenic
966008842 3:175051349-175051371 GGTCTCCTGTCCTGAAACCCAGG + Intronic
968132467 3:196199491-196199513 GCTGTCCTTGCATGGAGTCCTGG - Intronic
968986065 4:3875055-3875077 GCTCCCCATGCCTTAAGCCTCGG - Intergenic
969539546 4:7778446-7778468 GGTCTCCTGACCTGGAGCCCAGG + Intronic
969746132 4:9073667-9073689 GTTCTACTTGCCTGGAGCTCTGG - Intergenic
969873953 4:10122373-10122395 GCTTTCGTTGCCTGAAGCTATGG - Intergenic
969886929 4:10223255-10223277 GCTACCCTTGACTGAAGCTCTGG + Intergenic
971395201 4:26220832-26220854 GCTCCCCTGGCCTGAGGTCCAGG + Intronic
974234313 4:59161064-59161086 GCACTCCTTGCGTGCAGCCCTGG - Intergenic
976207581 4:82637556-82637578 GCTCCACTTGGCTGAAGCCTGGG - Intronic
979059819 4:116043692-116043714 GTTTTCCTTGCCAGAAGGCCTGG + Intergenic
979717839 4:123862987-123863009 GCTCACCAAGCCGGAAGCCCTGG - Intergenic
981498514 4:145420817-145420839 GCACTCCTTGCTAGAGGCCCTGG + Intergenic
984520055 4:180790699-180790721 GCTCTCTTTGCCTCAACCTCTGG - Intergenic
986843175 5:11721809-11721831 GGTCTACTTCCCTGTAGCCCTGG + Intronic
988783144 5:34541767-34541789 GTTCTTCTTGCCTGCTGCCCAGG + Intergenic
990952399 5:61311221-61311243 GCTCTAATTGCCTCAGGCCCTGG + Intergenic
991657450 5:68918327-68918349 GTTCTTCTTGCCTGCTGCCCAGG + Intergenic
999258065 5:150220795-150220817 TCTCTCCTGGCCTGCAGACCTGG + Intronic
999748876 5:154611485-154611507 GCTCTCTGTGCCTGAAGGCCAGG - Intergenic
1000003457 5:157162220-157162242 GCTCTACTTGCCTGGAGGCTGGG + Exonic
1001517386 5:172365489-172365511 GCTCTCCTTCCCCGAGGGCCTGG + Intronic
1004950826 6:20669744-20669766 ACTTTCCTTGCCTCAAGTCCTGG + Intronic
1006379965 6:33691694-33691716 GCTCTCGGTGCCTGAGGTCCTGG + Exonic
1006392057 6:33764301-33764323 TCTCTCCTTCCCTGTGGCCCAGG - Intergenic
1007697970 6:43745586-43745608 GCTCTCCTTGCCTGCAAACAAGG - Intergenic
1008441230 6:51533949-51533971 GTTCCCCTTTCCTGAAGCCCTGG + Intergenic
1012896947 6:104959549-104959571 GTTTTCCTTTCCTGAAGGCCTGG + Intronic
1013411670 6:109889078-109889100 GCTCCCATTTCCTGAATCCCTGG + Intergenic
1015741824 6:136464049-136464071 TCTCTCCTTGTCTGAAGCCTGGG - Intronic
1017636089 6:156444491-156444513 GCCCTCCTTGCCTGTGGCCAAGG + Intergenic
1017779942 6:157708040-157708062 GCTTTTCTTGCCTGCTGCCCAGG + Intronic
1017798473 6:157869639-157869661 ACTGGCCTTGCCTCAAGCCCAGG + Intronic
1023877572 7:44295666-44295688 CCTCCCCCTGCCAGAAGCCCTGG - Intronic
1025228013 7:57180342-57180364 TCTTTCCTGGCCTGCAGCCCTGG - Intergenic
1025257986 7:57398633-57398655 TCTGTCCTGGCCTGAAGCCATGG + Intergenic
1026331200 7:69354028-69354050 GCTCTCCTTCCCTGCAGACTGGG - Intergenic
1026408484 7:70093692-70093714 AATCTCCTGGCCTTAAGCCCAGG - Intronic
1032201590 7:129826038-129826060 GCTGTCCACGCCTGGAGCCCGGG + Intergenic
1034215038 7:149398661-149398683 TCTCACCTTGCCTCAGGCCCGGG + Intergenic
1035563803 8:628224-628246 GCTCTGCCTGCCTGGGGCCCTGG - Intronic
1035905927 8:3510253-3510275 GCGTCCCTTGCCTGCAGCCCAGG + Intronic
1036368639 8:8143584-8143606 GTTCTACTTGCCTGGAGCTCTGG - Intergenic
1036882249 8:12522058-12522080 GTTCTACTTGCCTGGAGCTCTGG + Intergenic
1038331313 8:26611711-26611733 GCTCTCCTTGCCTTCCCCCCAGG + Intronic
1038507739 8:28100115-28100137 GCTCTCCTTGCATTCAGCACAGG - Intronic
1039892194 8:41693304-41693326 GCTCACTTTGTCTGCAGCCCTGG + Intronic
1040532113 8:48274504-48274526 CCTCGCCCTCCCTGAAGCCCTGG + Intergenic
1040545711 8:48396751-48396773 CCTCTCCCTGCCTGAGTCCCGGG + Intergenic
1042017252 8:64327779-64327801 GCTCTCCCTGCCTCCATCCCTGG + Intergenic
1043947424 8:86269966-86269988 GCTGTTCTTTCCTGCAGCCCAGG + Intronic
1047523290 8:125612173-125612195 GCTGTGCTTCCCTGGAGCCCTGG - Intergenic
1049254715 8:141607678-141607700 GCCCTCCTGGCCTGAAGCAGGGG - Intergenic
1049782401 8:144434970-144434992 GCTCCCGGTGCCTGAGGCCCTGG + Intronic
1051040940 9:12810144-12810166 CCTCTCCCTGCCAGAAGCACAGG + Intronic
1053505434 9:38639016-38639038 CCTCTCCCTTCCTGTAGCCCTGG + Intergenic
1059106683 9:111518036-111518058 GTTCTCCTTGCTTGGTGCCCTGG - Intergenic
1059697299 9:116741370-116741392 GCTCTCCTTGCCTGGTTCTCTGG + Intronic
1060261736 9:122081252-122081274 GCTCTCCTGGCTTGTAGGCCAGG - Intronic
1062037736 9:134390185-134390207 CCTCCCCTTCCCTTAAGCCCAGG - Intronic
1062319818 9:135985445-135985467 GCTCTCCCCGCCTGATTCCCAGG - Intergenic
1186192776 X:7082553-7082575 GCTCTTCTAGACTGAGGCCCAGG - Intronic
1186403625 X:9282461-9282483 TCTCTCCTTCCCTCAATCCCTGG - Intergenic
1187372542 X:18722349-18722371 TCTCTTCTTGCCTGGAGGCCAGG + Intronic
1188533744 X:31171592-31171614 GCTCTCTCTACCTCAAGCCCCGG + Intronic
1189412152 X:40781938-40781960 GCTCTCTTTGCCTGCTGCCATGG + Intergenic
1190286701 X:48966263-48966285 GCTCACCTTCAGTGAAGCCCTGG - Exonic
1191865534 X:65700598-65700620 GCTCTCCTTACCAGCACCCCAGG - Intronic
1192188846 X:68978468-68978490 GCTTTCCTGGCCTGGAGCCAGGG + Intergenic
1192808197 X:74528283-74528305 CCTTTCTCTGCCTGAAGCCCAGG + Intronic
1198078102 X:133213386-133213408 GTTCTGCTTGCCTGCAACCCTGG + Intergenic
1199008539 X:142731227-142731249 TCTCTCCTTGCCTGAACCTATGG + Intergenic