ID: 1127976448

View in Genome Browser
Species Human (GRCh38)
Location 15:64000732-64000754
Sequence GGTGCTGGAGAGCCACATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 238}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127976448 Original CRISPR GGTGCTGGAGAGCCACATGA GGG Intronic
900370925 1:2331834-2331856 GGGGCGGGAGAGCCGCACGAGGG - Intronic
900990428 1:6095985-6096007 GGGGCTGCAAAGCCACATGGAGG + Intronic
900993047 1:6106741-6106763 GGAGCTGCTGAGCGACATGAAGG - Exonic
903135809 1:21308563-21308585 GGCCCTGGACAGCCTCATGAAGG - Intronic
904829660 1:33298686-33298708 GGCCCTGGAGAGCCACAGGTGGG + Intronic
907092914 1:51745727-51745749 ACTGCTGAAGAACCACATGAGGG - Intronic
911167761 1:94739798-94739820 GGTGCTGGCCAGCCACTTGGAGG - Intergenic
914992121 1:152507885-152507907 GGTGCAGCAGAGCCACTTGATGG + Intergenic
915947437 1:160163843-160163865 GTTCCTGGATAGCCACAGGATGG - Intronic
917526545 1:175793269-175793291 GGTGCTGTGGGGCCACATGAGGG + Intergenic
919743526 1:200994643-200994665 GGCCCTGGAGAGCCTCATGAGGG - Intronic
921046463 1:211481322-211481344 GGTGCTGGAGACGCTTATGATGG - Exonic
922088428 1:222372682-222372704 AGTGCTGGAGGGCAACATGGAGG + Intergenic
922162715 1:223090161-223090183 GGAGCTGGAGAGCCAGATGAGGG - Intergenic
922552637 1:226507391-226507413 GGTGATGGATAGATACATGAGGG - Intergenic
923696146 1:236254443-236254465 GGTGATGGGAAGCCACAGGAAGG - Intronic
923766375 1:236895814-236895836 GGGGCAGGAGAGGCACAGGATGG - Intronic
924385784 1:243496969-243496991 GCTGCAGGACAGCCACAGGAGGG + Intronic
1062811255 10:467803-467825 GGTGCTGGAGGACTACAGGAGGG + Intronic
1063296263 10:4809814-4809836 GGGGCTTGAGAGCAACATCATGG + Intronic
1064028215 10:11866368-11866390 GGTGATGGAGAGGCACACGCAGG + Intronic
1064878493 10:20022474-20022496 GGTCCTTGAAAGCCACATGAGGG + Intronic
1067151085 10:43735487-43735509 GTTGCAGGACAGCCCCATGAAGG + Intergenic
1067382880 10:45791198-45791220 GGTGCTGCAGAGCCACACACTGG + Intronic
1069047359 10:63757243-63757265 TGTGCTGTAGAGTGACATGATGG + Intergenic
1069753536 10:70760194-70760216 GGGGCTACAGAGCCACCTGACGG - Intronic
1069806417 10:71127909-71127931 GGTGCTAGGGAGCCACAGCAGGG - Intergenic
1069842966 10:71351483-71351505 GGGGCTGGTGAGCCACCTTAAGG - Intronic
1069913968 10:71775849-71775871 GGCCCTGCAGAGCCACAAGATGG - Intronic
1071371652 10:84957642-84957664 GCTCCTGGAGAGCCTCAGGATGG + Intergenic
1075194645 10:120345287-120345309 GATGCTGAAGAGCCACCTGGAGG + Intergenic
1075416561 10:122268560-122268582 GGGAGTGGAGAGCAACATGATGG + Intergenic
1076469935 10:130711235-130711257 GGGGCTGGACAGCCACAGGCTGG + Intergenic
1076667918 10:132103346-132103368 GCTGCTGGAGAGGAACATCAGGG + Intergenic
1076810269 10:132882768-132882790 GGGGCTTGGGAGCCACGTGAAGG + Intronic
1077217662 11:1401769-1401791 GGTGCTGGACAGCTCCCTGAGGG - Intronic
1077536991 11:3129215-3129237 GGGGCTTCAGAGCCACATGGTGG + Intronic
1077601155 11:3575862-3575884 GATGCTGGTGACTCACATGACGG - Intergenic
1078327046 11:10389331-10389353 GGTGCTGGAGAGACAGCTGCAGG - Intronic
1078346689 11:10555957-10555979 GCAGGTGGAGAGCCACGTGATGG - Intergenic
1079279688 11:19076156-19076178 GGTGATGGAGAGTCACTTGGGGG + Intergenic
1079451048 11:20599929-20599951 GGTGCTGAAAAGCCAGATGCCGG + Intronic
1083099549 11:60288630-60288652 GGTGATGGAGTGCCACATAGTGG + Intronic
1083301381 11:61741161-61741183 GGTGCTGGAGAACTACAACAAGG + Exonic
1083939483 11:65888046-65888068 GGTGCTGCAGAGCGACACCATGG - Exonic
1084257074 11:67950437-67950459 GATGCTGGTGACTCACATGACGG - Intergenic
1084815704 11:71644831-71644853 GATGCTGGTGACTCACATGACGG + Intergenic
1084856859 11:71994960-71994982 AGTGTAGGAGAGCCACAAGAGGG + Intronic
1086974069 11:93113231-93113253 GGTGCAGTGGAGCCATATGAGGG + Intergenic
1088740399 11:112762366-112762388 TGAGCTGGAGAGACACTTGATGG + Intergenic
1089489986 11:118876882-118876904 GGTGCTGGGTAGGCACATCAAGG - Intergenic
1090154582 11:124424305-124424327 GGTGCAGGAGAGCTGCAAGAGGG + Exonic
1090269673 11:125377365-125377387 CTTGCTGGAGAGACCCATGAGGG + Intronic
1090827284 11:130396693-130396715 GGGGATGGAGAGCCCCCTGAAGG + Intergenic
1090912814 11:131136195-131136217 GGTGCAGCAGATCCACATGCAGG + Intergenic
1092427307 12:8385221-8385243 GATGCTGGTGACTCACATGACGG - Intergenic
1093171809 12:15869649-15869671 GAAGCTGGATAGCCACATGCTGG - Intronic
1095483755 12:42662758-42662780 AGAGCTGGAGAGCCACATGAAGG + Intergenic
1096639955 12:52986228-52986250 TCTGCTGGAGAGCCACAGGCAGG - Intergenic
1098069135 12:66652862-66652884 TATGGTGGAGAGCCAGATGAGGG + Intronic
1098473318 12:70870214-70870236 GGGGATGCAGAGCAACATGATGG + Intronic
1098694287 12:73532683-73532705 GATGCTGTAGAGTCACATAAAGG - Intergenic
1099458351 12:82892623-82892645 GGGACAGGAGAGCCACACGAAGG - Intronic
1101865871 12:108518965-108518987 CGTGCTGGAGATCCACAGGCGGG + Exonic
1102019620 12:109672972-109672994 GGTCCAAGAGAGCCCCATGAAGG - Intergenic
1102221110 12:111194993-111195015 TGTTCTGGAGACCCACATGCGGG + Intronic
1102245500 12:111353281-111353303 GGGGCTGGAGAGCAACGAGAAGG + Intergenic
1104198240 12:126562149-126562171 GGTGCTGGAGATACAGAAGAAGG - Intergenic
1105941054 13:25148536-25148558 GGTGCTGAAGAGCCACATGTGGG - Intergenic
1105943567 13:25171259-25171281 GGTGCTGGAGAGCGGCAGGAAGG - Exonic
1106002688 13:25739080-25739102 GGAGCAGGAGAGTCACATCATGG + Intronic
1106234942 13:27853621-27853643 GGTGCTGGAGGGGCACAGCAAGG - Intergenic
1110110557 13:71739605-71739627 GGTGCTCAAGAGCCACAGGTGGG + Intronic
1112895312 13:104292455-104292477 GAGGCAGGAGAGCCACATCAGGG - Intergenic
1114345723 14:21792657-21792679 GGTGCCGTAGAGCCTGATGAAGG + Intergenic
1115160647 14:30390005-30390027 GGTACCGTAGACCCACATGAAGG + Intergenic
1115574197 14:34694950-34694972 GGTGCTGGAGATCCAAATTAAGG + Intergenic
1116635079 14:47384280-47384302 GTTGCTGCTGAGCCACATGAGGG + Intronic
1119129786 14:72161235-72161257 GGGGCTGGGGAGCTACAGGAGGG + Intronic
1119436325 14:74600068-74600090 GGTGGGGGAGAGCCAGCTGACGG + Intronic
1121112192 14:91320164-91320186 GCTCCTGGAGAGCCTCAGGATGG + Intronic
1121717068 14:96083964-96083986 GGTGCTCAAGGGCCACCTGATGG + Intronic
1121744546 14:96278032-96278054 GGGGATGCAGAGCCACAAGATGG + Intergenic
1122135311 14:99629241-99629263 GCTGCTGGACAGCCACAGGCTGG + Intergenic
1122406424 14:101503749-101503771 AGAGCTGCAGAGCCACAAGAGGG + Intergenic
1122596660 14:102898495-102898517 GGTGCAGGCGGGCCACAGGATGG - Intronic
1122744201 14:103888416-103888438 GGTGCAGGTGAGTCACCTGAGGG + Intergenic
1123052740 14:105554237-105554259 GGGGCTGGGAAGCCACATCAAGG - Intergenic
1124555256 15:30719390-30719412 TGTGCTGGAGAACCAAATGGAGG + Intronic
1124675999 15:31686291-31686313 TGTGCTGGAGAACCAAATGGAGG - Intronic
1124989494 15:34657474-34657496 GGTGCTGGATACCCAAATGGGGG + Intergenic
1127488619 15:59441369-59441391 TGTGCTTAAGAGCCACATGTGGG - Intronic
1127857780 15:62966883-62966905 AGTGCTGGACACACACATGATGG - Intergenic
1127976448 15:64000732-64000754 GGTGCTGGAGAGCCACATGAGGG + Intronic
1128453235 15:67819315-67819337 GGTGCAAGAGAGCCTCAGGAGGG + Intergenic
1129471562 15:75758444-75758466 GGTGCTGGAGGGCGAAATGCTGG - Intergenic
1130908069 15:88253810-88253832 GGTACTGGAGGGCCTCAGGAGGG - Intronic
1131157815 15:90085553-90085575 GGCCCTGGAGACCCACAGGAGGG - Intronic
1131259251 15:90880070-90880092 TGTGCAGGAGAGCACCATGATGG - Intronic
1132814422 16:1818967-1818989 GGTGCTGGGGAGCCTCATGGTGG - Intronic
1132892724 16:2212223-2212245 GGTGCTGCAGAGCAGCATGAGGG - Exonic
1133370939 16:5245150-5245172 GATGCAGGCGAGTCACATGATGG + Intergenic
1134056811 16:11175214-11175236 GGTGCTGGCCAGGCACATGGGGG + Intronic
1136512189 16:30745411-30745433 GGGGAAGGAGAGGCACATGATGG + Intergenic
1137581400 16:49635731-49635753 AGACCTGGAGAGCCACATGCAGG - Exonic
1139613604 16:68075856-68075878 GGGGCTGCAGAGCCAAATGAGGG - Intronic
1141638801 16:85329476-85329498 GGGGCTGCAGAGCCACCTGCAGG + Intergenic
1141852704 16:86658344-86658366 GCGGCTGGAGACCCACAGGAAGG + Intergenic
1143137224 17:4718624-4718646 GGTGCTGAAGAGGCAGATGTCGG - Exonic
1143368804 17:6425675-6425697 GCTGCTGGAGAACCGCATGGCGG - Exonic
1143379772 17:6488769-6488791 AGGGGTGGAGAGCCACATAAAGG + Intronic
1143992823 17:10981119-10981141 GAGGATGGAGAGCCCCATGAGGG - Intergenic
1145393483 17:22475560-22475582 GGTTTTGGTGAGCCACTTGAGGG - Intergenic
1146482561 17:33216735-33216757 GGTGATGGGGAGCCCCAAGAGGG + Intronic
1147186589 17:38716544-38716566 GGTGGTGGAGAAGCGCATGATGG - Exonic
1147557635 17:41489486-41489508 GGAGCTGGAGAGCCGCATCCAGG - Exonic
1151358264 17:73573008-73573030 AGTGCAGGTGTGCCACATGAAGG + Intronic
1151473574 17:74332602-74332624 GGTGCTGTAGAGCCAGGTAAGGG + Intronic
1151791323 17:76307686-76307708 AGCGCTGGAGAGCCAAGTGAAGG - Intergenic
1155096086 18:22557884-22557906 GGAACAGGAGAGGCACATGAGGG + Intergenic
1155186458 18:23391127-23391149 GATGCAGGAGAACCACTTGAAGG + Intronic
1160152232 18:76404079-76404101 GGTGTTGGAGAGCCACAGAGTGG - Intronic
1162106136 19:8370978-8371000 GGTGCTTGGCAGCCAGATGAGGG + Intronic
1162126751 19:8503571-8503593 TGGGCTAGAGAGCCACAGGATGG + Intergenic
1165158732 19:33803566-33803588 GGTGCTGGAGAGTCTCGTGCTGG + Intronic
1165806371 19:38583555-38583577 TGGGCTGGGGAGCCACAAGAAGG - Intronic
1166042927 19:40214070-40214092 GGAGCTGGAGAGCTTCAAGAAGG + Exonic
1166323413 19:42034040-42034062 CGTGCTGCAGAGCCACTGGAAGG - Intronic
1166395940 19:42441196-42441218 GGGGCAGGAAAGGCACATGAAGG + Intronic
1166658122 19:44627149-44627171 GGTGCTGGGAAGCCACAGCAGGG + Intronic
1167156326 19:47741452-47741474 GGAGCTGGGGAGCCACAGCAGGG - Exonic
1167429416 19:49446074-49446096 GCGGCTGGGGAGCCACAGGAGGG + Intergenic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
1168274544 19:55270070-55270092 GGTACTGGACAGCCACACAATGG + Intronic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
925243673 2:2359119-2359141 TGGGCTGGAGAGCTACATGGTGG - Intergenic
926364552 2:12121324-12121346 GGTGCTGTAGAGGCAGAGGAGGG + Intergenic
927511452 2:23646654-23646676 GGAGCTGGAGAACCAAAGGAAGG - Intronic
930211798 2:48646910-48646932 GCTGGTGGAGAGCCCCATGAGGG - Exonic
932815228 2:74855959-74855981 GGTGCTTGTGAGGCCCATGACGG + Intronic
934020887 2:87950707-87950729 GGTGCTGGAGAACAGCAAGAAGG - Intergenic
934625898 2:95851165-95851187 GGTGTTTGAGAGCTAGATGAAGG - Exonic
934807677 2:97250152-97250174 GGTGTTTGAGAGCTAGATGAAGG + Exonic
934829833 2:97507035-97507057 GGTGTTTGAGAGCTAGATGAAGG - Exonic
937328292 2:121005423-121005445 GGTGCTGGGATGGCACATGATGG + Intergenic
937646744 2:124274226-124274248 GGTGCTGAATAGCCACATACTGG + Intronic
940599532 2:155840721-155840743 AGTGCTGGAAAGCCACTTAAAGG - Intergenic
942304301 2:174590562-174590584 GGTGCAGGAGAGACGCAAGAAGG + Intronic
942451549 2:176111383-176111405 GGGCCTGGAGATCCACACGAGGG + Intronic
946487939 2:220118936-220118958 TGTTCTTGAGAGCCACATCAAGG + Intergenic
946550025 2:220791257-220791279 GCAGCTGGAGAGCCATATGGGGG - Intergenic
946655141 2:221938207-221938229 GGTGATGGTGAGACTCATGATGG - Intergenic
947878845 2:233486932-233486954 GCTGCTGGAGAGAAACAGGAGGG + Intronic
948133652 2:235620040-235620062 GGTGCTGCAGAGGCCCAGGAAGG - Intronic
948988825 2:241541641-241541663 GGGGCTGGAGAGCGAGATGCTGG - Intergenic
1168876750 20:1177099-1177121 AGTGCTGCAGAGCCATATGCAGG - Intronic
1169342839 20:4809568-4809590 GGTGCAGGAGAGGCACAGGCTGG - Intronic
1169910018 20:10640366-10640388 GGTGCTCGAGATCCTCAGGAGGG + Intronic
1170584218 20:17722146-17722168 GTTGCTGGAGAGCCCCAGGAGGG + Intronic
1170981279 20:21215895-21215917 GGTGCTGAAAGGGCACATGATGG - Intronic
1171202594 20:23254301-23254323 GGTGCTGCAGAACCCCATGAAGG + Intergenic
1171378986 20:24718881-24718903 GGTGCTGGTGACTCACATCAAGG - Intergenic
1172030804 20:31980741-31980763 AGTGATGGAGAGCCACAGGAAGG - Intronic
1173954135 20:47017740-47017762 GTTGCTTGAGAGCGTCATGAAGG - Intronic
1174139561 20:48403616-48403638 GGTGGAGGAGAGACACCTGAAGG - Intergenic
1176062178 20:63177270-63177292 GGTGCAGGAGGGCCATGTGAGGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176666324 21:9690738-9690760 GGTGCTGGGAAGCCACAGAATGG - Intergenic
1178072442 21:28983651-28983673 TGTAATGGAGAGCCACAGGAAGG + Intronic
1180235995 21:46459458-46459480 CGTGCTGGGGTCCCACATGAGGG - Intronic
1182295760 22:29310637-29310659 GGTGCTGAGGAGCCACGTGATGG + Exonic
1184473588 22:44709177-44709199 GGTGGTGGGGAGCCACAAGCAGG - Intronic
1185340444 22:50288552-50288574 AGTGCTAGAGAGACACAGGATGG + Intronic
950584875 3:13885131-13885153 GGTGCTGGAGACAGAGATGAAGG - Intergenic
950750488 3:15124284-15124306 GATGCTGGTGACTCACATGACGG + Intergenic
952207175 3:31191711-31191733 GGTGGGGGAGAGCCAGAGGATGG - Intergenic
952445054 3:33373035-33373057 GTTGCTGGACAGCCACTAGAGGG - Intronic
953058231 3:39405296-39405318 GGAGCTGCAGAGCCACTTGCAGG + Intergenic
954234687 3:49247339-49247361 GGTGCAGGAGAGACTCATGCAGG - Intronic
954305512 3:49723406-49723428 GGTGCTGGAGAAGGAAATGAAGG - Exonic
955611671 3:60764134-60764156 GGTGATGGAGCACTACATGATGG - Intronic
960803354 3:121560337-121560359 GATACTGAAGAGCCAGATGAAGG + Intergenic
961282126 3:125772171-125772193 GATGCTGGTGACTCACATGACGG + Intergenic
961369244 3:126419487-126419509 GGTGCAGGAATGCCACATGCTGG - Intronic
961477261 3:127156736-127156758 GCTGGTGGAGGGCCACAGGAGGG - Intergenic
961755793 3:129126687-129126709 GGGGCTGGAAAGTCAGATGAGGG - Intronic
961870269 3:129982488-129982510 CGTGCTGGAAAGCAAGATGATGG + Intergenic
962587709 3:136859285-136859307 GGTGGTGGTAAGCTACATGAAGG + Intergenic
964383087 3:156118306-156118328 CTTGCTGGACAGCCACATGCAGG - Intronic
968021436 3:195394172-195394194 GGTGCTGGAGGGGCACGGGAGGG - Intronic
971375004 4:26049554-26049576 TGTCCTGGAGAGCCTCATGGGGG + Intergenic
973790324 4:54372261-54372283 GGGCCTTGTGAGCCACATGAAGG + Intergenic
976788059 4:88845113-88845135 GGTGATGGAGACCTACATTAGGG + Intronic
978451680 4:108840648-108840670 GGGGCTGGGGAGACACATAAAGG - Intronic
979495806 4:121380962-121380984 GGTGCTGGAGCGCCACGCGAGGG + Exonic
980665363 4:135926429-135926451 TGTGCTGCAAATCCACATGATGG + Intergenic
985445457 4:190019004-190019026 GGAGCTGGAGAGCCAGGGGAAGG + Intergenic
985846573 5:2354061-2354083 GGGGCTGGAGTCCCACATGCAGG - Intergenic
987261817 5:16211869-16211891 CATGCTGGAGAGTCACATGTAGG + Intergenic
989541767 5:42626646-42626668 GCTCCTGGAGAGCCTCAGGATGG - Intronic
989624115 5:43413207-43413229 AGTGCTCAAGAGCCACATGTGGG - Intergenic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
996266003 5:121541119-121541141 GATGCTGGAGAGCCTCAGGAAGG + Intergenic
996994041 5:129672707-129672729 GGTGCTGCAAACCCATATGAGGG - Intronic
999461601 5:151761459-151761481 TGTCCTGCAGAGCCACATGCTGG + Intronic
1001890843 5:175337146-175337168 GGTGCTGGGCAGCCACACTAGGG + Intergenic
1002336580 5:178483471-178483493 GGTGCTGGAAAGCCAGGAGAAGG - Intronic
1002401309 5:178992885-178992907 GGGGCTGGAGAGAAACAAGAAGG + Intronic
1003263988 6:4550284-4550306 GGTGGTGGAGTCCCACATGCTGG - Intergenic
1003607867 6:7581104-7581126 CGTGCTGGATGGCCACCTGAGGG + Exonic
1005203318 6:23372250-23372272 GGTGGTGGACAGCCATTTGAAGG + Intergenic
1006114810 6:31769922-31769944 GGTGGTGGGGAGCCCCAGGAGGG + Intronic
1006510499 6:34518716-34518738 GGTGGTGGAGAGCCACTGGAAGG - Intronic
1007782324 6:44261722-44261744 GGCGCTGGCAGGCCACATGAAGG + Exonic
1008340922 6:50363007-50363029 GGTGATAGCGAGCCACTTGATGG - Intergenic
1012353962 6:98290183-98290205 GGAGGTGGAGAGTCAAATGATGG + Intergenic
1016707257 6:147123778-147123800 GTTTCTGGAGAGATACATGAAGG + Intergenic
1017722233 6:157251742-157251764 GGAGCTGGGGAGCGACAAGAGGG - Intergenic
1018039294 6:159907557-159907579 GGTGCTGGACACCAGCATGAGGG - Exonic
1019513453 7:1429651-1429673 CGTGCAGCAGAGCCACATGGGGG + Intronic
1024935703 7:54709959-54709981 TTTGCTGGAGAGTCACATGTTGG + Intergenic
1024955502 7:54915087-54915109 GGTGCTGGAGATCAACTAGAAGG - Intergenic
1026293802 7:69032696-69032718 TGTGCAGGAGAGGCACCTGAAGG - Intergenic
1027422966 7:78035090-78035112 GGTGCTGGAGACACACTGGAGGG + Intronic
1029074272 7:97923871-97923893 GATGCTGGTGACTCACATGACGG - Intergenic
1029646722 7:101861591-101861613 AGTGCTGCAGAGGCACATGTAGG + Intronic
1032281209 7:130503367-130503389 GGTGCAGGAGAGCTGGATGAGGG + Intronic
1033317843 7:140313234-140313256 GGGGCTGGAAAACCTCATGAAGG + Intronic
1034343838 7:150373743-150373765 GGTGATGGAGGGCCAGCTGAGGG + Intronic
1036243435 8:7097417-7097439 GATGCTGGTGACTCACATGACGG + Intergenic
1036654615 8:10670119-10670141 GAGGCTGGACAGCCACATGAAGG + Intronic
1036829290 8:12009774-12009796 GATGCTGGTGACTCACATGACGG - Intergenic
1037582300 8:20252868-20252890 GGAGCTCGAGAGCCTCATGAAGG - Exonic
1038309981 8:26439057-26439079 GCTACTGGAGGGTCACATGAGGG - Intronic
1038784670 8:30601150-30601172 GGTGCTGTAGAGACACCAGAGGG - Intronic
1038798146 8:30727541-30727563 CGTGGTGGAGAGCCACAAGCTGG - Exonic
1048428345 8:134343403-134343425 GGTGTTGGAGAGCTACAGGTAGG - Intergenic
1049248918 8:141577805-141577827 GGGGCTGGAGAGCCCCAGGAGGG + Intergenic
1049790116 8:144468565-144468587 GCTGCTGGAGGGCCCCTTGAAGG - Exonic
1051083956 9:13325400-13325422 GATGCTGGAGAGACACTGGAAGG - Intergenic
1052049014 9:23824517-23824539 GGTGCTCGAGAGGCAGAGGATGG - Intronic
1052273594 9:26653361-26653383 GGTGCTGAGGAGCAGCATGAAGG + Intergenic
1052821616 9:33141877-33141899 GGGGATGGAGAGCCACCAGAAGG + Intronic
1055155775 9:73061268-73061290 GGTTCTGGAAAGACACATGGGGG - Intronic
1057669798 9:97077391-97077413 GGTGCGGGGGAGCCGCGTGACGG - Intergenic
1058582377 9:106472456-106472478 GTTGGTGGAGAGCTAGATGAGGG - Intergenic
1060190552 9:121589636-121589658 GGTGCTGGAGACACAGATGCAGG - Intronic
1060207530 9:121690952-121690974 GGGGCAGGATAGCCACATAAAGG - Intronic
1060934603 9:127507879-127507901 GGTGCTGCAGACCGTCATGAAGG - Exonic
1060975282 9:127761627-127761649 GCTGCTGGAGAGCCAGAGGCTGG - Exonic
1061675712 9:132214405-132214427 GGGGCCTGACAGCCACATGAAGG - Intronic
1203659777 Un_KI270753v1:31023-31045 GGTGCTGGGAAGCCACAGAATGG + Intergenic
1187931404 X:24296675-24296697 AGTGCTCAAGAGCCACATGTGGG - Intergenic
1189065747 X:37806449-37806471 ACTGCTGGAGAGCCAGATGCAGG + Exonic
1189273596 X:39768960-39768982 GATTCAGGAGGGCCACATGAGGG + Intergenic
1194510927 X:94793566-94793588 GGTTCTGAAGATCCAAATGATGG + Intergenic
1195943978 X:110189786-110189808 GGAGCAAGAGAGCCACATTATGG + Intergenic
1196889769 X:120280692-120280714 GGTACTGGGGAGCCACAGAAGGG - Intronic
1198029690 X:132743051-132743073 TGTGTTGCAGAGACACATGATGG - Intronic
1198177326 X:134169622-134169644 AGTGCTGGAGATACGCATGAAGG + Intergenic
1198394749 X:136209634-136209656 GGTCCTTGAGAGCCACAGCAGGG + Intronic
1198674073 X:139113239-139113261 GGTGGTGGAGAGACAGATGATGG - Intronic
1199123637 X:144088420-144088442 GGTGCTGGAGAACAGCAAGAAGG + Intergenic
1201597714 Y:15691021-15691043 GACACTGGAGAGCCAAATGAAGG - Intergenic
1201868173 Y:18677237-18677259 GGTGATGGAGAGCTACAGGAGGG - Intergenic
1202116991 Y:21477618-21477640 AGTCCTGCAAAGCCACATGATGG - Intergenic