ID: 1127982698

View in Genome Browser
Species Human (GRCh38)
Location 15:64046315-64046337
Sequence GCCTGCCGCGGCCGCGACCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 209}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127982698_1127982707 2 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982707 15:64046340-64046362 GGCGGGAGCGGCGGGCGCGGCGG 0: 1
1: 11
2: 41
3: 411
4: 3205
1127982698_1127982704 -7 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982704 15:64046331-64046353 GGCAGGCGCGGCGGGAGCGGCGG 0: 1
1: 3
2: 22
3: 177
4: 1216
1127982698_1127982714 21 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982714 15:64046359-64046381 GCGGGCGCGGCGGGCGCGGCGGG 0: 6
1: 9
2: 60
3: 294
4: 1721
1127982698_1127982716 29 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982716 15:64046367-64046389 GGCGGGCGCGGCGGGCGCGGCGG 0: 4
1: 9
2: 75
3: 433
4: 3482
1127982698_1127982711 12 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982711 15:64046350-64046372 GCGGGCGCGGCGGGCGCGGCGGG 0: 6
1: 9
2: 60
3: 294
4: 1721
1127982698_1127982715 26 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982715 15:64046364-64046386 CGCGGCGGGCGCGGCGGGCGCGG 0: 2
1: 9
2: 56
3: 275
4: 1629
1127982698_1127982705 -6 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982705 15:64046332-64046354 GCAGGCGCGGCGGGAGCGGCGGG 0: 1
1: 1
2: 18
3: 122
4: 825
1127982698_1127982703 -10 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982703 15:64046328-64046350 CGCGGCAGGCGCGGCGGGAGCGG 0: 1
1: 1
2: 9
3: 76
4: 528
1127982698_1127982708 3 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1127982698_1127982713 20 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982713 15:64046358-64046380 GGCGGGCGCGGCGGGCGCGGCGG 0: 4
1: 9
2: 75
3: 433
4: 3482
1127982698_1127982717 30 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982717 15:64046368-64046390 GCGGGCGCGGCGGGCGCGGCGGG 0: 6
1: 9
2: 60
3: 294
4: 1721
1127982698_1127982706 -1 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982706 15:64046337-64046359 CGCGGCGGGAGCGGCGGGCGCGG 0: 1
1: 3
2: 35
3: 193
4: 1423
1127982698_1127982709 8 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982709 15:64046346-64046368 AGCGGCGGGCGCGGCGGGCGCGG 0: 1
1: 6
2: 30
3: 219
4: 1334
1127982698_1127982710 11 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982710 15:64046349-64046371 GGCGGGCGCGGCGGGCGCGGCGG 0: 4
1: 9
2: 75
3: 433
4: 3482
1127982698_1127982712 17 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982712 15:64046355-64046377 CGCGGCGGGCGCGGCGGGCGCGG 0: 2
1: 9
2: 56
3: 275
4: 1629

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127982698 Original CRISPR GCCTGCCGCGGCCGCGACCG CGG (reversed) Intronic