ID: 1127982702

View in Genome Browser
Species Human (GRCh38)
Location 15:64046327-64046349
Sequence CGCTCCCGCCGCGCCTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 237}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127982702_1127982710 -1 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982710 15:64046349-64046371 GGCGGGCGCGGCGGGCGCGGCGG 0: 4
1: 9
2: 75
3: 433
4: 3482
1127982702_1127982717 18 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982717 15:64046368-64046390 GCGGGCGCGGCGGGCGCGGCGGG 0: 6
1: 9
2: 60
3: 294
4: 1721
1127982702_1127982715 14 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982715 15:64046364-64046386 CGCGGCGGGCGCGGCGGGCGCGG 0: 2
1: 9
2: 56
3: 275
4: 1629
1127982702_1127982718 23 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982718 15:64046373-64046395 CGCGGCGGGCGCGGCGGGAACGG 0: 1
1: 0
2: 10
3: 83
4: 487
1127982702_1127982721 26 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982721 15:64046376-64046398 GGCGGGCGCGGCGGGAACGGGGG 0: 1
1: 2
2: 13
3: 86
4: 819
1127982702_1127982713 8 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982713 15:64046358-64046380 GGCGGGCGCGGCGGGCGCGGCGG 0: 4
1: 9
2: 75
3: 433
4: 3482
1127982702_1127982720 25 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982720 15:64046375-64046397 CGGCGGGCGCGGCGGGAACGGGG 0: 1
1: 0
2: 6
3: 53
4: 477
1127982702_1127982708 -9 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1127982702_1127982716 17 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982716 15:64046367-64046389 GGCGGGCGCGGCGGGCGCGGCGG 0: 4
1: 9
2: 75
3: 433
4: 3482
1127982702_1127982719 24 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982719 15:64046374-64046396 GCGGCGGGCGCGGCGGGAACGGG 0: 1
1: 0
2: 3
3: 98
4: 636
1127982702_1127982714 9 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982714 15:64046359-64046381 GCGGGCGCGGCGGGCGCGGCGGG 0: 6
1: 9
2: 60
3: 294
4: 1721
1127982702_1127982709 -4 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982709 15:64046346-64046368 AGCGGCGGGCGCGGCGGGCGCGG 0: 1
1: 6
2: 30
3: 219
4: 1334
1127982702_1127982712 5 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982712 15:64046355-64046377 CGCGGCGGGCGCGGCGGGCGCGG 0: 2
1: 9
2: 56
3: 275
4: 1629
1127982702_1127982711 0 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982711 15:64046350-64046372 GCGGGCGCGGCGGGCGCGGCGGG 0: 6
1: 9
2: 60
3: 294
4: 1721
1127982702_1127982707 -10 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982707 15:64046340-64046362 GGCGGGAGCGGCGGGCGCGGCGG 0: 1
1: 11
2: 41
3: 411
4: 3205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127982702 Original CRISPR CGCTCCCGCCGCGCCTGCCG CGG (reversed) Intronic