ID: 1127982708

View in Genome Browser
Species Human (GRCh38)
Location 15:64046341-64046363
Sequence GCGGGAGCGGCGGGCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1684
Summary {0: 2, 1: 13, 2: 25, 3: 229, 4: 1415}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127982702_1127982708 -9 Left 1127982702 15:64046327-64046349 CCGCGGCAGGCGCGGCGGGAGCG 0: 1
1: 1
2: 1
3: 23
4: 237
Right 1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415
1127982698_1127982708 3 Left 1127982698 15:64046315-64046337 CCGCGGTCGCGGCCGCGGCAGGC 0: 1
1: 0
2: 0
3: 13
4: 209
Right 1127982708 15:64046341-64046363 GCGGGAGCGGCGGGCGCGGCGGG 0: 2
1: 13
2: 25
3: 229
4: 1415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127982708 Original CRISPR GCGGGAGCGGCGGGCGCGGC GGG Intronic