ID: 1127982759

View in Genome Browser
Species Human (GRCh38)
Location 15:64046504-64046526
Sequence CCGTCCCAGGCGCCGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 159}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1127982737_1127982759 30 Left 1127982737 15:64046451-64046473 CCGGCACCCGCCCGCCGAGCAGC 0: 1
1: 0
2: 3
3: 28
4: 400
Right 1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1127982744_1127982759 16 Left 1127982744 15:64046465-64046487 CCGAGCAGCCTAGGAGCCGAGGG 0: 1
1: 0
2: 0
3: 14
4: 195
Right 1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1127982749_1127982759 8 Left 1127982749 15:64046473-64046495 CCTAGGAGCCGAGGGGGCGGAGC 0: 1
1: 0
2: 1
3: 19
4: 246
Right 1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1127982741_1127982759 20 Left 1127982741 15:64046461-64046483 CCCGCCGAGCAGCCTAGGAGCCG 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1127982751_1127982759 0 Left 1127982751 15:64046481-64046503 CCGAGGGGGCGGAGCGGCCAGCC 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1127982740_1127982759 23 Left 1127982740 15:64046458-64046480 CCGCCCGCCGAGCAGCCTAGGAG 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1127982742_1127982759 19 Left 1127982742 15:64046462-64046484 CCGCCGAGCAGCCTAGGAGCCGA 0: 1
1: 0
2: 1
3: 4
4: 74
Right 1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 159
1127982739_1127982759 24 Left 1127982739 15:64046457-64046479 CCCGCCCGCCGAGCAGCCTAGGA 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG 0: 1
1: 0
2: 1
3: 11
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1127982759 Original CRISPR CCGTCCCAGGCGCCGGCTGG AGG Intronic
900124636 1:1064006-1064028 CCCACCCAGGAGCCGGCAGGAGG - Intergenic
900669410 1:3841340-3841362 CCGTCCCAGCCGCCAGCCTGTGG - Intronic
901762238 1:11478866-11478888 CCGGCCCTGGCGCCCGCGGGCGG - Intergenic
904493273 1:30873126-30873148 CAGTCCCAGGCTTGGGCTGGTGG + Exonic
906150142 1:43582818-43582840 GCCTCCCTGGCGCCTGCTGGCGG + Intronic
911176165 1:94820361-94820383 CCGGCCCCGGCCCCGGCTCGCGG + Exonic
915446567 1:155977887-155977909 CCGTCCCCTCCGCCGGATGGCGG + Intronic
915544987 1:156592017-156592039 CCGTCCCAGGCCCCGCCCCGGGG - Intronic
915936220 1:160091715-160091737 CCCTCCCAGGCCCCACCTGGAGG - Intronic
920378029 1:205519695-205519717 CCACCCCAGGCACAGGCTGGTGG + Intronic
922602967 1:226870858-226870880 CCGGCCCAGCCGCCGCCTGCCGG - Intronic
1063636626 10:7788388-7788410 CCGTCGGAGGCGCCGGGTAGCGG + Intronic
1067339142 10:45387053-45387075 GCGTGCCAGGCGCCGTGTGGAGG + Intronic
1068886154 10:62098957-62098979 TCTTGCCAGGCGCTGGCTGGCGG + Intergenic
1071298185 10:84237605-84237627 CCGCTCCAGGCGCAGTCTGGAGG + Exonic
1073286687 10:102394070-102394092 CGGTCCCGGGCGCCCTCTGGCGG - Intergenic
1074891386 10:117739181-117739203 CCGTCCCAGGTGCTCGCTGTGGG + Intergenic
1075697546 10:124447893-124447915 GCGTCCCAGGCGCCGGCGCCTGG - Exonic
1075748408 10:124743919-124743941 GCGTCCCGGCCGCTGGCTGGAGG - Intronic
1075780591 10:125014837-125014859 CCGGCCAAGGCGGCTGCTGGTGG - Intronic
1077107934 11:849942-849964 CCGGAGCAGGCGCCGGCCGGCGG + Intronic
1077184396 11:1229820-1229842 CCACCCCAGGCGGAGGCTGGTGG - Intronic
1077360723 11:2139205-2139227 CCGTCCCGGGCGCCGTCCGCGGG - Intronic
1079205629 11:18412236-18412258 CCGGCCCAGGCGCGGGCATGGGG - Intergenic
1082007567 11:47428254-47428276 CCCTCCTAGGCCCAGGCTGGAGG - Intergenic
1082025169 11:47566035-47566057 CCGTCCCAGGCTCAGGGCGGTGG - Intronic
1082223651 11:49674289-49674311 CAGTCCCAGGAGCCGTTTGGTGG + Intergenic
1083264971 11:61542399-61542421 CTGGCCCAGGCTCTGGCTGGTGG + Intronic
1083710659 11:64546374-64546396 CAGGCCCAGGGGCAGGCTGGAGG + Intergenic
1084422247 11:69066244-69066266 CCGTCCCCGGTGACTGCTGGAGG + Intronic
1085474819 11:76783256-76783278 CCCTGCCGGGCGCCGGGTGGCGG - Intronic
1086625406 11:88944972-88944994 CAGTCCCAGGAGCCGTTTGGTGG - Intronic
1089564661 11:119364294-119364316 CCGCCCCCGGCGCCGGCACGCGG + Intronic
1094017951 12:25884447-25884469 CCGGCCTAGCCGCCTGCTGGAGG + Intergenic
1097036526 12:56128273-56128295 CCGACCCAGGGACTGGCTGGAGG - Exonic
1097046267 12:56189567-56189589 CCGGCCCAGGCGGCGGGAGGCGG - Intronic
1098426050 12:70366505-70366527 GGGGCCCAGGCGGCGGCTGGGGG + Exonic
1101662036 12:106774589-106774611 CCGGCCCGGGCGGAGGCTGGCGG + Intronic
1102453250 12:113056749-113056771 CGGACGCAGGAGCCGGCTGGCGG - Intronic
1102601833 12:114037247-114037269 CCTTCCCAGCCGCCTGCTCGGGG + Intergenic
1108408362 13:50125632-50125654 CTCTCCCAGGAGCCGGCGGGGGG - Intronic
1112693022 13:101917058-101917080 GCTCCCCGGGCGCCGGCTGGAGG + Intronic
1113430442 13:110245801-110245823 CTGTCACCGGCACCGGCTGGGGG - Intronic
1113890747 13:113734489-113734511 CCGTCACAGAGGCCGTCTGGGGG + Intronic
1114269574 14:21092546-21092568 CCGGCTCCGGCTCCGGCTGGGGG + Exonic
1115028440 14:28767610-28767632 CCGTCCAGGGCGGCGGCCGGTGG - Exonic
1116018222 14:39431989-39432011 CCGGCCCCGCCGCCGGCTGCCGG + Exonic
1119226119 14:72945834-72945856 ACGTCCCAGGCTGCGCCTGGTGG - Intronic
1121739688 14:96242748-96242770 CCTTCCCAGGTACCGGCTGGTGG - Exonic
1122118637 14:99540370-99540392 CACTCCCAGGCGGGGGCTGGAGG + Intronic
1122908683 14:104815770-104815792 CTGTCCCGGGCGCCTGCTCGTGG + Intergenic
1122959169 14:105086809-105086831 CCGTCCCAGGAGCAGCCCGGTGG - Intergenic
1202899770 14_GL000194v1_random:28351-28373 CCGGCGCAGGCGCCGGGGGGGGG - Intergenic
1124637011 15:31371812-31371834 CCATCCCAGGCGTGGGCGGGAGG + Intronic
1125505592 15:40265951-40265973 CTGTGCCCGCCGCCGGCTGGTGG - Exonic
1127982759 15:64046504-64046526 CCGTCCCAGGCGCCGGCTGGAGG + Intronic
1129471633 15:75758770-75758792 CCGTCTCAGGAGCGGGATGGCGG - Intergenic
1130531153 15:84748598-84748620 GCGTCCCCAGCGCCGGCTGCGGG - Intergenic
1131828688 15:96340972-96340994 CCGTCCCTGCAGCCGGCTAGAGG - Intergenic
1133007323 16:2891341-2891363 CTGTGCCAGGCGCAGGCAGGAGG + Intronic
1133272277 16:4616103-4616125 CTGTCCCAGGCGCCGTCCAGAGG - Intergenic
1137244315 16:46689843-46689865 CCTTCCCAGGCGACGGGCGGCGG + Intronic
1137507302 16:49065413-49065435 CCCTGGCAGGCCCCGGCTGGTGG - Intergenic
1137830509 16:51539207-51539229 ACGTCCCAGGCACAGGATGGGGG + Intergenic
1138561951 16:57806399-57806421 CCCTCCCAGGCACCAGCAGGCGG + Intronic
1141694866 16:85614427-85614449 CCCTCCCCAGCGCCGGGTGGGGG + Intronic
1141770238 16:86085387-86085409 CTCTCCCAAGCGCCGGCTGGTGG - Intergenic
1141995547 16:87634596-87634618 CTGCCCCAGGCCCAGGCTGGTGG + Intronic
1142631493 17:1229177-1229199 CCGTGCCGGGAGCCGCCTGGGGG + Intergenic
1145280564 17:21464232-21464254 TCGCCCCAGGGGCCGGCGGGCGG + Intergenic
1147315347 17:39617773-39617795 CCGTGCCAGGCGCGGGGCGGGGG - Intergenic
1148819864 17:50354146-50354168 CCTTCCCAGGCGGGGGCAGGGGG + Intronic
1150414337 17:64975286-64975308 ACAACCCAGGCTCCGGCTGGGGG + Intergenic
1151684741 17:75639907-75639929 CCGGCCAAGGCGGCGGCTGGTGG - Exonic
1151933386 17:77247145-77247167 CCGCCCCGGGCGCCGCCTGCGGG + Intergenic
1152821275 17:82439095-82439117 CTGTCCCAAGCGAGGGCTGGGGG - Intronic
1152926753 17:83090930-83090952 CCATCCCACTCGCCGGCTGGGGG - Intronic
1159798074 18:72867700-72867722 CCGGCCCCGGCCCCGGCTCGGGG - Exonic
1160808289 19:1001864-1001886 CGGTCCCACGCCCCGGCTTGCGG - Intronic
1160864298 19:1250278-1250300 CCATCCCCGGCGCGCGCTGGGGG - Exonic
1161103910 19:2434009-2434031 GCGGCCCAGGCGCCCGGTGGCGG + Exonic
1161370336 19:3907818-3907840 CCGCCACAGGCGCCCGTTGGCGG - Exonic
1162754940 19:12852239-12852261 CCTTTCCAGGTGCCGGCTGGTGG + Exonic
1162910699 19:13846712-13846734 CCAGCCCAGCCCCCGGCTGGCGG + Intergenic
1164682451 19:30144880-30144902 CCGTCCCATGCCCAGGCTAGTGG - Intergenic
1164713305 19:30374796-30374818 TCCGCCCGGGCGCCGGCTGGGGG - Intronic
1165419844 19:35717440-35717462 CCGTTCCAGGCGCGACCTGGCGG - Intergenic
1165455711 19:35909428-35909450 CAGCCCCAGGCTCCAGCTGGGGG - Intergenic
1165940327 19:39411974-39411996 CCGTCCCAGCCACCAGGTGGGGG - Intergenic
1167117639 19:47497455-47497477 CTGTCCCAGGTGTCTGCTGGTGG - Intronic
1167611582 19:50510433-50510455 CCGTCCTCGGCTCCTGCTGGGGG + Exonic
927156698 2:20224978-20225000 CTGTCCCAGGCGAGGGCTGCAGG + Exonic
934670391 2:96208722-96208744 CGGCCCCGGGCGCCCGCTGGAGG - Exonic
936512197 2:113157456-113157478 CGCGCCCAGGCGCCGGCTGGGGG - Intronic
937318417 2:120946746-120946768 CCATCCCAGGCCCCAGCTGAGGG - Intronic
944433215 2:199659346-199659368 CCGCGCCCGGCGGCGGCTGGGGG - Intergenic
947820086 2:233063349-233063371 CCCTCCCAGGCCCCCTCTGGTGG + Intronic
948694374 2:239725799-239725821 CCCACCCAGGCCCAGGCTGGAGG - Intergenic
948830185 2:240594832-240594854 CTGTCCCAGGAGCCGGGAGGAGG + Intronic
948869231 2:240789974-240789996 CCCCCCCAGGCACCGGCTGTGGG - Intronic
949023279 2:241753103-241753125 CCGTCCCAGGAAGCGTCTGGAGG - Intronic
1168991712 20:2101903-2101925 CTGGCCCGGGCGCCGGCGGGAGG + Exonic
1172799214 20:37564539-37564561 TCCTCCCAGGCGCCGGGAGGCGG - Intergenic
1172808669 20:37631780-37631802 CCCTCCCAGCCGTGGGCTGGCGG + Intergenic
1174380739 20:50153850-50153872 GCGTCCCAGCCTCCGGCTCGCGG - Intergenic
1174386844 20:50192359-50192381 CCTCTCCAGGCGCCGGCGGGCGG + Exonic
1175822507 20:61918052-61918074 CCGTCCCAGCCAGCTGCTGGAGG + Intronic
1176029524 20:63005274-63005296 ACGTCCCAGGCAGCGGATGGCGG + Intergenic
1176619147 21:9043125-9043147 CCGGCGCAGGCGCCGGGGGGTGG - Intergenic
1180871433 22:19149311-19149333 CCGCCCCAGCCTCCAGCTGGCGG + Intronic
1183484740 22:38082818-38082840 CAGCCCCAGCCGCCGTCTGGGGG + Exonic
1184775633 22:46621458-46621480 CCGGTGCAGGCGCAGGCTGGAGG + Intronic
1184775657 22:46621530-46621552 CCGGTGCAGGCGCAGGCTGGAGG + Intronic
1184775681 22:46621602-46621624 CCGGTGCAGGCGCAGGCTGGAGG + Intronic
1185250878 22:49801035-49801057 CAGTCCCACGCACCTGCTGGCGG - Intronic
1185400457 22:50612933-50612955 CCGTCCTAAGGGCCGGCTGGAGG - Intronic
950168057 3:10816323-10816345 GAGTCCGAGGCGCCGGGTGGCGG + Exonic
950345320 3:12287841-12287863 CGGGCGCGGGCGCCGGCTGGGGG - Intronic
952970748 3:38649184-38649206 CCATCCCTGGCGCAGGCTCGGGG - Intronic
954795785 3:53160913-53160935 CCCTCCCAGGCCCCAGCGGGCGG + Intronic
960942301 3:122943033-122943055 CCGTCCCAGGTGCAGGCCGCCGG + Intronic
962809568 3:138949115-138949137 CCTGCCCAGGCCCTGGCTGGGGG - Intronic
963240982 3:143002006-143002028 CTCTCCCAGGCGCTGTCTGGCGG - Intronic
966866124 3:184260045-184260067 CCGGCCCAGGCGCCCGCGGGCGG - Exonic
967055194 3:185824613-185824635 CCGTCCCAGGAGCGGGCCGGCGG + Intronic
968576622 4:1369243-1369265 CAGCCCCAGGCGAGGGCTGGAGG + Intronic
968623268 4:1614195-1614217 CCATCCCAGAGGCCGGCTGTGGG + Intergenic
982202891 4:152976023-152976045 CCAGCAGAGGCGCCGGCTGGAGG + Exonic
982278201 4:153658476-153658498 CCGACCCAGGCCCCAGCTGTCGG - Intergenic
988482090 5:31639371-31639393 CAGACCCAGGCGCCGCCCGGCGG - Intergenic
995354706 5:111224398-111224420 CGTTCGCAGGCGGCGGCTGGCGG + Exonic
998364255 5:141618721-141618743 GCGCCCCAGGGGCCGGCTGCAGG + Intronic
1001415708 5:171543653-171543675 CCGCCCCTGGCGCCGTCTAGAGG - Intergenic
1003942497 6:11043791-11043813 CCGCTCCAGGCGTCGGCGGGCGG + Intronic
1004924132 6:20402645-20402667 CCGTCCCCAGCCCCGGCGGGAGG + Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1007390220 6:41546453-41546475 CCGTCCCGGCCGCCGGCCGCCGG - Exonic
1013220673 6:108074695-108074717 CTGTCCGCGGTGCCGGCTGGGGG - Exonic
1017649118 6:156564928-156564950 CAGGCCCAGGCCCCGGCTGCTGG + Intergenic
1017672413 6:156779289-156779311 CAGTCCCAGGCGGCGGCGGCGGG + Exonic
1018050499 6:160004904-160004926 CCGACCCAGCCGCCAGCTTGGGG - Intronic
1019388226 7:770646-770668 CTGGCCCAGGCCCCAGCTGGGGG - Intronic
1019497459 7:1347097-1347119 GGGTCCCAGGAGCCGGCAGGAGG - Intergenic
1019687350 7:2389034-2389056 CCATCCCAGGGGCAGGCAGGGGG + Intergenic
1019687422 7:2389284-2389306 CCATCCCAGGGGCAGGCAGGGGG + Intergenic
1019687619 7:2390461-2390483 CCATCCCAGGGGCAGGCAGGAGG + Intergenic
1022106273 7:27199882-27199904 CCGCCGCAGCCGCCGGGTGGGGG + Exonic
1022106787 7:27202417-27202439 CTGGCACAGGCGCCGGCTAGTGG - Intergenic
1023937234 7:44748747-44748769 CCGCCCCGAGCGCCGGCTCGGGG + Intronic
1024733061 7:52274084-52274106 CCATCCCAGGAGCCGGCTGGGGG - Intergenic
1026091264 7:67302675-67302697 CCGTCCGAGGCTACGACTGGGGG - Intergenic
1029456631 7:100675214-100675236 CTCTCCCAGGCGCGGGCGGGCGG - Intronic
1029635101 7:101778378-101778400 CCATCCCTGGCACAGGCTGGTGG + Intergenic
1034300762 7:150013532-150013554 CTGTCCCAGGAACAGGCTGGAGG + Intergenic
1034805289 7:154083768-154083790 CTGTCCCAGGAACAGGCTGGAGG - Intronic
1039053309 8:33514340-33514362 CTGCCCCAGACGCCAGCTGGGGG - Intergenic
1041375678 8:57207784-57207806 CCGTCCCTGGCACCGGCTCCCGG + Intergenic
1041376441 8:57212163-57212185 CCGTCCCTGGCACCGGCTCCCGG + Intergenic
1049610840 8:143554013-143554035 CCCTCCCAGACACCGGCAGGAGG - Intronic
1049654215 8:143790711-143790733 CAGTCCCGGGCCCCGGCCGGCGG + Intergenic
1051419044 9:16871760-16871782 CCGGCCCAGACGCCGGCTTGCGG + Intergenic
1053601159 9:39610922-39610944 CCGACCCAAACGCCAGCTGGGGG - Intergenic
1056082048 9:83105848-83105870 CCATCCCATGTGCCGGCTGCAGG + Intergenic
1057270889 9:93650759-93650781 CTTTCCCAGGGGCCAGCTGGAGG - Intronic
1057772948 9:97983792-97983814 CCGCCCCAGGGGCCCGCGGGCGG - Intronic
1057773221 9:97984644-97984666 CCGCCCTCGGCGCTGGCTGGCGG + Intronic
1061089775 9:128420360-128420382 CCGCCCCGGGCGCCCTCTGGCGG - Intronic
1061935881 9:133857341-133857363 CCCGCCCTGGTGCCGGCTGGGGG - Intronic
1062325907 9:136012388-136012410 CCGTCCCAGTCCCAGCCTGGAGG + Intronic
1062553105 9:137099400-137099422 CCTGCCCAGGCGCCAGGTGGAGG + Intronic
1192266656 X:69543391-69543413 CCGGCCCAGGCCCTGGCTTGAGG - Intergenic
1199767163 X:150949632-150949654 AGGTCCCAGGAGCAGGCTGGAGG - Intergenic